ID: 1096973950

View in Genome Browser
Species Human (GRCh38)
Location 12:55687957-55687979
Sequence CTGTGGAAGGTGAGGCTTGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1169
Summary {0: 2, 1: 0, 2: 5, 3: 99, 4: 1063}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096973950_1096973959 29 Left 1096973950 12:55687957-55687979 CCTCCAAGCCTCACCTTCCACAG 0: 2
1: 0
2: 5
3: 99
4: 1063
Right 1096973959 12:55688009-55688031 GCCCAGCCAGTACAGCCAGGAGG 0: 1
1: 0
2: 0
3: 33
4: 203
1096973950_1096973958 26 Left 1096973950 12:55687957-55687979 CCTCCAAGCCTCACCTTCCACAG 0: 2
1: 0
2: 5
3: 99
4: 1063
Right 1096973958 12:55688006-55688028 GCAGCCCAGCCAGTACAGCCAGG 0: 1
1: 0
2: 1
3: 24
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096973950 Original CRISPR CTGTGGAAGGTGAGGCTTGG AGG (reversed) Exonic
900250571 1:1666642-1666664 CTGTGGGAGGCTAGGCGTGGGGG + Intronic
901492728 1:9604741-9604763 ATGTGGCAGGTGCGGCGTGGAGG - Intronic
901574698 1:10191495-10191517 GTGTTGGAGGTGAGGCTTGGTGG - Intergenic
901835243 1:11919861-11919883 CTGTAGATGGTGAGTGTTGGCGG - Exonic
902044114 1:13512847-13512869 GTTTGGAAGAGGAGGCTTGGGGG - Intronic
902167963 1:14587756-14587778 GTGTTGAAGGTGGGGCCTGGTGG - Intergenic
902505252 1:16935709-16935731 CAGTGGAAGGCCAGGCTTGGTGG - Intronic
902526739 1:17063770-17063792 TTGTGGAAGGTGAGGGATTGAGG + Intergenic
902584826 1:17432336-17432358 CTGTGGAAGGAGAGGCCTCTGGG + Intronic
902597769 1:17520843-17520865 CTGGGAAAACTGAGGCTTGGAGG + Intergenic
902615143 1:17619478-17619500 CAGGGGAAGGGGTGGCTTGGGGG + Intronic
902719006 1:18291857-18291879 CTGTGGCAGGTGACGGATGGTGG + Exonic
902892251 1:19452754-19452776 CTGCCGAAGGTGGGGCTTGGAGG - Intronic
902927746 1:19708004-19708026 GTGTTGAAGGAGAGGCCTGGTGG - Intronic
903339294 1:22643944-22643966 CTGGGGAATGAGAGGGTTGGGGG + Intronic
903543651 1:24110535-24110557 CTGTGGAGGGTCAGTCTTAGTGG + Intronic
903796076 1:25929851-25929873 CTGTGGAATGTGGGGTTGGGGGG - Intergenic
904224575 1:29005346-29005368 GTGTTGGAGGTGGGGCTTGGTGG - Intronic
904312486 1:29637981-29638003 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
904314739 1:29652929-29652951 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
904354927 1:29932843-29932865 CTCTGGGAAGGGAGGCTTGGTGG - Intergenic
904428896 1:30449202-30449224 CTGTTGATGGTGAGGCTCGATGG + Intergenic
904605844 1:31697144-31697166 GTCTGGAAGGTGATGCCTGGAGG - Intronic
904929362 1:34074117-34074139 ATGTGGGAGGTGGGGCCTGGTGG - Intronic
904982206 1:34515329-34515351 TTGTTGGAGGTGGGGCTTGGTGG - Intergenic
905092728 1:35442364-35442386 CTGTGGAGGGAGAGGCTGGGAGG + Intronic
905275360 1:36814130-36814152 CTGTGGGAGGTGCTGCTTGATGG + Intronic
906017992 1:42600101-42600123 GTGTTGAAGGTGGGGCCTGGTGG - Intronic
906108870 1:43310250-43310272 AGGCGGAAGGTGAGGCTTGATGG - Intronic
906286162 1:44589161-44589183 CTGGGGAAAGTGAAGTTTGGTGG - Intronic
906603004 1:47145398-47145420 CTGGGGGAGTTGAGGCTTGGTGG - Intronic
906941183 1:50256868-50256890 ATGTGAAAGATGAGGCTTGGGGG - Intergenic
907066577 1:51490276-51490298 ATGTGGAAGGCCAGGCATGGTGG + Intronic
907073920 1:51562164-51562186 GTGTTGGAGGTGAGGCCTGGTGG + Intergenic
907330601 1:53668876-53668898 CTCTGTATGGTGAGGGTTGGGGG + Intronic
907654181 1:56325476-56325498 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
907799279 1:57748734-57748756 GTGTGGAAGGTTAGACTAGGTGG + Intronic
907919722 1:58901254-58901276 CTGGAGAAGGTGGGGGTTGGGGG + Intergenic
908261262 1:62340895-62340917 ATGAGGAACCTGAGGCTTGGAGG - Intergenic
908473037 1:64463019-64463041 CTGTGGAAACTGGGTCTTGGAGG + Intergenic
908820690 1:68083208-68083230 ATGTTGGAGGTGAGGCCTGGTGG - Intergenic
909740673 1:79025997-79026019 TTGTTGAAGGTGGGGCCTGGTGG + Intergenic
909877671 1:80829480-80829502 GTGTTGAAGGTGGGGCTTGGGGG + Intergenic
910619870 1:89241814-89241836 CTGTTGAAGGTGGGGTCTGGTGG + Intergenic
910966902 1:92816965-92816987 CTGTGGAGGGTGAGGCCTCAAGG - Intergenic
910990681 1:93052939-93052961 GTGTTGAAGGTGGGGCCTGGAGG - Intergenic
911249925 1:95563830-95563852 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
911886082 1:103301193-103301215 ATGTTGAAGGTGGGGCCTGGTGG - Intergenic
912410856 1:109479848-109479870 CTGCTGCAGGTGAGGGTTGGGGG + Exonic
912665770 1:111578199-111578221 CGGTGGAAGGGGAGGATTGGTGG + Intronic
912965906 1:114237468-114237490 GGGTGGAAAGTGAGGCTCGGAGG - Intergenic
913139909 1:115930887-115930909 GTGTTGGAGGTGAAGCTTGGTGG + Intergenic
914927660 1:151902699-151902721 CTATGGAAGCTGAGGCGTGGTGG + Intronic
915730115 1:158047392-158047414 CAGGGGAAGGTCAGGCTGGGTGG + Intronic
916088017 1:161285281-161285303 CTGGGGATGGTTAGACTTGGAGG - Exonic
916409345 1:164529979-164530001 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
916604363 1:166326400-166326422 ATGGGGAAGGTGAGGCTTGAGGG - Intergenic
917369103 1:174269319-174269341 ATGTGGAAAGTGAGACTTTGAGG + Intronic
917444047 1:175091831-175091853 CTTTGGGAGGTGAAGCTGGGTGG - Intronic
917995448 1:180433993-180434015 ATGTGTAGGGTGAGGCATGGAGG - Intronic
918524534 1:185451182-185451204 CTGTGAAGGGAGAGGCTAGGGGG + Intergenic
918631094 1:186719399-186719421 ATGTTGGAGGTGAGGCATGGTGG + Intergenic
918666526 1:187157658-187157680 CTGTTGGAGGTGGGGCCTGGTGG + Intergenic
918687845 1:187442041-187442063 GTGTTGAAGGTGTGGCCTGGTGG + Intergenic
918736094 1:188065505-188065527 GTGTTGAAGGTGGGACTTGGTGG + Intergenic
918918731 1:190676713-190676735 ATGTGGAGGGAGAGGCCTGGTGG + Intergenic
919000265 1:191822935-191822957 ATGTGGGAGGTGGGTCTTGGTGG + Intergenic
919219909 1:194614661-194614683 CTGTGGGGGGTCAGGCATGGTGG - Intergenic
919767338 1:201135902-201135924 CTGGGGAAGGTAAGGCTTTGGGG - Intronic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
919986167 1:202676882-202676904 ATGTTGAAGGAGAGGCCTGGTGG + Intronic
920142473 1:203827911-203827933 CTAAGGAAAGTGAGGCTTAGAGG + Intronic
920161953 1:204005439-204005461 GTGTTGAAGGTGGGGCCTGGTGG + Intergenic
920162583 1:204010660-204010682 ATGTTGAAGGTGGGGCCTGGAGG + Intergenic
920362504 1:205429121-205429143 CTGTGGAGGGTAAGGGATGGTGG - Intronic
920380029 1:205529803-205529825 CTGAGGAAACTGAGGCATGGAGG - Intronic
920533312 1:206721055-206721077 GTGTGGGAGGTGGGGCCTGGTGG + Intronic
920735949 1:208533188-208533210 CTGTGGAGAGAGATGCTTGGGGG - Intergenic
920850424 1:209624546-209624568 GTGGAGAATGTGAGGCTTGGAGG - Intronic
921922845 1:220688089-220688111 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
922163634 1:223097024-223097046 GTGTGGAAGGTGGGGCCTGGTGG - Intergenic
922297923 1:224268334-224268356 ATGAGGAAAGTGAGGCTTAGAGG + Intronic
922707216 1:227795824-227795846 CTGAGGAAGGAGGGGGTTGGGGG - Intergenic
922785407 1:228280079-228280101 CTGTGGAAGGTGGGGCATGAGGG + Exonic
923021864 1:230170888-230170910 ATGTTGGAGGTGAGGCCTGGTGG - Intronic
923035928 1:230285161-230285183 ATGTTGGAGGTGAGGCGTGGTGG - Intergenic
923297094 1:232604675-232604697 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
923325301 1:232875357-232875379 TTGGGCAAGGGGAGGCTTGGGGG - Intergenic
923417239 1:233775390-233775412 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
923504633 1:234594882-234594904 GTGTGGGAGGTGGGGCCTGGTGG - Intergenic
923590154 1:235310776-235310798 CTCAGGAAGTTGAGGCTGGGAGG - Intronic
923621226 1:235581143-235581165 GTGTTGAAGGTGGGGCCTGGTGG + Intronic
923885102 1:238146004-238146026 GTGTTGAAGGTGGGGCATGGTGG + Intergenic
924791871 1:247258176-247258198 CTATGGAAGGCCAGGCGTGGTGG - Intergenic
1063559378 10:7112259-7112281 GTGTGGAGGGAGAGGCCTGGTGG + Intergenic
1063765514 10:9135901-9135923 ATGTTGTAGGTGAGGCCTGGTGG - Intergenic
1064464189 10:15562906-15562928 ATGTGGGAGGTGGGGCCTGGTGG + Intronic
1065244392 10:23742707-23742729 ATGTTGGAGGTGGGGCTTGGTGG - Intronic
1065741455 10:28800704-28800726 CTGTGAATGGAGAGGTTTGGTGG + Intergenic
1065856116 10:29831736-29831758 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1065870618 10:29953158-29953180 ATGTTGGAGGTGAGGCCTGGTGG - Intergenic
1065964684 10:30761601-30761623 GTGTTGAAGGTGGGGCCTGGTGG - Intergenic
1066291395 10:34017444-34017466 CTGGGGCACCTGAGGCTTGGAGG + Intergenic
1067479468 10:46585518-46585540 CTGTGGGAGGTCCGGCTAGGAGG - Intronic
1067615270 10:47756280-47756302 CTGTGGGAGGTCCGGCTAGGAGG + Intergenic
1068153277 10:53162295-53162317 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
1068285189 10:54924259-54924281 TTGTGGAAGGAGAGCCTAGGAGG - Intronic
1068422452 10:56812824-56812846 CTGTGGAAGGTGTGACTTGGTGG + Intergenic
1068654655 10:59562381-59562403 CTGTGGCAGTTGATGCTTGATGG + Intergenic
1069592034 10:69648081-69648103 GTGTGGCAGGTGGGGCATGGAGG + Intergenic
1070410421 10:76134271-76134293 CTGATGATGGTGAGACTTGGCGG + Intronic
1070772543 10:79090762-79090784 TTGTGGGAGCTGAGGTTTGGGGG + Intronic
1071110998 10:82156372-82156394 ATGAGGAAGTTGAGGCCTGGGGG - Intronic
1071173869 10:82900230-82900252 ATTTTGAAGGTGGGGCTTGGTGG - Intronic
1071189503 10:83082935-83082957 CTGTTGGAGGTGGGGCCTGGTGG + Intergenic
1071257396 10:83883827-83883849 CTGTTGGAGGTGGGGCCTGGTGG + Intergenic
1071471549 10:85987373-85987395 AGGGGGAAGGTAAGGCTTGGAGG - Intronic
1071481601 10:86069069-86069091 CTGGGGAAGGTTAGGTTGGGAGG + Intronic
1071630671 10:87216231-87216253 CTGTGGGAGGTCCGGCTAGGAGG + Intergenic
1071739343 10:88339122-88339144 CTGTGGAATGTGAGGATTTGTGG + Intronic
1071928996 10:90444484-90444506 GTGTTGAAGGTGGGGCCTGGTGG + Intergenic
1072200857 10:93157645-93157667 GTGTTGAAGGTGGGGCCTGGTGG + Intergenic
1072446400 10:95502507-95502529 CTCTGGAAGGTGAGTGATGGGGG - Intronic
1072820695 10:98554158-98554180 CTGGGAGAGGTAAGGCTTGGAGG - Intronic
1073002214 10:100294201-100294223 CAGAGGAAGGGGAGTCTTGGAGG + Intronic
1073229692 10:101958648-101958670 CTGTGGAAGGTGGGGGTTTGTGG - Intronic
1073579869 10:104655625-104655647 TTGTTGGAGGTGGGGCTTGGTGG + Intronic
1073865209 10:107795328-107795350 CTCGGGAAGCTGAGGTTTGGAGG - Intergenic
1074100269 10:110349149-110349171 GTGTTGAAGGTGGGGCCTGGTGG - Intergenic
