ID: 1096973407

View in Genome Browser
Species Human (GRCh38)
Location 12:55684875-55684897
Sequence CACTCTAAGGGGAAGTTGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 157}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096973397_1096973407 10 Left 1096973397 12:55684842-55684864 CCTGTCCCTGATTTACCCACTCT 0: 1
1: 0
2: 2
3: 8
4: 185
Right 1096973407 12:55684875-55684897 CACTCTAAGGGGAAGTTGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 157
1096973396_1096973407 11 Left 1096973396 12:55684841-55684863 CCCTGTCCCTGATTTACCCACTC 0: 1
1: 0
2: 1
3: 15
4: 236
Right 1096973407 12:55684875-55684897 CACTCTAAGGGGAAGTTGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 157
1096973392_1096973407 23 Left 1096973392 12:55684829-55684851 CCTACCCCATGGCCCTGTCCCTG 0: 1
1: 1
2: 1
3: 85
4: 753
Right 1096973407 12:55684875-55684897 CACTCTAAGGGGAAGTTGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 157
1096973394_1096973407 18 Left 1096973394 12:55684834-55684856 CCCATGGCCCTGTCCCTGATTTA 0: 1
1: 0
2: 1
3: 21
4: 156
Right 1096973407 12:55684875-55684897 CACTCTAAGGGGAAGTTGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 157
1096973400_1096973407 -5 Left 1096973400 12:55684857-55684879 CCCACTCTCATCTCACAGCACTC 0: 1
1: 0
2: 1
3: 17
4: 338
Right 1096973407 12:55684875-55684897 CACTCTAAGGGGAAGTTGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 157
1096973391_1096973407 24 Left 1096973391 12:55684828-55684850 CCCTACCCCATGGCCCTGTCCCT 0: 1
1: 1
2: 5
3: 59
4: 596
Right 1096973407 12:55684875-55684897 CACTCTAAGGGGAAGTTGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 157
1096973393_1096973407 19 Left 1096973393 12:55684833-55684855 CCCCATGGCCCTGTCCCTGATTT 0: 1
1: 0
2: 1
3: 25
4: 261
Right 1096973407 12:55684875-55684897 CACTCTAAGGGGAAGTTGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 157
1096973398_1096973407 5 Left 1096973398 12:55684847-55684869 CCCTGATTTACCCACTCTCATCT 0: 1
1: 0
2: 0
3: 11
4: 211
Right 1096973407 12:55684875-55684897 CACTCTAAGGGGAAGTTGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 157
1096973399_1096973407 4 Left 1096973399 12:55684848-55684870 CCTGATTTACCCACTCTCATCTC 0: 1
1: 0
2: 0
3: 12
4: 198
Right 1096973407 12:55684875-55684897 CACTCTAAGGGGAAGTTGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 157
1096973395_1096973407 17 Left 1096973395 12:55684835-55684857 CCATGGCCCTGTCCCTGATTTAC 0: 1
1: 1
2: 3
3: 21
4: 270
Right 1096973407 12:55684875-55684897 CACTCTAAGGGGAAGTTGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 157
1096973401_1096973407 -6 Left 1096973401 12:55684858-55684880 CCACTCTCATCTCACAGCACTCT 0: 1
1: 1
2: 8
3: 48
4: 519
Right 1096973407 12:55684875-55684897 CACTCTAAGGGGAAGTTGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096973407 Original CRISPR CACTCTAAGGGGAAGTTGGG TGG Exonic
901815519 1:11791323-11791345 CACCCTGAGGGGATGTGGGGTGG + Exonic
901931349 1:12597722-12597744 CCCTTTGAGGGGAACTTGGGAGG + Intronic