1074156754 10:110806569-110806591 ATGTTGAAGGTGGGGCCTGGTGG - Intronic
1074671333 10:115795816-115795838 GTGTTGAAGGTGGGGCCTGGTGG - Intronic
1075048393 10:119164365-119164387 GTGAGGAAGCTGAGGCTTAGAGG + Intronic
1075312978 10:121430262-121430284 ATGTTGGAGGTGGGGCTTGGTGG - Intergenic
1075555434 10:123427493-123427515 CTGTGGAAGGTGCGGACTGGAGG - Intergenic
1075672175 10:124270303-124270325 TTGGGGAAGGTGAGGCTGGAGGG - Intergenic
1075717617 10:124566148-124566170 CTGGAGAAGGTGATGCTGGGAGG - Intronic
1076205873 10:128602254-128602276 CTGTGGATGGTGAGGCTGTTGGG - Intergenic
1076412582 10:130262505-130262527 CAGTGGATGGTGAGCCATGGGGG + Intergenic
1076693591 10:132236401-132236423 ATGAGGAAGCTGAGGCTGGGTGG + Intronic
1077088148 11:765048-765070 CTGGGGCAGGTGATGCTTAGGGG - Intergenic
1077162193 11:1118943-1118965 CAAGGGAAGGTGAGGCGTGGGGG + Intergenic
1077243094 11:1521671-1521693 CTTTGGAAGGTGAAGGTGGGTGG + Intergenic
1077273092 11:1690956-1690978 CTGTGGGAGGTGGGGCTGGCAGG + Intergenic
1077439320 11:2560631-2560653 GTGTGGAAGGGGAGGCTGAGGGG - Intronic
1077559865 11:3253219-3253241 CTGAGGAAGTTAAGGTTTGGGGG + Intergenic
1077565758 11:3299022-3299044 CTGAGGAAGTTAAGGTTTGGGGG + Intergenic
1077753067 11:4994827-4994849 CTGTGAGTGGTGAGGCTTGAAGG - Intergenic
1077792521 11:5456767-5456789 TTGCTGAAGGTGGGGCTTGGTGG + Intronic
1078516945 11:12030667-12030689 GTGTTGGAGGTGGGGCTTGGTGG + Intergenic
1078964492 11:16322218-16322240 ATGTTGGAGGAGAGGCTTGGTGG + Intronic
1079224705 11:18595384-18595406 CTGGGGGAGGTGGGGCTAGGTGG - Intergenic
1079264679 11:18919891-18919913 CTGTGGATGGAGAGGAATGGGGG + Intergenic
1079637781 11:22766098-22766120 ATGTTGAAGGTGGGGCATGGTGG - Intronic
1079733887 11:23971295-23971317 TTGTTGAAGGTGGGGCCTGGTGG + Intergenic
1079992583 11:27262062-27262084 GTGTTAAAGGTGAGGCCTGGTGG - Intergenic
1080426017 11:32154871-32154893 ATGTGGAAGCTAAGGCTTAGAGG - Intergenic
1080812206 11:35715979-35716001 ATGTTGAAGGTGGGGCCTGGTGG - Intronic
1080826650 11:35854175-35854197 CTGAGGAAGTAGAGGCATGGTGG - Intergenic
1081050215 11:38330784-38330806 CTGTGGAAAGTGTGGCTCAGCGG + Intergenic
1081051890 11:38351445-38351467 ATGTTGAAGGTGAGACCTGGTGG - Intergenic
1081068508 11:38578313-38578335 ATGTTGGAGGTGAGGCCTGGTGG - Intergenic
1081167550 11:39824289-39824311 CTGTTGAAGGTGGGGCCTGGTGG - Intergenic
1081245867 11:40765174-40765196 GTGTTGGAGGTGGGGCTTGGTGG + Intronic
1081752626 11:45522836-45522858 GTGTTGAAGGTGGGGCCTGGTGG - Intergenic
1081967885 11:47180441-47180463 CTGAAGGAGGTGAGGCTGGGTGG - Exonic
1082093022 11:48105167-48105189 ATGGGGAGGGAGAGGCTTGGGGG - Intronic
1082824673 11:57568650-57568672 CTGGGGAAGATGAGACTTGTTGG + Intergenic
1082966791 11:58974203-58974225 CTGTTGTAGGGCAGGCTTGGTGG - Intronic
1083196343 11:61090833-61090855 CTGTGGAAGAGGAGGCCTGGCGG + Intergenic
1083404998 11:62450652-62450674 CGGTGGGAGCAGAGGCTTGGAGG - Intronic
1083574044 11:63776385-63776407 ATGTGGAGGGTGAGGCCAGGTGG + Intergenic
1083689134 11:64396183-64396205 CTGAGGAAGGAGAAGCTTAGAGG - Intergenic
1083891154 11:65596387-65596409 CTGTGGCAGGGGAGAGTTGGGGG + Intronic
1084302256 11:68259411-68259433 CTGTGTGAGCTGTGGCTTGGGGG - Intergenic
1084410387 11:69003197-69003219 CTGGGGAGGGTGGGACTTGGAGG + Intergenic
1084792251 11:71482272-71482294 CTGTGCACGGTGTGGCCTGGTGG + Intronic
1085241778 11:75062493-75062515 ATGTTGAACGTGGGGCTTGGTGG + Intergenic
1085600468 11:77851548-77851570 ATGTTGGAGGTGGGGCTTGGTGG + Intronic
1085885480 11:80517186-80517208 ATGCTGAAGGTGGGGCTTGGTGG + Intergenic
1086313330 11:85561066-85561088 CTGTGTAAGGCCAGGCATGGTGG + Intronic
1086365810 11:86109443-86109465 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
1086729441 11:90229263-90229285 GTCTTGAAGGTGAGGCCTGGTGG - Intergenic
1087301243 11:96439032-96439054 GTGTTGGAGGTGAGGCTTGGTGG - Intronic
1087430377 11:98046048-98046070 CTGAGGAAAGTGTGCCTTGGTGG + Intergenic
1087732758 11:101797250-101797272 CTGGGGAAGTAGGGGCTTGGGGG + Intronic
1087958129 11:104315412-104315434 CTGTTGATGGTGATGCCTGGAGG + Intergenic
1088112008 11:106272371-106272393 CTGTTGAATCAGAGGCTTGGGGG - Intergenic
1088449713 11:109968420-109968442 CTGTGGAAGGTTGGGGTAGGAGG - Intergenic
1088459972 11:110072530-110072552 ATGTGGAAGGTGGGGTTTGGGGG - Intergenic
1088460253 11:110075225-110075247 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
1088976849 11:114823362-114823384 CTGAGGAAGGTGAAGCTGGCCGG - Intergenic
1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG + Intronic
1089783098 11:120888037-120888059 TTGAGGAAGGGGAGGCTAGGCGG - Intronic
1089841924 11:121426022-121426044 CTGTGGGAGGTGGGGCCTGCTGG - Intergenic
1089896533 11:121935707-121935729 CTGTTGGAGGTGGGGCCTGGAGG - Intergenic
1089905006 11:122029760-122029782 CTGTGGGAATTGGGGCTTGGAGG - Intergenic
1089970575 11:122689882-122689904 ATGTGTAAGGTGAGGTATGGGGG + Intronic
1090441403 11:126728259-126728281 ATGGGAAAGCTGAGGCTTGGGGG - Intronic
1090507117 11:127328084-127328106 GTGTTGGAGGTGAGGCCTGGTGG + Intergenic
1090860348 11:130647464-130647486 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1091047939 11:132341884-132341906 ATGGGGAAACTGAGGCTTGGAGG - Intergenic
1091187721 11:133661547-133661569 CTGTCTAAGGTGAGACTTAGAGG + Intergenic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1091749591 12:3014155-3014177 CTGTGGAAGCTGAGGCTGAGAGG - Intronic
1091945722 12:4539549-4539571 CAGTGGGAGGTGAGGTTAGGGGG + Intronic
1092054515 12:5497707-5497729 CTGAGATAGGAGAGGCTTGGAGG + Intronic
1092488713 12:8925557-8925579 ATGTGGAAGGAGAGTGTTGGAGG + Intronic
1092786179 12:12029063-12029085 GTGTTGAAGGTGGGGCCTGGTGG + Intergenic
1093047171 12:14460711-14460733 CTGTAGAAGCTGAGGCTGGGAGG - Exonic
1093157756 12:15708241-15708263 ATGAGGAAAGTGAGGCTTAGAGG - Intronic
1093440853 12:19194038-19194060 ATGTTGGAGGTGAGGCCTGGTGG - Intronic
1094282232 12:28753104-28753126 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
1094603704 12:31932743-31932765 ATGTGTAGGGTGAGGTTTGGGGG + Intergenic
1094660414 12:32465322-32465344 CTGTTAAAGGTGAGGGCTGGGGG - Intronic
1095226609 12:39685551-39685573 GTGTTGGAGGTGGGGCTTGGTGG - Intronic
1095520453 12:43058269-43058291 CTGTTGAAGATGGGGCCTGGTGG + Intergenic
1095528619 12:43158089-43158111 ATGTCGAAGGTGGGGCCTGGTGG - Intergenic
1095804662 12:46305352-46305374 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
1095872875 12:47050231-47050253 ATGTTGGAGGTGAGGCCTGGTGG - Intergenic
1096160398 12:49371862-49371884 GTGTTGAAGGTGGGGCCTGGTGG - Intronic
1096370302 12:51063843-51063865 GTGCGGAAGGGGAGGCTTGAGGG + Exonic
1096550329 12:52367862-52367884 CTGGGTTAGGTGAGACTTGGGGG + Intergenic
1096973950 12:55687957-55687979 CTGTGGAAGGTGAGGCTTGGAGG - Exonic
1096993775 12:55826421-55826443 CTTTGGGAGGCCAGGCTTGGTGG - Intronic
1097022067 12:56027572-56027594 CTGGGGAAGGTGTGGATTAGAGG - Intronic
1097058362 12:56264294-56264316 CTTTGGGAGGTGAAGGTTGGTGG - Intergenic
1097088534 12:56487598-56487620 CTAGGGAAGGTGAGGACTGGCGG + Intronic
1097755967 12:63407060-63407082 TTGTTGGAGGTGGGGCTTGGTGG - Intergenic
1097770932 12:63584422-63584444 CTGTGGAAAGTGAGGATTGGAGG - Intronic
1097851721 12:64417438-64417460 CTGGGGAAGCTGAGGCCAGGAGG + Intronic
1098571148 12:71988638-71988660 ATGTTGAAGGTGGGGCCTGGTGG - Intronic
1098734515 12:74081959-74081981 ATGTTGGAGGTGGGGCTTGGTGG + Intergenic
1098736789 12:74114671-74114693 CTGTGGGAGGTATGGCATGGTGG + Intergenic
1099449989 12:82796851-82796873 CTGGGGAAACTGAGGCTTAGAGG - Intronic
1099807742 12:87541990-87542012 GTGTTGGAGGTGAGGCCTGGTGG + Intergenic
1099898867 12:88682371-88682393 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
1099979668 12:89583843-89583865 TTGAGGAAGGTGAGGCAAGGTGG + Intergenic
1100237165 12:92672511-92672533 CTGTGGCAGGCCAGGCGTGGTGG + Intergenic
1100437387 12:94584138-94584160 GTGTTGGAGGTGAGGCCTGGTGG + Intronic
1100915915 12:99421797-99421819 GTGTTGGAGGTGGGGCTTGGTGG + Intronic
1101342944 12:103859179-103859201 CTGTTGACAGTGAGGCCTGGAGG + Intergenic
1102094040 12:110220983-110221005 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1102303805 12:111790131-111790153 ATGGGGAAACTGAGGCTTGGGGG - Intronic
1102810455 12:115819721-115819743 GTGTTGAAGGTGAGACCTGGTGG - Intergenic
1103200508 12:119084191-119084213 CTGTAGAAGGTGAATATTGGAGG + Intronic
1103253139 12:119518134-119518156 CTCTGGAAGGTGGCACTTGGAGG + Intronic
1103746992 12:123131681-123131703 CAGTGGAAGGTGTGGCTGGCTGG - Intronic
1104110156 12:125697196-125697218 GTGTTGGAGGTGGGGCTTGGTGG + Intergenic
1104370850 12:128222775-128222797 ATGTTGGAGGTGAGGCCTGGTGG - Intergenic
1104882505 12:132082348-132082370 CTGTGGAGGGAGAGACTGGGGGG + Intergenic
1104898855 12:132177028-132177050 CTGCGGAGACTGAGGCTTGGTGG + Intergenic
1105257515 13:18753906-18753928 ATGTTGAAGGTGGGGCATGGGGG - Intergenic
1105258294 13:18759721-18759743 CTGTTGTAGGTGGGGCCTGGTGG - Intergenic
1105260177 13:18773221-18773243 ATGTTGAAGGTGGGGCCTGGGGG - Intergenic
1105260951 13:18779021-18779043 CTGTTGTAGGTGGGGCCTGGTGG - Intergenic
1105714195 13:23045810-23045832 CTGTTGCACGTGGGGCTTGGTGG - Intergenic
1106143039 13:27026969-27026991 TTGTGGCAGGTGAGGATGGGTGG - Intergenic
1106336905 13:28791703-28791725 ATTAGGAAGGTGAGGCTTAGAGG - Intergenic
1106677554 13:31977129-31977151 CTGAGGAAACTGAGGCCTGGGGG - Intergenic
1107472635 13:40704638-40704660 TTGTTGAAGGTGGGGCCTGGTGG + Intergenic
1107699433 13:43033146-43033168 ATGTGGGAGGTGGGGCCTGGTGG - Intronic
1107851209 13:44575481-44575503 CTGAGGAAGGTGGGGCTGGTTGG + Exonic
1107872809 13:44762576-44762598 ATGTTGGAGGTGAGGCCTGGTGG - Intergenic
1107966713 13:45603997-45604019 CTGTGGATGGTGAGGTTTCTGGG + Intronic
1108004836 13:45935838-45935860 CTGTGGCAGTTGTGGGTTGGTGG - Intergenic
1108385555 13:49896219-49896241 CTGTGGAAGGTCAAGGTGGGTGG + Intergenic
1108527944 13:51301712-51301734 ATGTTGGAGGTGAGGCCTGGCGG - Intergenic
1108809278 13:54201452-54201474 ATGTGGGAGGTGGGGCCTGGTGG + Intergenic
1109009600 13:56923307-56923329 ATGTTGGAGGTGAGGCCTGGTGG - Intergenic
1109549633 13:63876598-63876620 AAGTGGGAGGTGAGGCCTGGTGG + Intergenic
1110360689 13:74621435-74621457 GTGTTGGAGGTGAGGCCTGGTGG + Intergenic
1110406468 13:75156025-75156047 GTGTGGGAGGTGGGGCGTGGTGG - Intergenic
1110512373 13:76366185-76366207 TTGTTGGAGGTGAGGCCTGGTGG + Intergenic
1110542072 13:76718037-76718059 CTGTTGGAGGTGAAGCCTGGTGG - Intergenic
1110587221 13:77207950-77207972 CTGGGGCGGGTGGGGCTTGGTGG - Intronic
1111291635 13:86178584-86178606 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
1111333750 13:86793503-86793525 CTGTTGGAGGTGAGGCCTAGTGG - Intergenic
1111447890 13:88373885-88373907 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1111578621 13:90192700-90192722 ATGTTGGAGGTGGGGCTTGGTGG + Intergenic
1111659763 13:91194286-91194308 GTGTTGGAGGTGAGGCCTGGCGG + Intergenic
1111815502 13:93147792-93147814 CTTTGGCGGGTGGGGCTTGGGGG + Intergenic
1112093792 13:96110378-96110400 ATGTTCAAGGTGAGGCCTGGAGG - Intronic
1112260399 13:97873015-97873037 ATGTTGGAGGTGAGGCTTGGTGG - Intergenic
1112718292 13:102212421-102212443 CTGTGGGAGGTGAAGGGTGGAGG - Intronic
1113001160 13:105638959-105638981 ATGTTGGAGGTGAGACTTGGTGG + Intergenic
1113320512 13:109228203-109228225 ATGTTGGAGGTGAGGCCTGGTGG - Intergenic
1113418967 13:110155136-110155158 CTTTGGAAGGGGATGGTTGGAGG + Intronic
1113476258 13:110583610-110583632 GTGTGGGAGGTGGGGCCTGGTGG + Intergenic
1113711965 13:112471336-112471358 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1113959119 13:114116017-114116039 GTGTGGATGTTGAGGCCTGGAGG + Intronic
1113963286 13:114137963-114137985 CTGTGGATGCCGAGGCCTGGTGG + Intergenic
1114421162 14:22584282-22584304 CTCTGGAAGGTGAGCCCTTGAGG - Intronic
1115349825 14:32381882-32381904 CTGAGGCAGGTGAGGGTTTGAGG - Intronic
1115806322 14:37055922-37055944 GTGTTGGAGGTGAGGCCTGGTGG + Intronic
1115880634 14:37913783-37913805 CTGTTGGAGGTGGGGCCTGGTGG + Intronic
1115971577 14:38950589-38950611 CTGTTGAAGGTAGGGCCTGGTGG + Intergenic
1115972621 14:38962829-38962851 ATGTTGAAGGTGAGACCTGGTGG + Intergenic
1116255302 14:42547632-42547654 GTGTTGAAGGTGGGGCCTGGTGG - Intergenic
1117081507 14:52156829-52156851 CGGTGGCAGGTGGGGTTTGGGGG + Intergenic
1117165641 14:53029924-53029946 GGGTGGAGGGTGAGGGTTGGAGG - Intergenic
1117886861 14:60372724-60372746 ATGTTGAAGGTGGGGCCTGGTGG + Intergenic
1117898039 14:60508037-60508059 GTGAGGAAGGAGTGGCTTGGTGG - Intronic
1117933399 14:60872315-60872337 ATGTTGAAGGTGAGGCCTAGTGG - Intronic
1118691611 14:68345342-68345364 GTGTTGGAGGTGGGGCTTGGTGG + Intronic
1118717791 14:68572610-68572632 CTTTGGCAGGTGAGCCGTGGGGG - Intronic
1118780601 14:69005312-69005334 CTAGGGAAGGTGAGGCTGGGAGG - Intergenic
1118861632 14:69668708-69668730 GTGTTGAAGTTGGGGCTTGGTGG + Intronic
1118973382 14:70656053-70656075 GTGGGGAAGGTGAAGCTTAGAGG - Intronic
1118991259 14:70799252-70799274 TTGGGGAAGCTGAGGCTTGAGGG - Intronic
1118993463 14:70816776-70816798 ATGTGGGAGGTGGGGCCTGGTGG - Intergenic
1119052489 14:71383825-71383847 GTGTGGAAGGTGGGGCCTGCTGG - Intronic
1119208329 14:72811222-72811244 ATGTTGGAGGTGAGGCCTGGTGG - Intronic
1119666488 14:76488766-76488788 TTGTGGAAGGGGAGCCTTGAGGG - Intronic
1119695091 14:76707035-76707057 GTGTGGAGGGAGAGGCGTGGGGG - Intergenic
1119884376 14:78128120-78128142 ATGAGGAAAGTGAGGCTCGGTGG + Intergenic
1119925516 14:78489824-78489846 CTGTCCAAGATGAGGCATGGTGG + Intronic
1120357247 14:83450430-83450452 GTGTTGGAGGTAAGGCTTGGTGG - Intergenic
1120710229 14:87785749-87785771 CTCTTGAATGGGAGGCTTGGAGG + Intergenic
1121330247 14:93045170-93045192 TTGTGAGAGGTGAGGCTTGGAGG - Intronic
1121365654 14:93307258-93307280 CTTGGGAGGCTGAGGCTTGGAGG - Intronic
1121419742 14:93804739-93804761 CCCTGGAAGGTGAGCATTGGAGG + Intergenic
1121450534 14:94004387-94004409 GTTTGGAAGACGAGGCTTGGGGG + Intergenic
1121643807 14:95503969-95503991 CAGTGGAGGGTGAGTCTTGCAGG - Intergenic
1121664909 14:95665068-95665090 ATGGGGAAGGTGAGGCCTGGAGG + Intergenic
1122126261 14:99580166-99580188 CAGAGGAAGGAGAGGCTGGGTGG + Intronic
1122146416 14:99691562-99691584 CTGTGGAAACTGAGGCCTGCTGG + Intronic
1122462562 14:101907638-101907660 GTGAGGAAGGTGAGACTTGGAGG + Intronic
1122605860 14:102947381-102947403 CTGTGGCAGGTTAGGCATGAAGG - Intronic
1122707236 14:103629093-103629115 CTGGGGAAACTGAGGCTGGGTGG - Intronic
1122986344 14:105213337-105213359 CTCTGGAAGGTGAGGCCAGCAGG + Intronic
1202898441 14_GL000194v1_random:22934-22956 GAGTGGAAGGTGAGGTTTGAGGG - Intergenic
1123457741 15:20441316-20441338 GAATGGAAGCTGAGGCTTGGAGG + Intergenic
1123660329 15:22559101-22559123 CAATGGAAGCTGAGGCTTGGAGG - Intergenic
1123775544 15:23575561-23575583 GTGTTGGAGGTGGGGCTTGGTGG + Intronic
1125396744 15:39257143-39257165 CTGTGGAAGGTGAGATTTTGGGG - Intergenic
1125457285 15:39872836-39872858 ATGCTGGAGGTGAGGCTTGGTGG - Intronic
1126155903 15:45565425-45565447 GTGTTGAAGGTGGGGCCTGGTGG + Intergenic
1126210942 15:46099554-46099576 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
1126290463 15:47070775-47070797 CTGTTGAAGGAGGGACTTGGTGG + Intergenic
1126593392 15:50361780-50361802 GTGTTGGAGGTGAGGCCTGGTGG + Intergenic
1126739393 15:51762211-51762233 CTGTGGTAGGCCAGGCTGGGAGG + Intronic
1127070861 15:55287458-55287480 ATGTGGAAGGCCAGGCATGGTGG + Intronic
1127233661 15:57023827-57023849 CTGTGGATGGTGAGGGTTGTAGG + Intronic
1127358831 15:58226938-58226960 GTGTGGAGAGTGAGGGTTGGGGG + Intronic
1127639969 15:60907236-60907258 GTATGGAAGAAGAGGCTTGGAGG + Intronic
1127755726 15:62090161-62090183 GTGTTGGAGGTGGGGCTTGGTGG + Intergenic
1127848194 15:62889977-62889999 CTGTGTGAGCAGAGGCTTGGAGG + Intergenic
1128476832 15:68004614-68004636 GTGTTGGAGGTGGGGCTTGGTGG + Intergenic
1128549399 15:68588507-68588529 CTGTGGAAGGCGAGGGAAGGTGG + Intronic
1128752683 15:70160491-70160513 CAGTGGAAGGTCAGGCCTGAAGG + Intergenic
1129087036 15:73104933-73104955 GTGTTGGAGGTGAGGCCTGGTGG - Intronic
1129229533 15:74189101-74189123 CTCTGGAAGGTGAGGCCTCCAGG - Exonic
1129997116 15:80016514-80016536 GTGTGGAAGGAGAGGCAGGGGGG + Intergenic
1130093714 15:80840904-80840926 CTAATGAAGGTGAGGCATGGTGG - Intronic
1130840922 15:87700706-87700728 GTGTTGGAGGTGAGGCCTGGTGG + Intergenic
1131177580 15:90219712-90219734 GTGTGGAAGGGGGGGCTCGGCGG + Intronic
1131236158 15:90698786-90698808 CTGGGGAAGGTGTTGGTTGGCGG + Intergenic
1131314154 15:91318038-91318060 CTGTGGAAGCAGAGGCTGGAGGG - Intergenic
1131549201 15:93342069-93342091 GTGCTCAAGGTGAGGCTTGGGGG + Intergenic
1131612086 15:93975978-93976000 ATGTTGGAGGTGGGGCTTGGTGG + Intergenic
1131927433 15:97401157-97401179 CTGGGGATGCTGAGGCCTGGAGG - Intergenic
1132231399 15:100187150-100187172 GTGTGTAAGGTGAGACTTGCTGG + Intronic
1132561103 16:594389-594411 CTGTGGATGTTGGGGCCTGGTGG + Intronic
1132906228 16:2284129-2284151 CTGTGGGAGGTGGGGCAAGGCGG + Intronic
1132981464 16:2740438-2740460 GTGAGGAAGGTGAGGCTGGAGGG - Intergenic
1133036759 16:3037940-3037962 ATGAGGAAGCTGAGGCTCGGAGG + Intergenic
1133366918 16:5217489-5217511 CTGGGGAGGCTGTGGCTTGGTGG + Intergenic
1133595129 16:7283603-7283625 CTGAGGACGGTGAGGCTGAGTGG - Intronic
1133646967 16:7773725-7773747 GTGTTGAAGGTGGGGCCTGGTGG - Intergenic
1133712146 16:8411673-8411695 CTGTGGTGGGTGGGGCTTTGAGG - Intergenic
1133817478 16:9209221-9209243 CTGTGGAAGGAGACGCCTGGAGG + Intergenic
1134009010 16:10837390-10837412 ATGTTGGAGGTGGGGCTTGGTGG + Intergenic
1134013789 16:10874442-10874464 CTGTGGCAGGTGAGGGTGTGGGG - Intergenic
1134914490 16:18058532-18058554 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
1135053019 16:19207636-19207658 ATGTTGGAGGTGAGGCCTGGTGG - Intronic
1135151730 16:20012898-20012920 ATGTTGAAGGTGGGGCCTGGTGG - Intergenic
1135930539 16:26732589-26732611 GTGTTGGAGGTGAGGCTGGGTGG + Intergenic
1136099751 16:27985234-27985256 CTGTTGAAGGTGGGGATTGATGG + Intronic
1136429170 16:30186949-30186971 CTGCGGGAGGAGGGGCTTGGGGG + Intronic
1137327006 16:47450098-47450120 CTGTGGAAGGAGCGGAGTGGTGG + Intronic
1137442940 16:48511476-48511498 CTGTGGAGGGTGAGCCTTACAGG - Intergenic
1137499600 16:49000347-49000369 CTGTGGAAAGTGACCTTTGGGGG + Intergenic
1137727907 16:50669513-50669535 GTGTTGAAGGTGTGGCCTGGTGG - Intronic
1138122621 16:54412614-54412636 CTTTGGGAGGTCAGGGTTGGAGG + Intergenic
1138133574 16:54502252-54502274 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1138379768 16:56591645-56591667 ATGAGGAAGCTGAGGTTTGGAGG - Intergenic
1138443269 16:57047567-57047589 CAGAGGCGGGTGAGGCTTGGGGG - Exonic
1138503827 16:57466243-57466265 GGGTGGAATGTGAGGTTTGGTGG + Intronic
1138622029 16:58219166-58219188 GTGTTGAAGGTGGGGCCTGGAGG - Intergenic
1138828428 16:60350421-60350443 CTTGGGAAGGTGAGGCATGAGGG - Intergenic
1139351533 16:66339288-66339310 GTGTTGGAGGTGAGGCCTGGCGG + Intergenic
1139806115 16:69566385-69566407 CTGTGGGGGGTGGGGCGTGGGGG + Intronic
1139828902 16:69780758-69780780 CTTTGGAAGGTGGGGCTGGGAGG + Intronic
1139836294 16:69841351-69841373 CTGAGGAAGCTGAGACTTGGAGG + Intronic
1140556232 16:75924674-75924696 ATGTTGAAGGTGGGGCTTGGTGG + Intergenic
1140608532 16:76570392-76570414 ATGTTGGAGGTGAGGCCTGGTGG + Intronic
1140760648 16:78105759-78105781 CAGTGGAAGCTGAGCCTTGTTGG - Intronic
1141474860 16:84266038-84266060 CTGAGAAAGCTGAGGCCTGGAGG + Intergenic
1141490509 16:84369180-84369202 CTGTAGGAAGTGAGGCTGGGAGG - Intronic
1141576001 16:84963938-84963960 GTGTGGAGGGTGAGGACTGGTGG - Intergenic
1141616138 16:85210682-85210704 CTGTGTAAGTTGAGGCTGGGAGG + Intergenic
1142286640 16:89174137-89174159 ATGTGGAAGAAGAGGCATGGAGG - Intronic
1142556778 17:783622-783644 CTGTGTAAGGCCAGGCATGGTGG - Intronic
1143550582 17:7627937-7627959 CTGTCGGGGGTGGGGCTTGGGGG - Intronic
1143741480 17:8957267-8957289 CAGTGGAATGGGAGGCTTCGTGG - Intronic
1144165226 17:12604171-12604193 CCATGGAACGTGAGGCTCGGAGG + Intergenic
1144780939 17:17808119-17808141 CAGTGGCTGGTGAGGCTTTGGGG + Intronic