902461042 1:16576977-16576999 CTCACTAAGGGTAAGTGGGGTGG + Intronic
902461823 1:16583254-16583276 CTCACTAAGGGTAAGTGGGGTGG + Intronic
902462603 1:16589559-16589581 CTCACTAAGGGTAAGTGGGGTGG + Intronic
903521853 1:23956751-23956773 GACTCTCAGGGGAAGAAGGGAGG + Intergenic
906821431 1:48934413-48934435 CTCTCTAAAGTGAAATTGGGAGG + Intronic
909150903 1:72003374-72003396 CACTCTAAAGGGATTTTGGCAGG + Intronic
909715453 1:78701965-78701987 CATTGGAAGGGGAATTTGGGAGG + Intergenic
910837282 1:91528507-91528529 CATTTTATGGGGAAGTTGGGTGG - Intergenic
913249922 1:116904810-116904832 CCCTCTAAGGGGACATTAGGTGG - Intergenic
913602877 1:120438960-120438982 CTCACTAAGGGTAAGTGGGGTGG - Intergenic
913603625 1:120445313-120445335 CTCACTAAGGGTAAGTGGGGTGG - Intergenic
913604382 1:120451599-120451621 CTCACTAAGGGTAAGTGGGGTGG - Intergenic
913640486 1:120808027-120808049 CTCACTAAGGGTAAGTGGGGTGG - Intronic
913641255 1:120814311-120814333 CTCACTAAGGGTAAGTGGGGTGG - Intronic
913743004 1:121870119-121870141 CATTCCAAGGGGAATTTTGGAGG - Intergenic
914084161 1:144437605-144437627 CTCACTAAGGGTAAGTGGGGTGG + Intronic
914212037 1:145588597-145588619 CTCACTAAGGGTAAGTGGGGTGG + Intergenic
914277230 1:146136017-146136039 CTCACTAAGGGTAAGTGGGGTGG + Intronic
914277995 1:146142314-146142336 CTCACTAAGGGTAAGTGGGGTGG + Intronic
914364051 1:146962577-146962599 CTCACTAAGGGTAAGTGGGGTGG - Intronic
914487629 1:148124563-148124585 CTCACTAAGGGTAAGTGGGGTGG + Intronic
914538277 1:148586965-148586987 CTCACTAAGGGTAAGTGGGGTGG + Intronic
914539041 1:148593262-148593284 CTCACTAAGGGTAAGTGGGGTGG + Intronic
914587979 1:149079717-149079739 CTCACTAAGGGTAAGTGGGGTGG + Intronic
914627638 1:149478362-149478384 CTCACTAAGGGTAAGTGGGGTGG - Intergenic
915405594 1:155657525-155657547 CACTGTGAGGGGAACTTGGCAGG + Intergenic
915467373 1:156105423-156105445 CACTCTCAGGAGGAGTGGGGAGG - Intronic
919998127 1:202773105-202773127 CAGCCTAAGGGTAAGTTTGGGGG - Exonic
922205400 1:223441997-223442019 AACTCTAAGGGGAAGTTATATGG + Intergenic
922231205 1:223688325-223688347 CACTTTGAGGTGAAGGTGGGAGG - Intergenic
923056418 1:230429304-230429326 AAATCAAAGAGGAAGTTGGGTGG + Intergenic
1065025251 10:21534626-21534648 CCATCTAAGAGGGAGTTGGGGGG - Exonic
1070417690 10:76205808-76205830 AACTCTTGGGGGAAGTTGGCTGG + Intronic
1070458101 10:76637893-76637915 CAGTCTAGGGTGAAGATGGGAGG + Intergenic
1077491809 11:2864431-2864453 CACCCTGAGGGGAAGGTGGATGG - Intergenic
1081390604 11:42524594-42524616 CACTGTAAAGGAAAGTAGGGAGG + Intergenic
1085100107 11:73793632-73793654 AACTCCTAGAGGAAGTTGGGAGG + Intronic
1085614453 11:77985213-77985235 CACTCTGAGGGGAAGTATGGAGG - Intronic
1085872995 11:80372306-80372328 CACTCTTAGTGGAGGTCGGGGGG + Intergenic
1085915509 11:80882935-80882957 AACTATAAGGGGAACTTGGAAGG + Intergenic
1088559213 11:111096060-111096082 CCCTCTAATGGGAAGTGGGGTGG + Intergenic
1089495021 11:118903376-118903398 CTCGCTGAGGGGCAGTTGGGTGG + Exonic
1091302039 11:134514069-134514091 CACTCTATGGAGCAGGTGGGAGG + Intergenic