1144952012 17:18999502-18999524 ATGAGGAAACTGAGGCTTGGTGG - Intronic
1144968899 17:19094689-19094711 GTGAGGAAGCTGAGGCTTAGAGG + Intronic
1144979017 17:19157377-19157399 GTGAGGAAGCTGAGGCTTAGAGG - Intronic
1144989205 17:19220855-19220877 GTGAGGAAGCTGAGGCTTAGAGG + Intronic
1145025227 17:19463205-19463227 ATGTTGGAGGTGGGGCTTGGAGG + Intergenic
1146267254 17:31461014-31461036 CTGTGGATGGTGAGAGTTGGTGG - Intronic
1146456589 17:33014065-33014087 CTCTGGAAGGGAAGGGTTGGTGG + Exonic
1146653412 17:34621127-34621149 CTGGGGAAACTGAGGCTCGGAGG + Intronic
1146953374 17:36921649-36921671 CTGTGGAAGGTGAGGCTTGGCGG - Intergenic
1147998419 17:44374340-44374362 ATGTGGAAGGTGAGGTGTGAAGG - Exonic
1148027849 17:44600721-44600743 ATGGGGAAACTGAGGCTTGGGGG - Intergenic
1148064607 17:44859860-44859882 CTGGGGATAGTGGGGCTTGGCGG + Intronic
1148656137 17:49285289-49285311 CTGTGGAAGGGAATGCATGGTGG - Intergenic
1148660594 17:49328464-49328486 ATGTTGGAGGTGAGGCCTGGTGG + Intronic
1148680657 17:49471729-49471751 CTTTGGAAGGTAAGGCAAGGAGG - Intronic
1149148978 17:53536277-53536299 GTGTTGGAGGTGGGGCTTGGTGG + Intergenic
1149201196 17:54187903-54187925 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1150835309 17:68558389-68558411 GTGTTGAAGGTGGGGCCTGGTGG + Intronic
1150997232 17:70332545-70332567 GTGTTGAAGGTGGGGCCTGGTGG - Intergenic
1151196755 17:72437237-72437259 CTGTGGGTGGTGGGACTTGGGGG - Intergenic
1151258419 17:72897905-72897927 GGGTGGAAGGTGAGACCTGGAGG + Intronic
1151322109 17:73358574-73358596 TTTTGGAAGGTAAGGCTTGAAGG + Intronic
1151460336 17:74250400-74250422 CTCTGGAAGGTGTGGCCTGCTGG - Intronic
1151554656 17:74840634-74840656 CTGTGGCAGGTGAGGCATCCTGG - Intergenic
1151834411 17:76573540-76573562 CAGTGGAAGAGGGGGCTTGGCGG + Intronic
1151873991 17:76856265-76856287 GTGAGGAAACTGAGGCTTGGAGG + Intergenic
1151929886 17:77225691-77225713 GTGTTGAAGGTGGGGCCTGGTGG - Intergenic
1153160832 18:2203149-2203171 ATGTTGGAGGTGGGGCTTGGTGG - Intergenic
1153347600 18:4044856-4044878 GTGTTGAAGGTGCGGCCTGGTGG + Intronic
1153350026 18:4069438-4069460 ATGTTGAAGGTGGGGCCTGGTGG + Intronic
1153966235 18:10184774-10184796 ATGTCGGAGGTGGGGCTTGGTGG + Intergenic
1154004449 18:10514990-10515012 CTGTGCAAGGTGTGGGGTGGAGG + Intergenic
1154344176 18:13528554-13528576 CTTTGGAAGGTGAAGGTGGGTGG - Intronic
1154396079 18:13990594-13990616 ATGTTGAAGGTGGGGCCTGGTGG + Intergenic
1154425068 18:14265783-14265805 CTGTTGTAGGTGGGGCCTGGTGG + Intergenic
1154425849 18:14271579-14271601 ATGTTGAAGGTGGGGCCTGGGGG + Intergenic
1154428594 18:14291173-14291195 ATGTTGAAGGTGGGGCCTGGGGG + Intergenic
1154430867 18:14307517-14307539 ATGTTGAAGGTGGGGCCTGGGGG + Intergenic
1154432752 18:14321010-14321032 CTGTTGTAGGTGGGGCCTGGTGG + Intergenic
1154433539 18:14326821-14326843 ATGTTGAAGGTGGGGCCTGGGGG + Intergenic
1155740108 18:29278959-29278981 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
1155798903 18:30074764-30074786 ATGTTGGAGGTGGGGCTTGGTGG + Intergenic
1155829371 18:30493496-30493518 GTGTTGGAGGTGGGGCTTGGTGG + Intergenic
1155891603 18:31277430-31277452 ATGTTGAAGGTGGGGCCTGGTGG + Intergenic
1156622523 18:38869670-38869692 CTGAGGAAACTGAGGCTTAGGGG - Intergenic
1156643555 18:39131741-39131763 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
1156814932 18:41298355-41298377 ATGTTGAAGGTGGGGCCTGGTGG + Intergenic
1157270301 18:46269999-46270021 CTCTGGAAGGGGAGGTATGGAGG + Intergenic
1157696672 18:49728728-49728750 CTGGGAAAGGTGAGGCTTTCTGG + Intergenic
1157990247 18:52487118-52487140 CTGTGGACTGGGAGGGTTGGTGG + Intronic
1158317814 18:56230887-56230909 ATGTTGGAGGTGAGGCCTGGAGG + Intergenic
1158424463 18:57326649-57326671 CTGGGGAAGGAGAGGCAAGGAGG + Intergenic
1158517688 18:58144466-58144488 GTGTTGGAGGTGGGGCTTGGTGG - Intronic
1159218631 18:65429512-65429534 ATGTTGGAGGTGAGGCATGGTGG + Intergenic
1159522792 18:69547518-69547540 CTGTTGGAGGTGAGGCCTGCTGG - Intronic
1159890353 18:73947332-73947354 CTGTGGAGGAGGTGGCTTGGTGG - Intergenic
1160121637 18:76135539-76135561 GTGTTGAAGGTGGGGCCTGGTGG - Intergenic
1160270742 18:77381276-77381298 CTGTGGAAGATGGGGGCTGGGGG + Intergenic
1160405715 18:78645156-78645178 TTCTGCCAGGTGAGGCTTGGGGG - Intergenic
1160617416 18:80142185-80142207 CTGAGGAAATTGAGGCATGGAGG + Intronic
1160764568 19:801691-801713 CTGTGGGAGGCGAAGGTTGGAGG + Intronic
1160840845 19:1146500-1146522 CAGGGGAAGCGGAGGCTTGGGGG + Intronic
1160875948 19:1296188-1296210 ATGGGGAAACTGAGGCTTGGAGG + Intronic
1161000292 19:1907433-1907455 GGGTGGAAGCCGAGGCTTGGAGG + Intronic
1161045021 19:2130105-2130127 CTGTGGAAGGTGCCTCCTGGTGG + Intronic
1161127869 19:2570008-2570030 ATGTTGGAGGTGAGGCTGGGTGG + Intronic
1161363341 19:3863862-3863884 ATGAGGAAAGTGAGGCTTGGGGG - Intronic
1161604705 19:5208179-5208201 CTGGGGAAACTGAGGCCTGGTGG - Intronic
1161865764 19:6831119-6831141 CTGTGGTAGGTGAGGGTGGGAGG + Intronic
1161908639 19:7176180-7176202 ATGTGGGAGGTGGGGCCTGGTGG + Intronic
1162469655 19:10864817-10864839 CCAAGGAGGGTGAGGCTTGGAGG + Intronic
1162769564 19:12940879-12940901 CTCTGGCAGGTGAGACTTGGAGG + Exonic
1162821921 19:13228322-13228344 CTTTGGGAGGTGAGGGGTGGAGG + Intronic
1163015420 19:14451404-14451426 CTGTGGAAGGTGGGGCTGGCTGG - Intronic
1163314986 19:16535575-16535597 CTGTGGCAGGGGTGGCATGGTGG + Exonic
1163529570 19:17841831-17841853 GAGTGGATGGTGTGGCTTGGGGG - Intronic
1163611477 19:18304192-18304214 CTGTGGAAGGGAAGGATTGCCGG + Intergenic
1163751070 19:19078167-19078189 CTATGGCAGGTGTGGCTTGTAGG + Intronic
1164451700 19:28371768-28371790 GTGTTGGAGGTGAGGCCTGGTGG + Intergenic
1164580256 19:29430339-29430361 GTGTTGCAGGTGAGGCCTGGTGG + Intergenic
1164676358 19:30104247-30104269 CTGAGGAAGGGGAGGCAGGGGGG - Intergenic
1164853444 19:31502884-31502906 CTGTAGAAGGTGATCTTTGGTGG - Intergenic
1165319494 19:35076646-35076668 CTGAGGAAGGTGGGGACTGGGGG - Intergenic
1165870846 19:38972000-38972022 ATGGGGAAACTGAGGCTTGGAGG + Intronic
1166014897 19:39972255-39972277 CTGTGCAAGGTCTGGGTTGGGGG - Intronic
1166301228 19:41913139-41913161 CTGCGGGAGGAGAGGCTGGGAGG - Intronic
1166560268 19:43728184-43728206 CTGTTGGAGGTGGGGCCTGGCGG + Exonic
1166748099 19:45151532-45151554 CTGTGGCAGGAGAGGCTGCGGGG - Exonic
1167390321 19:49190468-49190490 CTGTGGGAGGTGAGTTTTGGGGG + Intronic
1167413359 19:49357691-49357713 GTGTTGGAGGTGAGGCCTGGTGG + Intronic
1167684789 19:50949708-50949730 TCATGGAAGGTGAGGGTTGGTGG - Intronic
1167688096 19:50968971-50968993 CTGAGGGAGGAGGGGCTTGGGGG + Exonic
1167689100 19:50974841-50974863 CTGAGGAAGGAGGGGCTGGGGGG + Intergenic
1167689134 19:50974925-50974947 CTGAGGAAGGAGGGGCTGGGGGG + Intergenic
1167765927 19:51482453-51482475 CTGTGGAAGGTGGGGTTGAGGGG + Intronic
1167830043 19:52012002-52012024 ATGTTGAAGGTGGGGCCTGGTGG + Intergenic
1167915187 19:52734651-52734673 CTGAGGAGGGGGAGGCTGGGAGG + Intronic
1168123999 19:54272813-54272835 CTCTGGAAGATGAGGCATGTGGG + Intronic
1168178367 19:54642721-54642743 CTCTGGAAGATGAGGCATGTGGG - Intronic
1168326473 19:55541125-55541147 CTGAGGTGGCTGAGGCTTGGTGG + Exonic
1168419315 19:56190844-56190866 CTTTGGAAGCTGAGGCTCTGGGG + Exonic
1168423769 19:56222598-56222620 CTTTGGAAGCTGAGGCTCTGGGG + Exonic
1168460712 19:56554749-56554771 CTGTGCAAGGTGAGCCTTCTGGG - Exonic
1168608881 19:57783018-57783040 CTGTATAAGGCCAGGCTTGGTGG + Intronic
925388118 2:3477109-3477131 CTGTGGCAGAGGAGGCCTGGGGG - Intronic
926076247 2:9945496-9945518 CTGAGGAAAGTGAGGCTCAGAGG + Intergenic
926116550 2:10217365-10217387 CCGTGGTAGGTGAGGGCTGGAGG - Intergenic
926183023 2:10663077-10663099 CTGTAGAAGGCGGGGCATGGTGG + Intronic
926392440 2:12407021-12407043 ATGTTGGAGGTGAGGCTTGGTGG - Intergenic
926547742 2:14262862-14262884 GTGTTGGAGGTGGGGCTTGGCGG - Intergenic
926682676 2:15675734-15675756 CTGTGAGAGGTGAGGATTTGAGG + Intergenic
926837982 2:17045364-17045386 GTGTTGAAGGTGGGGCTTGGTGG - Intergenic
927068666 2:19501571-19501593 GTATTGAAGGTGGGGCTTGGTGG + Intergenic
927154370 2:20213144-20213166 CTGTGGAAGGGTAGGTATGGGGG - Intronic
927164017 2:20298988-20299010 CTGGGTAGGGTGAGGCATGGAGG - Intronic
927395656 2:22648043-22648065 GTGTTGGAGGTGAGGCCTGGTGG + Intergenic
927480807 2:23452421-23452443 ATGTTGGAGGTGGGGCTTGGTGG - Intronic
927485958 2:23488517-23488539 CTGGGGAAGGAGAGGCCTGATGG + Intronic
928235532 2:29536217-29536239 GTGTTGGAGGTGAGGCCTGGTGG + Intronic
928247129 2:29640273-29640295 ATGTTGGAGGTGGGGCTTGGTGG + Intronic
928461169 2:31474200-31474222 CTGTGGTAGTTGAGGCAGGGTGG - Intergenic
928487471 2:31747256-31747278 CTGTTGAAGGCAAGGCTTTGGGG - Intergenic
929587305 2:43124720-43124742 ATGAGGAAGCTGAGGCTCGGAGG + Intergenic
929591020 2:43146303-43146325 CTGTGGGAGGAGGGGCCTGGAGG - Intergenic
929606595 2:43238887-43238909 CTGTGGGAGCTGGGGGTTGGTGG + Intronic
930026544 2:47032484-47032506 CTGTGGAGGGTGGGGCCTAGGGG + Intronic
930418268 2:51117572-51117594 ATGCTGAAGGTGGGGCTTGGAGG + Intergenic
930501241 2:52220843-52220865 CAGTGGAAGGTGGGGATTGTAGG + Intergenic
930626861 2:53708101-53708123 GTGTTGAAGGTGGGGCTTGGTGG + Intronic
931766150 2:65458360-65458382 CTGTGGAGAGTGAGGCTTCCTGG + Intergenic
931862705 2:66373109-66373131 ATGTTGGAGGTGAGGCTTGGTGG + Intergenic
932493901 2:72137332-72137354 ATGAGGAAACTGAGGCTTGGGGG - Intronic
932603425 2:73146094-73146116 GTGTTGAAGGTGGGGCCTGGTGG + Intronic
932873677 2:75428982-75429004 CTGTGGAAGAGGAGGCTGGCTGG + Intergenic
933402621 2:81818521-81818543 ATGTGGGAGGTGGGGCCTGGGGG - Intergenic
933949645 2:87317531-87317553 ATGTTGGAGGTGAGGCCTGGTGG - Intergenic
933998026 2:87684213-87684235 CTTTTGAATGTGGGGCTTGGTGG - Intergenic
934859477 2:97751930-97751952 GTGTGGAAGGTGGGGCTTGGTGG - Intergenic
934909155 2:98234792-98234814 CTGTGGAAAGGGAGGCTGGTTGG - Intronic
935540163 2:104339074-104339096 CTGTGGAATCTGAGTCTTTGGGG + Intergenic
935553592 2:104483380-104483402 GTGGGGAAGGTGGGGCTGGGTGG + Intergenic
935718829 2:105961600-105961622 TTGTGGAAACTGAGGCTTGGAGG + Intergenic
935798849 2:106672016-106672038 GTGTTGGAGGTGAGGCCTGGTGG + Intergenic
936168686 2:110148137-110148159 ATGTTGAAGGTGAGGCCTGGTGG + Intronic
936295825 2:111266653-111266675 CTTTTGAATGTGGGGCTTGGTGG + Intergenic
936330548 2:111544066-111544088 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
936341082 2:111633274-111633296 GTGGGGAAAGTCAGGCTTGGAGG - Intergenic
936396487 2:112135746-112135768 CAGTTAAAGGTGAGGGTTGGGGG + Intergenic
936475467 2:112835893-112835915 CTTTGCAAAGTGTGGCTTGGAGG - Intronic
937110430 2:119363032-119363054 CTGAGGGAGGTGAGAGTTGGTGG - Intronic
937112690 2:119378690-119378712 ATGTGGAAGGTGGGGCCTGGTGG + Intergenic
937140241 2:119593977-119593999 CTGTTGGAGGTGGGGCCTGGTGG - Intronic
937344460 2:121116071-121116093 ATGTTGAAAGTGGGGCTTGGTGG - Intergenic
937345216 2:121121163-121121185 CTGTGGAAGGGGAGGGCAGGGGG + Intergenic
938109245 2:128553094-128553116 CTGGGGAAACTGAGGCCTGGAGG - Intergenic
938222558 2:129582714-129582736 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
938364476 2:130723999-130724021 ATGTTGAAGGTGGGGCCTGGTGG + Intergenic
938428355 2:131210318-131210340 CTGTGGAAGGGGTGGTTGGGGGG + Intronic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
938911660 2:135890857-135890879 GTGTGGGAGGTGGGGCCTGGTGG + Intergenic
939026187 2:137016160-137016182 ATGAGGAAATTGAGGCTTGGGGG + Intronic
939503995 2:143021750-143021772 ATGTCGAAGGTGGGGCCTGGTGG - Intronic
939600014 2:144177121-144177143 ATGTTGCAGGTGAGGCCTGGTGG - Intronic
939723766 2:145688199-145688221 TTGGGGAAGGTGATACTTGGTGG + Intergenic
939929116 2:148209920-148209942 CTGTTGAAGGTGGGGCCTGGTGG - Intronic
940720906 2:157280723-157280745 ATGTTGGAGGTGAGACTTGGTGG + Intronic
940977071 2:159958113-159958135 GTGTTGAAGGTGAGGCCTGGTGG + Intronic
941018597 2:160384855-160384877 CTGTTGAAGGTGGGACCTGGTGG + Intronic
941122496 2:161546883-161546905 GTGTTGAAGGTGGGGCCTGGTGG - Intronic
942168412 2:173265227-173265249 CTGAGGAAGCTGAGGCTGGGAGG + Intronic
942662791 2:178283958-178283980 GTGGTGAAGGTGAGGCCTGGTGG - Intronic
942980157 2:182071026-182071048 GTGTTGGAGGTGGGGCTTGGTGG - Intronic
943725613 2:191248269-191248291 CAGTGGAAACTGAGGCCTGGAGG + Intronic
944479909 2:200145783-200145805 GTGTTGAAGGTGGGGCCTGGTGG - Intergenic
945125727 2:206507457-206507479 CAGTGGAAGGTGAAGGTGGGAGG - Intronic
945449261 2:209974979-209975001 CTGTGAAAAGTGAGACTTTGAGG + Intronic
945533916 2:210988579-210988601 ATGTTGAAGGTGGGGCCTGGTGG + Intergenic
945588539 2:211698027-211698049 ATGAGGAAGGTCAGGCATGGTGG + Intronic
946263799 2:218520908-218520930 ATGTTGGAGGTGGGGCTTGGTGG + Intronic
946300244 2:218819343-218819365 CTGTTCATGGTGATGCTTGGGGG - Intergenic
946810110 2:223514649-223514671 GTGTTGGAGGTGGGGCTTGGTGG - Intergenic
946954616 2:224915988-224916010 ATGTTGAAGGTGTGGCCTGGTGG + Intronic
947183539 2:227433753-227433775 ATGTTGAAGGTGGGGCCTGGTGG - Intergenic
947204279 2:227646009-227646031 CTGGGGAAGCTGAGGCCAGGAGG - Intergenic
947256241 2:228167085-228167107 GTGTTGGAGGTGAGGCCTGGTGG - Intronic
947961960 2:234247466-234247488 CTGTTGGAGGTGAGGCCTGATGG + Intergenic
947963913 2:234262850-234262872 GTGTTGGAGGTGAGGCCTGGGGG + Intergenic
948209667 2:236183500-236183522 CTGTTGGAGGTGGGGCCTGGTGG + Intergenic
948633842 2:239321220-239321242 CTTTGGAAGGTGAAGGTGGGCGG + Intronic
948639658 2:239367287-239367309 CTATGGAAGGTGTGGCTTAATGG - Intronic
948853601 2:240719985-240720007 CTGAGGAGGGTGAAGCCTGGGGG - Intronic
948855557 2:240728737-240728759 CTGTGGAGGGTCAGGCCTGCAGG + Intronic
948862894 2:240761442-240761464 CTCTGGAAGGTCAGGCTGGTCGG + Intronic
1168770903 20:416004-416026 GTGTTGAAGGTGAGGCCTGGTGG - Intronic
1169210630 20:3764488-3764510 CTGTCGAAGGTGTGGCTGGGAGG - Intronic
1169291955 20:4360420-4360442 GTGTTGAAGGTGGGGCCTGGTGG - Intergenic
1169394604 20:5218555-5218577 ATGTTGAAGGTGGGGCCTGGTGG - Intergenic
1169643278 20:7778989-7779011 GTGTTGGAGGTGAGGCCTGGTGG + Intergenic
1170037067 20:12000899-12000921 GTGTGGAAACTGAGGCTTGGAGG - Intergenic
1170414072 20:16121535-16121557 GTGAAGAAGGTGAGGCTTTGGGG - Intergenic
1170638306 20:18128892-18128914 GTGTTGGAGGTGGGGCTTGGTGG - Intergenic
1170688682 20:18592366-18592388 CTCTGGAAGCTGAGGCAGGGAGG + Intronic
1170746053 20:19099918-19099940 ATGAGGAAGCTGAGGCTTAGAGG + Intergenic
1170814107 20:19698236-19698258 GTGTTGGAGGTGAGGCTTGGCGG - Intronic
1171405405 20:24909460-24909482 CTGTGGAAGGTGCCCCTCGGGGG + Intergenic
1172036381 20:32013735-32013757 CTGGGGAAGGCCAGGCGTGGTGG - Intronic
1172292549 20:33786723-33786745 CTTTGGAAGGTGAAGGTGGGTGG + Intronic
1172386802 20:34539782-34539804 TTGTAGAAGGTCAGGCGTGGTGG - Intronic
1172604897 20:36207627-36207649 CTGTGGAATGTGTGGCTTTGGGG - Intronic
1172872531 20:38144646-38144668 ATGAGGAAATTGAGGCTTGGAGG + Intronic
1172878215 20:38179337-38179359 GTGTTGAAGGTGGGGCCTGGTGG + Intergenic
1172980871 20:38940620-38940642 CTAAGGAAGCCGAGGCTTGGGGG - Intronic
1173433834 20:43015275-43015297 ATGTGGAAGGTGAAGCAAGGAGG - Intronic
1173644212 20:44623445-44623467 CTGTGGAGGGTGCAGCATGGTGG - Intronic
1173866828 20:46317730-46317752 CTCTGCAAGGTGAGGCTGGTGGG - Intergenic
1174373015 20:50106473-50106495 CTGTGGTAGCTGCTGCTTGGTGG - Intronic
1174466852 20:50724502-50724524 GGGTGGAAGGAGAGGCTGGGTGG - Intergenic
1174751885 20:53119094-53119116 GTGTTGGAGGTGAGGCCTGGTGG - Intronic
1175123977 20:56738039-56738061 CTGTGGGAGGCCAGGCATGGTGG - Intergenic
1175212144 20:57366575-57366597 GTGTTGAAGGTGGGGCCTGGTGG - Intronic
1175616323 20:60402691-60402713 ATGAGGAAGCTGAGGCTTTGAGG - Intergenic
1175854260 20:62111918-62111940 CTGGGGGAGGTGAGGGTGGGAGG + Intergenic
1175873512 20:62219289-62219311 GTGGGGAAGGTGGGGGTTGGGGG - Intronic
1175987313 20:62770516-62770538 GCGTGGAAGCTGAGGCCTGGAGG + Intergenic
1176049514 20:63110354-63110376 GTGTTGAAGGTGGGGCCTGGTGG - Intergenic
1176050975 20:63119654-63119676 CTGTGGAGGAGGAGGCTTTGTGG - Intergenic
1176142508 20:63551057-63551079 CTGAGGATGGTGAAGCCTGGGGG - Intronic
1176618123 21:9038924-9038946 GAGTGGAAGGTGAGGTTTGAGGG - Intergenic
1176844288 21:13864738-13864760 CTGTTGCAGGTGGGGCCTGGTGG - Intergenic
1176844743 21:13868144-13868166 ATGTTGCAGGTGAGGCCTGGTGG - Intergenic
1176846175 21:13878249-13878271 ATGTTGAAGGTGGGGCCTGGGGG - Intergenic
1176848908 21:13897792-13897814 ATGTTGAAGGTGGGGCCTGGGGG - Intergenic
1176885269 21:14247921-14247943 CTGTTGGAGGTGGGGCCTGGCGG - Intergenic
1177067337 21:16456314-16456336 CTGTGGAGGTTGAGGGTGGGAGG - Intergenic
1177106222 21:16958722-16958744 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1177141211 21:17360167-17360189 GTGTTGAAGGTGGGGCCTGGTGG + Intergenic
1178052499 21:28763512-28763534 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
1178132457 21:29589265-29589287 CTGTGGAGGGTGGGGCTGTGCGG + Intronic
1178155943 21:29854344-29854366 ATGTTGGAGGTGGGGCTTGGTGG - Intronic
1178188184 21:30248938-30248960 GTGTTGGAGGTGATGCTTGGTGG + Intergenic
1178251362 21:31006491-31006513 CTGGGGAATCTGAGGATTGGAGG + Intergenic
1178625026 21:34208898-34208920 GTGTTGAAGGTGAGACCTGGTGG + Intergenic
1178934549 21:36850478-36850500 CTGTGGAGCTTGGGGCTTGGGGG - Intronic
1179010893 21:37555276-37555298 AAGGGGAAGGTGAAGCTTGGAGG + Intergenic
1179190473 21:39118429-39118451 CTGTCGGAGGCGGGGCTTGGTGG - Intergenic
1179722006 21:43321455-43321477 CTCAGGACGGTGAGGCCTGGTGG - Intergenic
1179914358 21:44466889-44466911 CTGGGGAAGGTCAGCCTGGGTGG - Intergenic
1180931094 22:19592354-19592376 CTGTGGAAGCTGAGGCAGGAGGG - Intergenic
1181279797 22:21711173-21711195 CTTTGGGAGGCCAGGCTTGGTGG - Intronic
1181619889 22:24083652-24083674 CTCTGGAGGGTGAGGGTAGGAGG + Intronic
1181861631 22:25823592-25823614 CTGTCGAAGGTGGTGCTTGAAGG - Exonic
1182220435 22:28754380-28754402 CTGTGGAAGGTCAGGCACGGTGG + Intronic
1182524295 22:30906061-30906083 CGGAGGAAGGTGAGGCCGGGCGG + Exonic
1182722815 22:32417414-32417436 CTTTGGAAGGTCAAGATTGGAGG - Intronic
1182796508 22:32994990-32995012 CTGAGGAATGTGAGGTTCGGAGG + Intronic
1182899759 22:33888071-33888093 CTGTGGAACGGGAGCATTGGTGG - Intronic
1183293529 22:37017292-37017314 CTGTGGAAGGGAAGGCCAGGTGG - Intronic
1183572877 22:38667414-38667436 CTTGGGAAGCTGAGGCTGGGGGG - Intronic
1184106985 22:42373505-42373527 AAGAGGAAAGTGAGGCTTGGAGG - Intergenic
1184119542 22:42441103-42441125 CTGGAGAAGGGGAGGCTGGGTGG - Intergenic
1184321235 22:43743734-43743756 CTGTGGAGGGTGAGGGGTGAAGG - Intronic
1184617419 22:45647509-45647531 ATGAGGAAAGTGAGTCTTGGAGG + Intergenic
1185069953 22:48650793-48650815 CTGGGGGAGGGGAGGCTCGGTGG - Intronic
1185088165 22:48751975-48751997 CTGTGGCTGGTGAGGCTGGTGGG + Intronic
949310773 3:2695414-2695436 CTGAAAAAGGTGAGGCTTGGGGG - Intronic
949387304 3:3517408-3517430 CTGTTGGAGGTGGGGCCTGGTGG + Intergenic
949725393 3:7038768-7038790 CTGAGGCAGGTGAGACTTAGAGG + Intronic
949850840 3:8418780-8418802 ATGTTGAAGGTGGGGCCTGGTGG + Intergenic
949932538 3:9090168-9090190 CTTTGAAAGCTGATGCTTGGTGG - Intronic
950046563 3:9951860-9951882 CTGTGGAAGATGAGCCTCCGAGG - Intronic
950239283 3:11353550-11353572 CTGTTGGAGGTGGGGCCTGGTGG + Intronic
950523772 3:13511523-13511545 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
950565654 3:13768226-13768248 AGGTGGAAACTGAGGCTTGGAGG + Intergenic
950646832 3:14382377-14382399 CTCTGGAGGCTGAGGCTTGTGGG + Intergenic
950766204 3:15274964-15274986 ATGTTGGAGGTGGGGCTTGGCGG - Intronic
950794397 3:15498819-15498841 CTGCTGTAGGGGAGGCTTGGAGG + Intronic
951182326 3:19673001-19673023 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
951528812 3:23679800-23679822 GTGTTGAAGGTGGGGCCTGGTGG - Intergenic
951582562 3:24181485-24181507 CTGTGTAAGGTGAGGCCTTTGGG + Intronic
951644772 3:24877652-24877674 CAGTGGAAGATCAGACTTGGAGG - Intergenic
951934179 3:28003220-28003242 ATGTTGAAGGTGGGGCCTGGTGG - Intergenic
952074323 3:29677192-29677214 TTGTTGGAGGTGGGGCTTGGTGG - Intronic
952529079 3:34244545-34244567 CTGTGGAAGGCGAGGGTTGTGGG - Intergenic
952687350 3:36164901-36164923 CTTTGGAAGGTGAAGGTGGGTGG + Intergenic