1091914231 12:4256634-4256656 CACTCTCTGGGTAAATTGGGAGG + Intergenic
1096219689 12:49821260-49821282 CAGGCTGAGGGGAAGTTGGGGGG - Intronic
1096749450 12:53749403-53749425 CAGACTAAGGGGAAATGGGGAGG + Intergenic
1096973407 12:55684875-55684897 CACTCTAAGGGGAAGTTGGGTGG + Exonic
1098912420 12:76222628-76222650 CACTCTAAGGGAAAGGTGACTGG + Intergenic
1105333948 13:19446472-19446494 TAATCTAATTGGAAGTTGGGGGG - Intronic
1105860983 13:24412895-24412917 TAATCTAACTGGAAGTTGGGGGG + Intergenic
1112765267 13:102735052-102735074 CACATTAAGGTGAAGTGGGGAGG + Exonic
1113675873 13:112207694-112207716 GACTTTCTGGGGAAGTTGGGTGG - Intergenic
1114550186 14:23528294-23528316 CAATCCAAGGGAAAGTGGGGAGG - Intronic
1114579965 14:23748425-23748447 CAATCTGAGGGGAAGAAGGGTGG - Intergenic
1118425144 14:65652333-65652355 CAATATAAGAGGAAGTTGGCTGG + Intronic
1122606358 14:102949242-102949264 AACTCTAAGAGGAAGTGGGAAGG + Intronic
1127511904 15:59650738-59650760 AACTTGAAGGGCAAGTTGGGGGG + Exonic
1128614131 15:69096268-69096290 CAGTCTCAGGGGAGGCTGGGAGG - Intergenic
1128984314 15:72208071-72208093 CACTCTCAGAGGAAGATGTGTGG - Intronic
1129756129 15:78100343-78100365 CACGGGAAGGGAAAGTTGGGTGG + Intronic
1130535964 15:84785127-84785149 CCCTTTGAGGGGAAGTTGAGTGG - Intronic
1137355925 16:47763647-47763669 CTCTGGAAGGGGAAGTAGGGGGG - Intergenic
1138201090 16:55089061-55089083 CCCTCAAAGGGGTAGTTGGGTGG - Intergenic
1139479916 16:67224871-67224893 CATTGAAAGGGGAATTTGGGAGG - Intronic
1139568695 16:67796776-67796798 TACTATATAGGGAAGTTGGGAGG - Intronic
1140259222 16:73362766-73362788 CACTCTAATGTGAAATTAGGGGG + Intergenic
1140733318 16:77875823-77875845 CACTGTAAAGGGAGGTTAGGAGG + Intronic
1143370676 17:6437087-6437109 CCTTCTCAGGGGAAGTTGGGAGG + Intergenic
1148716536 17:49719866-49719888 GACCCTGAGGGGAAGCTGGGAGG + Exonic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1150369583 17:64625170-64625192 CACCCAAAGGGGAAGGTGTGTGG - Intronic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1152005648 17:77678686-77678708 CACTCCATGGGGATGTTGTGAGG + Intergenic
1152078921 17:78174663-78174685 CACTCCAGGAGGAAGTCGGGAGG - Exonic
1152461131 17:80443159-80443181 CATTCTAAGTGGGGGTTGGGGGG + Intergenic
1155148695 18:23105318-23105340 CACTTTAAGGGGAAATTGATGGG - Intergenic
1157290466 18:46406241-46406263 CACTCTCTGGGGAGGTTGAGAGG - Intronic
1157606954 18:48931905-48931927 CACCCTGGGGGGAAGGTGGGGGG + Intronic
1160313809 18:77821790-77821812 GACTAAGAGGGGAAGTTGGGGGG - Intergenic
1161665342 19:5572703-5572725 CACTCTCCGGGGAAGGTGGGCGG + Intergenic
1162321652 19:9974143-9974165 CACTCCCAGAGGAAGGTGGGAGG - Intronic
1164516851 19:28943949-28943971 CACTCTAGGAGGAAGGTTGGAGG - Intergenic
1166047579 19:40238505-40238527 CTCTGTAAGGGGAAGCTGAGCGG + Intronic
1167697888 19:51025697-51025719 CACTTTACGGGGAAATCGGGAGG + Intronic
1202677475 1_KI270711v1_random:20717-20739 CTCACTAAGGGTAAGTGGGGTGG + Intergenic
1202678260 1_KI270711v1_random:27001-27023 CTCACTAAGGGTAAGTGGGGTGG + Intergenic
925231168 2:2235276-2235298 CCCTCTAAGGGGAAGCTCTGAGG - Intronic