952706657 3:36384365-36384387 ATGAGGAAGCTGAGGCTTTGAGG - Intronic
952784833 3:37142923-37142945 GTGTTGGAGGTGAGGCCTGGTGG + Intronic
952972978 3:38666466-38666488 TTGTTGAAGGTGGGGCTTGGTGG + Intergenic
953196035 3:40734266-40734288 ATGTTGGAGGTGGGGCTTGGTGG - Intergenic
953548226 3:43880374-43880396 CTGTGAAATGTGAGGCAGGGGGG - Intergenic
953671571 3:44967119-44967141 ATGTGTAAGGTTTGGCTTGGAGG - Intronic
954003859 3:47577801-47577823 CTGGGGAAGATGAGGCGTCGTGG - Exonic
954138064 3:48591374-48591396 GTGTGGAAGGAGAGGGCTGGAGG + Intronic
954416107 3:50394227-50394249 CTGGGGATGGAGAGGCTTTGGGG - Intronic
954452020 3:50576869-50576891 ATGGGGAAGCTGAGGCCTGGAGG + Intronic
954880677 3:53833888-53833910 AGATGGAAGGTGTGGCTTGGTGG - Intronic
955906712 3:63815158-63815180 GTGTTGAAGGTGGGGCCTGGTGG - Intergenic
956004462 3:64763584-64763606 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
956677885 3:71753149-71753171 CTCAGGAAGCAGAGGCTTGGAGG - Intronic
957505546 3:81115978-81116000 CTGTTGAAGGAGGGGCCTGGTGG - Intergenic
957506696 3:81130771-81130793 GTGTTGAAGGAGAGGCTTGGTGG + Intergenic
957576326 3:82013526-82013548 GTGTTGAAGGTGAGGCCTAGTGG + Intergenic
957747884 3:84368210-84368232 ATATTGAAGGTGGGGCTTGGGGG - Intergenic
957876223 3:86149881-86149903 GTGTTGGAGGTGAGGCCTGGTGG + Intergenic
958536030 3:95404751-95404773 GGGTGGAAGGGGAGGGTTGGAGG + Intergenic
958877187 3:99629818-99629840 CTGTGATAAGTCAGGCTTGGTGG + Intergenic
959064451 3:101642539-101642561 GTGTTGAAGGTGGGGCCTGGTGG + Intergenic
959849772 3:111072173-111072195 CTGTGGTAGGTGAACCTCGGCGG + Exonic
959873773 3:111358877-111358899 ATGTGGGAGGTGGGGCCTGGTGG + Intronic
960005435 3:112776687-112776709 CTTTGGGAGGTGAGGGTGGGCGG + Intronic
960134143 3:114088863-114088885 GTGTTGAAGGTGGGGCCTGGTGG - Intergenic
960615545 3:119592616-119592638 CTGAGCAACCTGAGGCTTGGAGG - Intergenic
960805162 3:121576622-121576644 GTTTGGAAGGTCAGGCGTGGTGG - Intronic
960834023 3:121885288-121885310 CTGGGGGAGGTGAGGCTAAGTGG - Intronic
961210378 3:125120725-125120747 CTGGGGAAGGCGATGCGTGGAGG - Intronic
961575240 3:127830616-127830638 ATGTTGAAGGTGGGGCCTGGTGG + Intergenic
961747668 3:129075664-129075686 ATGTTGAAGGTGAGGCCTGGTGG - Intergenic
962207216 3:133444866-133444888 CTGTGGGAAGAGAGGATTGGAGG - Intronic
962507262 3:136060411-136060433 GTGTTGAAGGTGGGGCCTGGTGG + Intronic
962841062 3:139232974-139232996 CAGAGGAAGGTGAAGCTTTGAGG + Intronic
962973310 3:140424872-140424894 CTGTGGTAGGGGAGGGTGGGTGG + Intronic
963006196 3:140728221-140728243 CTGGAGCAGGTGAGGCTTTGGGG - Intergenic
963997385 3:151725500-151725522 CTGTGGAGGGAGAGACCTGGTGG - Intergenic
964205331 3:154168331-154168353 CTTTGGAAGGTGGGGGTGGGTGG + Intronic
964507155 3:157411936-157411958 ATGTTGGAGGTGAGGCCTGGTGG + Intronic
964552816 3:157903906-157903928 ATGTTGAAGGTGGGGCTTGTGGG + Intergenic
964738538 3:159941702-159941724 CTGTGGTTGATGAGGCTTGCAGG - Intergenic
964920305 3:161887908-161887930 ATGTTGAAGGTGGGGCCTGGTGG - Intergenic
964977093 3:162634745-162634767 GTGTTGAAGGTGGGGCCTGGTGG - Intergenic
965252588 3:166361826-166361848 GTGTTGAAGGTGAGGCTTGGTGG + Intergenic
966304231 3:178512976-178512998 GTGTTGGAGGTGAGGCCTGGTGG + Intronic
966925865 3:184644240-184644262 CTTTGGAAGGTCAGGGTGGGTGG - Intronic
967548684 3:190763678-190763700 ATGTTGAAGGTGGGGCCTGGTGG + Intergenic
967593105 3:191300672-191300694 GTGTTGAAGGTGGGGCCTGGTGG + Intronic
968211645 3:196854014-196854036 CTTTGGAAGGTGGGGGTGGGCGG - Intergenic
968484608 4:853071-853093 CTGTGGGAGGTGAGGCCAGCGGG - Intronic
968649525 4:1754954-1754976 CTGGGGGAGGTGGGGCCTGGAGG + Intergenic
968875600 4:3266036-3266058 CTGTCGGAGGCGAGGCTGGGAGG + Intronic
968908373 4:3464633-3464655 GTGGGGCAGGTGATGCTTGGTGG + Intronic
968950491 4:3688867-3688889 CTGTGGGATGTGAGGGCTGGTGG - Intergenic
969111069 4:4844605-4844627 TTGTGGCAGGGGAGGGTTGGGGG - Intergenic
969573638 4:8024350-8024372 CTCTGGAAGCTGGGTCTTGGTGG + Intronic
969850424 4:9952251-9952273 ATGTTGGAGGTGGGGCTTGGTGG + Intronic
969994800 4:11301234-11301256 CTGTGTAGGGTGTGGCTTGGTGG + Intergenic
970104119 4:12560940-12560962 ATGTTGGAGGTTAGGCTTGGTGG - Intergenic
970177860 4:13357256-13357278 TTCTGGAAGGTGGGGCTTTGGGG + Intergenic
970344606 4:15141401-15141423 GTGTTGGAGGTGAGGTTTGGTGG - Intergenic
970801696 4:19979562-19979584 CTGTTGGAGGTGGGGCATGGTGG + Intergenic
970966744 4:21936729-21936751 TAATGGAAGGTGAGGATTGGTGG - Intronic
971157706 4:24101105-24101127 CTGTTGGAGGTGGGGCCTGGTGG + Intergenic
971216917 4:24670670-24670692 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
971224156 4:24735869-24735891 CTGAGTAAGGCCAGGCTTGGTGG - Intergenic
971224880 4:24742673-24742695 ATGTGGAAGGTGTGTCCTGGTGG + Intergenic
971265693 4:25094441-25094463 TTGTTGAAGGTGGGGCCTGGTGG + Intergenic
971367728 4:25991153-25991175 CTGAGAGAAGTGAGGCTTGGAGG + Intergenic
971550756 4:27953067-27953089 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
971564165 4:28117239-28117261 CTGGGGAGGCTGAGGCATGGCGG + Intergenic
971645681 4:29198314-29198336 CTCTGGAGGTTGAGGCTGGGGGG + Intergenic
971701099 4:29977674-29977696 GTGTTGGAGGTGAGGCCTGGTGG + Intergenic
971741484 4:30526804-30526826 GTATTGAAGGTGGGGCTTGGTGG - Intergenic
972123823 4:35739674-35739696 ATGTTGCAGGTGGGGCTTGGTGG - Intergenic
972145648 4:36021369-36021391 CTGTTGGAGGTGGGGCCTGGTGG + Intronic
972296675 4:37745838-37745860 ATGTTGAAGGTGAGGCCTGGTGG - Intergenic
972304402 4:37818313-37818335 ATGTTAAAGGTGAGGCCTGGTGG + Intergenic
972367560 4:38390666-38390688 GTGTTGGAGGTGGGGCTTGGTGG + Intergenic
972447636 4:39161041-39161063 CTGTGGGAGCTGAGGCTGGAAGG - Intergenic
973012648 4:45095210-45095232 ATGTTGGAGGTGAGGCCTGGTGG - Intergenic
973074487 4:45905299-45905321 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
973131418 4:46653234-46653256 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
973367444 4:49219122-49219144 ATGTTGAAGGTGGGGCCTGGTGG - Intergenic
975045355 4:69796552-69796574 ATGTTGAAGGTGGGGCCTGGTGG + Intergenic
975495399 4:75030839-75030861 ATGAGGAAGGTGTGGCTGGGGGG - Intronic
975545593 4:75557177-75557199 TTTTAGTAGGTGAGGCTTGGGGG - Intronic
975870784 4:78776404-78776426 GCGCGGAATGTGAGGCTTGGCGG + Exonic
976011743 4:80497046-80497068 ATGTTGAAGGTGGGGCCTGGTGG - Intronic
976195915 4:82531008-82531030 GTGTTGGAGGTGAGGCCTGGTGG - Intronic
976686709 4:87822111-87822133 CTTTGGGAGGTAAGACTTGGCGG - Intronic
976771366 4:88656588-88656610 ATGTTGGAGGTGAGGCATGGTGG - Intronic
976833646 4:89345606-89345628 GTGTTGAAGGTAAGGCCTGGTGG + Intergenic
976985536 4:91291712-91291734 CTGTTGGAGGTGGGGCCTGGTGG - Intronic
976987797 4:91324949-91324971 GTGTTGAAGGTGGGGCCTGGTGG + Intronic
977202369 4:94132256-94132278 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
977325144 4:95565321-95565343 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
977349747 4:95867454-95867476 CTGTTGGAGGTGGGGCCTGGTGG + Intergenic
978100766 4:104838807-104838829 GTGTTGAAGGTGGGGCCTGGTGG + Intergenic
978528712 4:109692959-109692981 GTGTGGGAGGTGAAGCCTGGTGG + Intronic
978582435 4:110245661-110245683 ATGAGGAAACTGAGGCTTGGAGG - Intergenic
978983537 4:114981888-114981910 ATGTTGAAGGTGGGGCTTGGTGG + Intronic
979049210 4:115909220-115909242 CTGTTCGAGGTGAGGCCTGGTGG - Intergenic
979558871 4:122079876-122079898 GTGGTGAAGGTGGGGCTTGGTGG + Intergenic
979682480 4:123477100-123477122 GTGTTGAAGGTGGGGCCTGGTGG + Intergenic
979799776 4:124894381-124894403 GTGTTGGAGGTGGGGCTTGGTGG + Intergenic
979977941 4:127220019-127220041 ATGTTGAAGGTGGGGCCTGGTGG + Intergenic
980289287 4:130824847-130824869 ATGTTGAAGGTGGGGCGTGGTGG + Intergenic
980482418 4:133404165-133404187 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
981052476 4:140323110-140323132 GTGTTGAAGGTGGGGCTTGGTGG + Intronic
981130965 4:141158003-141158025 CTGGGGAAGGCCAGGCATGGTGG + Intronic
982035668 4:151343447-151343469 CTGTGGAAGGCCGGGCATGGTGG - Intergenic
982136336 4:152277398-152277420 CTGTGGGAACTGAGGCTTAGAGG - Intergenic
982971047 4:161986976-161986998 CTGTGGAAGGAGAGGCCTATTGG + Intronic
983039418 4:162907126-162907148 ATGTGGAAGGTGAGTCCTGGTGG + Intergenic
983075314 4:163318296-163318318 GTGTTGGAGGTGGGGCTTGGTGG - Intergenic
983672472 4:170254273-170254295 ATGTTGGAGGTGGGGCTTGGTGG + Intergenic
983830672 4:172322756-172322778 ATGTTGAAGGTGGGGCCTGGTGG - Intronic
983876581 4:172883619-172883641 GTGTTGGAGGTGAGGCCTGGTGG - Intronic
984031821 4:174613354-174613376 GTGTGGGAGGTGGGGTTTGGTGG - Intergenic
984035948 4:174667938-174667960 GTGTTGGAGGTGGGGCTTGGTGG + Intronic
984401393 4:179269857-179269879 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
984424173 4:179562679-179562701 GTGTTGGAGGTGGGGCTTGGTGG + Intergenic
984870176 4:184318367-184318389 GTGTTGAAGGTGGGGCCTGGTGG + Intergenic
985223201 4:187730245-187730267 GTATAGAAGGTGAGGCCTGGAGG + Intergenic
985689569 5:1299618-1299640 CTGGAGAAGCTGAGGCCTGGAGG + Intergenic
985800636 5:2003538-2003560 CAGTGTAGGGTGAGGCTGGGAGG + Intergenic
985877952 5:2614518-2614540 GTATGGCAGGTGAGGCTGGGAGG - Intergenic
985884891 5:2670153-2670175 CAGTGGAAGGGGAGGCTGGAGGG - Intergenic
985924437 5:3004833-3004855 CTGTGGAGGGTAAGGGATGGAGG - Intergenic
986259614 5:6132827-6132849 CTGTTGAAGGAGGGGCCTGGTGG + Intergenic
986425447 5:7626807-7626829 GTGTTGGAGGTGAGGCCTGGTGG - Intronic
986606048 5:9524010-9524032 ATGTTGAAGGAGAGGCCTGGTGG + Intronic
986916211 5:12623941-12623963 GTGTTGAAGGTGGGGCCTGGTGG + Intergenic
986950064 5:13072114-13072136 GTGTTGAAGGAGAGGCCTGGTGG - Intergenic
986959124 5:13191909-13191931 GTGTTGGAGGTGGGGCTTGGTGG - Intergenic
986999087 5:13640963-13640985 GTGTGGGAGGTGGGGCCTGGTGG + Intergenic
987014247 5:13801140-13801162 ATGTTGGAGGTGAGGCCTGGTGG + Intronic
987123014 5:14785278-14785300 GTGTGGGAGCTGAGGCCTGGAGG + Intronic
987342301 5:16949845-16949867 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
988098886 5:26653513-26653535 AAGTGGAAGGTGGGGCCTGGTGG - Intergenic
988103309 5:26709820-26709842 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
988671484 5:33386353-33386375 GTGTTGAAGGTGGGGCCTGGTGG - Intergenic
988997865 5:36731517-36731539 ATGAGGAAACTGAGGCTTGGGGG + Intergenic
989503454 5:42197142-42197164 GTGTTGAAGGTGAGGCCTGGTGG + Intergenic
989791881 5:45414271-45414293 TTTGGGAAGGTGAGGCATGGAGG - Intronic
990237957 5:53788147-53788169 CTGTGGGAGTTTAGGCTGGGGGG + Intergenic
991008782 5:61859785-61859807 CTTTGGAAGGTCAGGGTGGGCGG - Intergenic
991045731 5:62220777-62220799 ATGTTGAAGGTGGGGCCTGGCGG + Intergenic
991703457 5:69336210-69336232 CTGAACAAGGTGGGGCTTGGTGG + Intergenic
991961718 5:72051325-72051347 ATGTTGAAGGTGGGGCCTGGTGG - Intergenic
992279088 5:75154924-75154946 CAGTGGATGGTGAGGCATTGGGG - Intronic
992375170 5:76181723-76181745 ATGTTGAAGGTGGGGCCTGGTGG - Intronic
992644392 5:78798537-78798559 TTTTGGATGGTGAGGCTTTGTGG - Intronic
992745074 5:79811328-79811350 CTGTGGAGGGTGTGGCTGTGGGG + Intergenic
992796650 5:80259619-80259641 ATGAGGAAACTGAGGCTTGGAGG - Intergenic
993249531 5:85500990-85501012 GTGTGGGAGGTGAGGCCTGGTGG + Intergenic
993468466 5:88277085-88277107 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
994100125 5:95882665-95882687 GTGTTGGAGGTGGGGCTTGGTGG - Intergenic
994166002 5:96608946-96608968 GTGTTGGAGGAGAGGCTTGGTGG - Intronic
994519753 5:100818055-100818077 CTGAGGACACTGAGGCTTGGTGG + Intronic
994840706 5:104922083-104922105 ATGTGGGAGGTGGGGCCTGGGGG + Intergenic
994925753 5:106115124-106115146 GTGTTGAAGGTGGGGCCTGGTGG + Intergenic
995115030 5:108469829-108469851 ATATTGAAGGTGAGGCCTGGTGG - Intergenic
995450228 5:112291814-112291836 ATGTGTAAGGTGAGGTATGGGGG - Intronic
995856338 5:116596938-116596960 CTGTTGGAGGTGGGGCCTGGCGG + Intergenic
996238907 5:121170630-121170652 GTGTTGGAGGTGGGGCTTGGTGG - Intergenic
996782824 5:127207167-127207189 ATGTTGAAGGTGGGGCCTGGTGG + Intergenic
996916160 5:128714507-128714529 CTGTTGCAGGACAGGCTTGGGGG - Intronic
997284152 5:132666400-132666422 CAGTGAAAGGAGAGGCTTTGGGG + Intergenic
997441363 5:133910977-133910999 CTGGGGAAGGGGGGTCTTGGAGG - Intergenic
998217699 5:140249880-140249902 GTGTTGAAGGTGGGGCCTGGTGG - Intronic
998602775 5:143601991-143602013 ATGAGGAAGCTGAAGCTTGGAGG + Intergenic
999918415 5:156289454-156289476 CTGTGGGGGGTGAGGGGTGGAGG - Intronic
1000269605 5:159671478-159671500 ATGTTGAAGGTGGGGCCTGGTGG + Intergenic
1000349510 5:160342388-160342410 CTGTGGAAGGTATGGGGTGGGGG - Intronic
1000686953 5:164262197-164262219 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
1000687452 5:164270030-164270052 TTGTTGGAGGTGAGGCCTGGTGG + Intergenic
1001462252 5:171926432-171926454 TTGTTGAAGGTGAGGCCTGGTGG + Intronic
1001586400 5:172835954-172835976 CTGGGTAAGGGGAGGCTTTGTGG - Intronic
1001588476 5:172849573-172849595 ATGAGGAAGCTGAGGCTTTGGGG + Intronic
1001891292 5:175341308-175341330 ATGTTGGAGGTGGGGCTTGGTGG - Intergenic
1002317688 5:178354469-178354491 GTGTTGGAGGTGGGGCTTGGTGG + Intronic
1002426489 5:179179716-179179738 CTGTGGAATGAGGTGCTTGGTGG + Intronic
1002439153 5:179255419-179255441 CTCTAGAGGGTGAGGATTGGGGG + Intronic
1002542486 5:179915445-179915467 CTCTGGAAGGAGAGGCATGGAGG - Intronic
1003142363 6:3482185-3482207 CTCTGAAAAATGAGGCTTGGGGG - Intergenic
1003801078 6:9668152-9668174 CTCTGGAAGGTGAAGCTGGCTGG + Intronic
1004632343 6:17433988-17434010 CTGTGGTTGGTCAGGCCTGGTGG - Intronic
1006304399 6:33210355-33210377 CTTTGGGAGGTGAGGATGGGAGG + Intronic
1006440427 6:34050332-34050354 GTGTTGAAGGTGGGGCCTGGTGG + Intronic
1006755806 6:36414292-36414314 CAGTGGAAAGGGAGACTTGGTGG + Intronic
1006831062 6:36968670-36968692 CTAGGGAAGGTGAGGCGAGGTGG - Exonic
1006912407 6:37571962-37571984 CTCTGGCAGCTGAGGCTGGGAGG - Intergenic
1007730616 6:43943293-43943315 GTGTGGAAGGTGAGGGCTGGTGG - Intergenic
1007755222 6:44095108-44095130 ATGTGGAACATGAGGCCTGGTGG + Intergenic
1007772569 6:44203004-44203026 CTATGGAAACTGAGGCTGGGAGG + Intergenic
1008062537 6:47013719-47013741 ATGTTGGAGGTGGGGCTTGGTGG + Intronic
1008567570 6:52784286-52784308 GTGTTGGAGGTGGGGCTTGGTGG - Intergenic
1008629858 6:53353193-53353215 CTGTGGAAGATCAGGTTTGAAGG - Intergenic
1008700723 6:54096424-54096446 CTGTGGAAGGTGTGGTTGGCAGG + Intronic
1008760866 6:54849564-54849586 GTAAGGAAGGTGAGCCTTGGTGG + Intronic
1008912048 6:56745007-56745029 CTGTGGAAGGACAGACTTAGAGG + Intronic
1009380389 6:63020858-63020880 ATGTTGAAGGTGAGGCCTGGTGG + Intergenic
1009960088 6:70509188-70509210 CTGTGGAAGGTGGAGGTGGGAGG + Intronic
1010498816 6:76568664-76568686 GTGTTGCAGGTGAGGCCTGGTGG - Intergenic
1011220855 6:85053074-85053096 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1011257915 6:85442769-85442791 TTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1012034274 6:94111550-94111572 ATGTGGGAGGTGAGGTTTGGTGG + Intergenic
1012278186 6:97298434-97298456 ATGTTGGAGGTGCGGCTTGGTGG - Intergenic
1012291528 6:97461212-97461234 CTGTGGAGTGAGAGGTTTGGAGG + Intergenic
1012398452 6:98825306-98825328 CTAGGAAAGGTGAGGCTAGGAGG + Intergenic
1012479630 6:99652092-99652114 CTGTTGAAGGTGGGGCCTGGTGG + Intergenic
1012660780 6:101887857-101887879 GTGTTGAAGGTCGGGCTTGGCGG - Intronic
1012686017 6:102250546-102250568 ATGTTGGAGGTGAGGTTTGGTGG + Intergenic
1012885302 6:104839716-104839738 CTGAGGAAGGCCAGGCATGGTGG + Intronic
1013186120 6:107759987-107760009 CTTTGGAAGATGAAGCTTAGAGG - Intronic
1013672313 6:112418024-112418046 CTCAGGAAGCTGAGGTTTGGAGG + Intergenic
1014074123 6:117217087-117217109 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
1014415384 6:121177180-121177202 ATGTTGGAGGTGGGGCTTGGTGG + Intronic
1014493074 6:122086676-122086698 ATGTTGGAGGTGAGGCATGGTGG - Intergenic
1014811893 6:125895859-125895881 GTGTTGGAGGTGAGGGTTGGTGG - Intronic
1015252400 6:131141176-131141198 GTGTTGGAGGTGGGGCTTGGTGG + Intronic
1015263479 6:131264997-131265019 GTGTTGAAGGTGGGGCCTGGTGG - Intronic
1015546097 6:134362817-134362839 GTGTTGGAGGTGGGGCTTGGTGG + Intergenic
1015808719 6:137140258-137140280 GTGCTGGAGGTGAGGCTTGGTGG - Intergenic
1015924455 6:138295224-138295246 CTGTGGCTGGTGAGTGTTGGAGG - Intronic
1016032181 6:139349277-139349299 CGGTGGCAGCTGAGCCTTGGTGG + Intergenic
1016180352 6:141139061-141139083 ATGTTGGAGGTGGGGCTTGGTGG + Intergenic
1016261409 6:142174695-142174717 GTGTTGGAGGTGAGGCCTGGTGG + Intronic
1016330725 6:142949306-142949328 CTATGGGAAGTGAGGCTGGGTGG + Intergenic
1016927280 6:149363317-149363339 TTGTTGGAGGTGAGGCCTGGTGG - Intronic
1017036318 6:150270332-150270354 CTGTGTAAGGGGAGGCATGCTGG + Intergenic
1017290774 6:152733388-152733410 CCGTGGAAGGCCAGGCATGGTGG - Intergenic
1017473844 6:154767824-154767846 CAGGGGAAGGTCAGGCATGGTGG - Intronic
1017618441 6:156270099-156270121 CTGTGGCAGAGGTGGCTTGGGGG - Intergenic
1017989036 6:159470414-159470436 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
1018036782 6:159888688-159888710 CTTTGGAAGGTGTGACTTGGAGG + Intergenic
1018052525 6:160023600-160023622 GTGGGGAAGCTGAGGCATGGAGG + Intronic
1018089076 6:160329897-160329919 TTTTTGAGGGTGAGGCTTGGGGG - Intergenic
1018207143 6:161446263-161446285 CTTTGGGAAGGGAGGCTTGGAGG + Intronic
1018302647 6:162419644-162419666 CTATGGGAGGTGAGGTTAGGGGG + Intronic
1018463101 6:164017768-164017790 GTGTGGAAGGTGGGACTTAGCGG - Intergenic
1018805205 6:167253962-167253984 GTGTTGGAGGTGAGGCCTGGTGG + Intergenic
1019768871 7:2870922-2870944 CTGTGGAGGGTGACTCTGGGAGG + Intergenic
1019974893 7:4573332-4573354 CTGTGGTAGGCCAGGCATGGTGG - Intergenic
1020167853 7:5822330-5822352 CTTTGGAAGGTCAAGCTAGGTGG - Intergenic
1020630854 7:10637726-10637748 TTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1020916331 7:14198461-14198483 CTATGGAAGTTGGGGTTTGGGGG - Intronic
1020973362 7:14976001-14976023 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
1020989845 7:15183029-15183051 ATGTTGAAGGTGAGACCTGGTGG - Intergenic
1021771861 7:24011052-24011074 CTGTGGAAACTGTGGGTTGGGGG + Intergenic
1022511222 7:30935880-30935902 CTGGGGAAGGGGAGGGTTGGTGG + Intergenic
1022930417 7:35106686-35106708 CTGTGGAAAGTGAGGATCAGAGG - Intergenic
1023781830 7:43663015-43663037 ATGTTGGAGGTGGGGCTTGGTGG + Intronic
1023921327 7:44632408-44632430 CTCAGGAAGCTGAGGCGTGGGGG - Intronic
1023980688 7:45068390-45068412 CAGTGGAAGGGCAGGCATGGGGG - Intronic
1024181843 7:46903174-46903196 GTGTTGGAGGTGAGGCCTGGAGG - Intergenic
1024186449 7:46952865-46952887 CAGTGGCAGGTGAGGCCTAGTGG - Intergenic
1024677533 7:51650536-51650558 CTGTTGAAGGTGGGGCCTGATGG + Intergenic
1024729359 7:52236884-52236906 GTGTTAAAGGTGGGGCTTGGTGG + Intergenic
1025142388 7:56476949-56476971 GTGTTGGAGGTGAGGCCTGGTGG + Intergenic
1025258946 7:57404483-57404505 CTCGGGAAGGTGTGGATTGGAGG + Intergenic
1025611028 7:63075753-63075775 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1025620787 7:63168717-63168739 CTTTGGGAGGTGAAGGTTGGGGG - Intergenic
1026058524 7:67006109-67006131 TTGTTGGAGGTGGGGCTTGGCGG + Intronic
1026102636 7:67395602-67395624 ATGTTGGAGGTGGGGCTTGGTGG - Intergenic
1026115256 7:67490470-67490492 GTGCTGGAGGTGAGGCTTGGTGG + Intergenic
1026554232 7:71392058-71392080 ATGTTGGAGGTGAGGCCTGGTGG - Intronic
1026557515 7:71421108-71421130 CTGTGGCTGGTGAGCCCTGGCGG + Intronic
1026665995 7:72340314-72340336 CTTTGGAAGGTGGGGGTGGGAGG - Intronic
1026719565 7:72818914-72818936 GTGTTGGAGGTGGGGCTTGGCGG - Intronic
1027513132 7:79108761-79108783 GTGTTGGAGGTGGGGCTTGGTGG + Intronic
1028457187 7:91051249-91051271 ATGTTGGAGGTGAGGCCTGGTGG - Intronic
1028498915 7:91496365-91496387 GTGTTGAAGGTGGGGCCTGGTGG + Intergenic
1028709389 7:93890491-93890513 CTGGAGAAAGCGAGGCTTGGAGG + Intronic
1029146849 7:98452484-98452506 CTGTGGACACTGAGGCTTGGGGG + Intergenic
1029198818 7:98825309-98825331 ATGTTGAAGGTGGGGCCTGGTGG + Intergenic
1029225623 7:99026212-99026234 CTGTGGAAGGTGGAGGTGGGTGG + Intergenic
1029610092 7:101622201-101622223 CTGTGGGAGGTGAGAGGTGGGGG + Intronic