925231178 2:2235345-2235367 CCCTCTAAGGGGAAGCTCTGAGG - Intronic
925231191 2:2235414-2235436 CCCTCTAAGGGGAAGCTGTGAGG - Intronic
927604147 2:24471083-24471105 CACTCTCAGAGTAATTTGGGAGG + Intergenic
930722189 2:54648353-54648375 CACTCTGGGGAGAAGTTGGAGGG + Intronic
932810032 2:74817500-74817522 CTTGCTAAGGGGAAGTGGGGCGG - Intergenic
933709415 2:85314714-85314736 GACACGAAGGGGAAGATGGGAGG + Intergenic
934521002 2:95020201-95020223 CACTCTAAGGGGCGGGGGGGGGG + Intergenic
937990624 2:127660046-127660068 CACTGAAAGGGGAAGCTGGCTGG + Intronic
938622255 2:133068300-133068322 TGCTCTGAGGGGAAGCTGGGAGG - Intronic
938764373 2:134450584-134450606 CAGTCTAAGAGGAGGGTGGGGGG + Exonic
941086976 2:161129325-161129347 GACTCCAGGGGGATGTTGGGAGG - Intergenic
945552526 2:211237764-211237786 CAAGCGAAGGGGAAGTTGGGTGG - Intergenic
946578970 2:221105824-221105846 CATTCTAGGGGGAAATTGGTGGG - Intergenic
947843330 2:233223634-233223656 CACTCAAAGGGGATTTTGGGGGG + Intronic
947897450 2:233688882-233688904 CAATCTTGGGAGAAGTTGGGGGG + Intronic
948643626 2:239390582-239390604 CACTCTAAGGGGATTTTTGGGGG - Intronic
1169302796 20:4458926-4458948 CACACTGAGAGGAAGTTGTGGGG + Intergenic
1169369671 20:5019055-5019077 CACTTTAAGGCCAAGGTGGGTGG + Intergenic
1170980487 20:21207567-21207589 CCCTCTAAGGGAAAGGGGGGAGG - Intronic
1172174259 20:32962520-32962542 CACTCTGCTGGGAGGTTGGGAGG + Intergenic
1173073271 20:39790885-39790907 CACTGTAAGGGCAAGGTGGGAGG + Intergenic
1173403719 20:42746968-42746990 CACTCTAAGGGGCACATGGTGGG + Intronic
1176840518 21:13838559-13838581 CACTCGGAGGGAAGGTTGGGGGG + Intergenic
1180055399 21:45356432-45356454 CAGTCTAAGGGGATGCTGGCAGG - Intergenic
1181621801 22:24096322-24096344 CACCCTAAGGGGAAGTCCTGGGG + Intronic
950014706 3:9747461-9747483 CAGTCTCAGGGGAAGCTGGGTGG + Exonic
951117943 3:18887165-18887187 CAGTCAAAGCAGAAGTTGGGGGG - Intergenic
954420652 3:50417406-50417428 AACTCTAAAGGGCACTTGGGGGG + Intronic
957394302 3:79619596-79619618 CTCTCTAAGAGGAAGTTGTTGGG - Intronic
964199725 3:154105557-154105579 CACGCAAAGGGGATGTTGGGGGG - Intergenic
964794911 3:160486183-160486205 CAGTCTAAGGGGAAGTTTCTTGG + Intergenic
968885509 4:3328998-3329020 AACTCCAAGGGGAAGTTGTCAGG + Intronic
969217680 4:5735145-5735167 CACTCTCTGGGGCAGTGGGGAGG + Intronic
973606039 4:52588587-52588609 GACTCTAAGGGGAGGTGTGGAGG + Intergenic
976264809 4:83180528-83180550 CAGGGTAAGGGGAAGTTGGGGGG - Intergenic
976491641 4:85677382-85677404 CACTCTAAGGGACAGCAGGGAGG - Intronic
982376144 4:154692918-154692940 CACTCTGAGGAAAAGGTGGGAGG + Intronic
985509258 5:302966-302988 CTTCCCAAGGGGAAGTTGGGAGG + Intronic
985739013 5:1603926-1603948 CTTCCCAAGGGGAAGTTGGGAGG - Intergenic
985767212 5:1786308-1786330 GACCCCAAGGGGGAGTTGGGTGG + Intergenic
986525839 5:8674057-8674079 CAATTCAAGGGGAATTTGGGTGG - Intergenic
988227980 5:28438219-28438241 CACAGAAAGGGGAAGTTGAGGGG + Intergenic
989998511 5:50864139-50864161 CACTCTCAAGGGAGGGTGGGTGG + Intergenic
990565185 5:57020913-57020935 CTCTCTAAGGGGAAATTGTTGGG + Intergenic
991086830 5:62655601-62655623 TACTTTTAGAGGAAGTTGGGGGG + Intergenic
995563355 5:113407298-113407320 CACTTTAAGGAGAAACTGGGTGG + Intronic
1002184570 5:177448028-177448050 CCCGCTGAGGGGAGGTTGGGAGG - Intronic
1003646870 6:7919995-7920017 CACGCTAAGGCGGAGGTGGGAGG + Intronic
1004111895 6:12726830-12726852 GACTCTGAGGGGCAGGTGGGAGG - Intronic
1005276965 6:24229896-24229918 CTCTCAAAGGGGAAGTGGTGGGG - Intronic
1005312024 6:24567898-24567920 GTTTCTAAGGGGAAATTGGGAGG - Intronic
1005921230 6:30403618-30403640 CACACTTAGGGGCAGTAGGGAGG + Intergenic
1016150292 6:140732935-140732957 TATTTTAAGGGGAAGTTGAGAGG - Intergenic
1016190154 6:141255283-141255305 CACTCTGACTGGGAGTTGGGTGG - Intergenic
1018312482 6:162525359-162525381 CAGGCTCAGGGGAGGTTGGGTGG - Intronic
1019420755 7:949670-949692 CAGTCTAGGCTGAAGTTGGGGGG + Intronic
1019774608 7:2905265-2905287 AAATGTAAGGGGAAGTTTGGGGG - Intergenic
1021244331 7:18243518-18243540 CACTCTGAGTGGAATTTGGAAGG - Intronic
1021440023 7:20667483-20667505 CAGTCTAAGGAGAATTTGAGAGG - Intronic
1023297926 7:38735890-38735912 CAATCCAAGGGGCAGTTGGGAGG + Intronic
1027265674 7:76494052-76494074 GAGTCTAGGGGGAGGTTGGGAGG + Intronic
1027317044 7:76992169-76992191 GAGTCTAGGGGGAGGTTGGGAGG + Intergenic
1029585309 7:101467054-101467076 CCCTCCAAGGGGAATTTGGTTGG - Intronic
1032679523 7:134167613-134167635 CACTCTTAGGGGCAGCTGGTGGG + Intronic
1033434013 7:141315887-141315909 CATACTGATGGGAAGTTGGGAGG - Intronic
1035787647 8:2274907-2274929 GACTCCAAGGGGAAGGAGGGAGG - Intergenic
1035805163 8:2446809-2446831 GACTCCAAGGGGAAGGAGGGAGG + Intergenic
1036387909 8:8297760-8297782 CACTCTTGGTGGAAGTTGGAGGG - Intergenic
1036395616 8:8368131-8368153 CAAACTACTGGGAAGTTGGGGGG + Intronic
1039229439 8:35427145-35427167 AATTCAAAGGGGTAGTTGGGGGG - Intronic
1039381709 8:37091943-37091965 CACTTCACGGGGATGTTGGGAGG - Intergenic
1040633970 8:49250421-49250443 CACTCAAAGAGGAGGTAGGGAGG - Intergenic
1049398730 8:142415322-142415344 CACACTAGGGGGAAGAAGGGAGG - Intergenic
1053248844 9:36557813-36557835 CACTGTAAGGGGATGTCGGGTGG - Intergenic
1057525037 9:95791547-95791569 TACTCTAAAGGAAAGTAGGGGGG - Intergenic
1058295831 9:103305254-103305276 CTCTCTATGGAGAAGTTTGGAGG - Intergenic
1058747696 9:108007899-108007921 AACTCCAATGGGAAGGTGGGAGG - Intergenic
1062314114 9:135957217-135957239 CAGGCTGAGGGGATGTTGGGGGG + Intronic
1187341553 X:18425756-18425778 CACTCTCAGGAGAAGCTGGGTGG - Intronic
1188147353 X:26630238-26630260 TATTCCAATGGGAAGTTGGGGGG + Intergenic
1188297276 X:28464545-28464567 CACTCTAAGGGTAGGTAGGTAGG - Intergenic
1189360643 X:40348171-40348193 GACTCTCAGAGGAAGGTGGGTGG - Intergenic
1191758785 X:64624591-64624613 CACAGGAAGGGGAGGTTGGGAGG - Intergenic
1192549047 X:72039202-72039224 GACTCTTAGGGATAGTTGGGAGG + Intergenic
1196264549 X:113626802-113626824 CACTATAGAGGGGAGTTGGGTGG - Intergenic
1200120352 X:153787288-153787310 CACACTTAGGGGAGGTGGGGTGG - Intronic
1200731558 Y:6748419-6748441 GACTCAAGGGGGAAGGTGGGAGG - Intergenic