1029643900 7:101839299-101839321 CTGTGCATGGAGGGGCTTGGGGG - Intronic
1029826309 7:103199203-103199225 CTGTGGAAAGTGAGGATCGGAGG - Intergenic
1031008066 7:116497107-116497129 GTGTTGGAGGTGGGGCTTGGTGG - Intronic
1031035722 7:116785573-116785595 GTGTGGGAGCTGAGGCCTGGTGG - Intronic
1031041242 7:116840401-116840423 GTGTTGAAGGTGGGGCCTGGTGG + Intronic
1031395616 7:121270124-121270146 GTGTTGGAGGTGAGGCTTAGTGG - Intronic
1031419946 7:121539492-121539514 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
1031574549 7:123399780-123399802 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
1031623017 7:123958538-123958560 GTCTGGCAGGTGAGGCATGGTGG + Intronic
1031686475 7:124736305-124736327 CTGTTGAAGGTGGGGCTTAGTGG + Intergenic
1031716806 7:125118455-125118477 GTGTTGGAGGTGAGGCTTGGTGG + Intergenic
1031764479 7:125761206-125761228 GTGTTGGAGGTGGGGCTTGGTGG - Intergenic
1032124949 7:129187026-129187048 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1032263931 7:130357272-130357294 CTGTGGCAGGTGGGGCGGGGAGG + Intronic
1032586637 7:133152945-133152967 GAGTGGAAACTGAGGCTTGGGGG + Intergenic
1032704536 7:134410623-134410645 ATGTTGAAGGTGGGGCCTGGTGG + Intergenic
1032810259 7:135406969-135406991 GTGTTGAAGGTGGGGCCTGGTGG + Intronic
1033283971 7:140025186-140025208 CTGAGGAATCTGAGGTTTGGGGG - Intronic
1033784639 7:144716350-144716372 ATGTTGAAGGTGAGGCCTGGTGG + Intronic
1033790809 7:144790688-144790710 GTGTTGAAGGTGAAGCCTGGTGG - Intronic
1034121567 7:148632767-148632789 ATGTTGAAGGTGGGGCCTGGGGG + Intergenic
1034928943 7:155145069-155145091 GTGTGGAAGGAGGGACTTGGTGG - Intergenic
1035046845 7:155973471-155973493 CTGTGGAAGGTGGAGCTGGGAGG + Intergenic
1035184288 7:157113730-157113752 CTGTGGCAGGAGGGACTTGGTGG + Intergenic
1035312816 7:157980891-157980913 GTGTGGGAGGTGGGGCTTGGTGG - Intronic
1035957597 8:4099457-4099479 CTGTGGAAGATGATTGTTGGAGG - Intronic
1036250134 8:7155078-7155100 CTGTGGAAGGGAATGCCTGGAGG - Intergenic
1036367355 8:8132372-8132394 CTGTGGAAGGGAATGCCTGGAGG + Intergenic
1036456446 8:8913107-8913129 ATGTTCAAGGTGGGGCTTGGTGG + Intergenic
1036637043 8:10558336-10558358 GTGTTGAAGGTGAGGTCTGGTGG - Intergenic
1036647308 8:10619477-10619499 ATGAGGAAGGTGAGTTTTGGGGG - Intronic
1036711760 8:11084090-11084112 TTGTGGAAACTGAGGCTTAGAGG - Intronic
1036822239 8:11950352-11950374 CAGTGGCAGGTGAGCCCTGGAGG - Intergenic
1036883528 8:12533290-12533312 CTGTGGAAGGGAATGCCTGGAGG - Intergenic
1037609810 8:20466536-20466558 GGGTGGCAGGAGAGGCTTGGAGG + Intergenic
1037675200 8:21045104-21045126 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1037731990 8:21533861-21533883 ATGTTGAAGGTGGGGCCTGGTGG - Intergenic
1037884769 8:22590134-22590156 CTGTGGAAGGTGGAGGCTGGCGG + Intronic
1038058066 8:23880751-23880773 GTATGGAAGGTGGGGCCTGGTGG - Intergenic
1038163101 8:25059246-25059268 CTGTGGCAGGTGATGGGTGGTGG - Intergenic
1038376026 8:27041358-27041380 ATGTTGAAGGTGAGGCCTGGTGG + Intergenic
1038412261 8:27367891-27367913 GTGTGGGAGGTGGGGCCTGGTGG - Intronic
1038589635 8:28824826-28824848 ATGAGGAAACTGAGGCTTGGAGG - Intronic
1038662631 8:29510408-29510430 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1039092637 8:33848637-33848659 CTGTGGAAGTTGGGTTTTGGAGG + Intergenic
1039561043 8:38512840-38512862 CTGTGGATGGTGCGGGGTGGGGG - Intronic
1040013534 8:42681992-42682014 GTGTTGAAGGTGGGGCTTGGTGG - Intergenic
1040984755 8:53281315-53281337 GTGTTGGAGGTGGGGCTTGGTGG + Intergenic
1041032639 8:53753999-53754021 TTGTGGAAATTGAGGCTTGGGGG - Intronic
1041146638 8:54883176-54883198 CTGTGGCAGGAGAGTCTTGAGGG - Intergenic
1041522221 8:58769291-58769313 CTGTTGGAGGTGGGGCTTGGTGG - Intergenic
1041698204 8:60759821-60759843 CTATGTAGGGTGAGTCTTGGAGG + Intronic
1042032260 8:64489368-64489390 ATGTTGGAGGTGAGGCTTAGTGG - Intergenic
1042071763 8:64942673-64942695 ATGTCGAAGGTGGGACTTGGTGG - Intergenic
1042111992 8:65390627-65390649 TTGTTGAAGGTGGGGCCTGGTGG - Intergenic
1042197237 8:66241496-66241518 GTGTGGGAGGTGTGGCCTGGTGG + Intergenic
1042387657 8:68196607-68196629 ATGTTGAAGGTGGGGCCTGGTGG + Intronic
1042400582 8:68341553-68341575 GTGTTGAAGGTGGGGCCTGGTGG + Intronic
1042515202 8:69652094-69652116 CAGAGGAAGGTGGGGGTTGGGGG - Intronic
1042659305 8:71135912-71135934 GTGAGGCAGCTGAGGCTTGGAGG - Intergenic
1042749203 8:72139810-72139832 GTGTTGAAGGTGTGGCCTGGTGG + Intergenic
1042985202 8:74575630-74575652 ATGTTGAAGGTGAGGCCTAGTGG - Intergenic
1043400888 8:79883128-79883150 GTGTGGAAGGAGAGGCAAGGAGG - Intergenic
1043492228 8:80761012-80761034 GTGTTGAAGGTGGGGCCTGGTGG - Intronic
1043930667 8:86087706-86087728 GTGTGAAAGGTGGGGCCTGGTGG + Intronic
1044189473 8:89297785-89297807 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1044552898 8:93532061-93532083 ATGTTGAAGGTGGGGCCTGGGGG + Intergenic
1044581487 8:93830276-93830298 ATGTGTAGGGTGAGGCATGGGGG - Intergenic
1044582773 8:93838630-93838652 GTGTGGGAAGTGAGGCCTGGTGG - Intergenic
1044669480 8:94664409-94664431 CTGAGGAAGGCCAGGCGTGGTGG - Intronic
1045419024 8:101995682-101995704 GTGTTGAAGGTGGGGCCTGGTGG - Intronic
1045439077 8:102192080-102192102 CTGTTGGAGGTGAGGCCTAGTGG - Intergenic
1045791187 8:105986838-105986860 GTGTTGAAGGTGGGGCCTGGTGG + Intergenic
1046066015 8:109197426-109197448 ATGTGGGAGGTGGGGCCTGGTGG - Intergenic
1046110812 8:109721691-109721713 ATGTTGAAGGTGGGGCCTGGTGG - Intergenic
1047484345 8:125315298-125315320 ATGTGGAAGCTGGGGCTTTGAGG - Intronic
1047537579 8:125733742-125733764 ATGTGGAAGCTGAAGCTTAGCGG - Intergenic
1047627012 8:126666795-126666817 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1047791669 8:128209788-128209810 ATGTTGAAGGTGAGGATTGGTGG - Intergenic
1047997624 8:130351783-130351805 GTGTCGGAGGTGGGGCTTGGTGG - Intronic
1048023230 8:130559935-130559957 GTGTTGAAGGAGAGGCCTGGTGG + Intergenic
1048207159 8:132424411-132424433 CTGTCGAATGAGAGGGTTGGGGG - Intronic
1048973054 8:139655915-139655937 AGGAGGAAGCTGAGGCTTGGGGG - Intronic
1049047051 8:140161021-140161043 ATGAGGAAGTTGAGGCTTGGAGG + Intronic
1049411507 8:142475764-142475786 CGGTGGAGGGAGGGGCTTGGGGG + Intronic
1049450298 8:142657751-142657773 GTGTTGAAGGTGGGGCCTGGTGG - Exonic
1049467063 8:142756440-142756462 CCACGGAAGGTGAGGCTTTGGGG - Intergenic
1049804473 8:144532691-144532713 CTGGGGAAACTGAGGCTTGCAGG - Intronic
1050042865 9:1514098-1514120 CTGAAGAAGGTGAGGCATAGAGG + Intergenic
1050061348 9:1712917-1712939 CTTTGGGAGGAGGGGCTTGGAGG + Intergenic
1050166061 9:2765881-2765903 GTGTTGGAGGTGAGGCCTGGTGG - Intronic
1050284334 9:4085627-4085649 CTGTTGGAGGTGGGGCCTGGTGG + Intronic
1050317672 9:4419895-4419917 ATGTGGTAGGTGAGGCCTGGTGG - Intergenic
1050354595 9:4770729-4770751 CTGTGTGAGGTGAAGATTGGAGG - Intergenic
1050360620 9:4827363-4827385 CTGTGGTAGCTGAGGCTGGAGGG + Intronic
1050378409 9:4997571-4997593 ATGTTGGAGGTGAGGCCTGGTGG - Intronic
1050584107 9:7092248-7092270 CTGTGGAACCTGAGGCTCAGAGG + Intergenic
1050782048 9:9349348-9349370 CTGTGCAAGATGGGGGTTGGAGG - Intronic
1050998925 9:12256479-12256501 CTGGGGAAAGTGTGCCTTGGTGG - Intergenic
1051154231 9:14123003-14123025 CTGTGGGAGGTCAGGGTGGGTGG + Intronic
1051274588 9:15386765-15386787 ATGTTGAAGGTGGGGCCTGGTGG + Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051569549 9:18540479-18540501 GTTTGGAAGGTGAGGCATGAAGG + Intronic
1051705804 9:19878547-19878569 CTGTTGGAGGTGGGGCCTGGTGG + Intergenic
1051882937 9:21858658-21858680 TTGTGGGAGGTGGGGCCTGGTGG - Intronic
1052090346 9:24320017-24320039 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1052830388 9:33210683-33210705 ATGTTGAAGGTGGGGCCTGGTGG - Intergenic
1052985395 9:34483146-34483168 GTGTGGAAGGAGAGGCGTGGAGG - Intronic
1054949566 9:70834937-70834959 ATGTTAGAGGTGAGGCTTGGTGG + Intronic
1055163553 9:73162170-73162192 CTGTTGAAGGTGGGGCCTGTTGG - Intronic
1055352102 9:75400084-75400106 GTGTTGGAGGAGAGGCTTGGTGG - Intergenic
1055663497 9:78530850-78530872 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
1055862545 9:80770110-80770132 TTGAGGAGGCTGAGGCTTGGGGG + Intergenic
1056056825 9:82833440-82833462 CTGTTGGAGGTGGGGCCTGGTGG + Intergenic
1056397904 9:86198153-86198175 AAGTTGGAGGTGAGGCTTGGAGG + Intergenic
1056468238 9:86879759-86879781 TTGTTGAAGGTGCGGCCTGGTGG - Intergenic
1056512547 9:87319641-87319663 TTGTTGAAGGTGGGGCCTGGTGG - Intergenic
1056556864 9:87696787-87696809 ATGTGGGAGGTGAGGCCTGGTGG - Intronic
1056661953 9:88550237-88550259 TTGTTGGAGGTGGGGCTTGGTGG - Intronic
1057312304 9:93950035-93950057 CTGTGGAAAGGGAGGCCTGAGGG - Intergenic
1057325586 9:94060822-94060844 ATGTTGAAGGTGGGGCTTGGTGG - Intronic
1057367943 9:94441514-94441536 ATGTTGAAGGTGGGGCCTGGTGG - Intronic
1057506018 9:95634171-95634193 GTGTTGGAGGTGGGGCTTGGTGG + Intergenic
1057641780 9:96830583-96830605 CTGTGGCAGGGGAGGTTGGGGGG - Intronic
1057689565 9:97271469-97271491 GTGTGGAGGGAGAGGCGTGGGGG - Intergenic
1057802852 9:98200481-98200503 CTGCGGAAGTTGAGGCCTGGAGG + Intronic
1058141480 9:101360713-101360735 GTGTTGGAGGTGAGGCCTGGTGG - Exonic
1058234368 9:102470876-102470898 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1058652896 9:107193684-107193706 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
1058852519 9:109026716-109026738 ATGTTGAAGGTGAGGCCTAGTGG + Intronic
1059260997 9:112976514-112976536 ATGTTGGAGGTGAGGTTTGGTGG + Intergenic
1059440819 9:114305924-114305946 CTCTGGAAGCTGAGGCTTAAGGG + Intronic
1059475217 9:114541065-114541087 GTGTTGGAGGTGAGGCCTGGTGG + Intergenic
1059587858 9:115625531-115625553 CTGTAGAGGCAGAGGCTTGGGGG + Intergenic
1059779989 9:117516029-117516051 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
1060027033 9:120182087-120182109 CTGTGGAAGGCTGTGCTTGGTGG + Intergenic
1060205435 9:121680163-121680185 GTGTAGGAGGTGAGGCTGGGAGG + Intronic
1060234716 9:121854082-121854104 CTGATGAACTTGAGGCTTGGAGG + Intronic
1060255629 9:122027263-122027285 GTGTTGGAGGTGAGGCCTGGTGG - Intronic
1060396656 9:123321203-123321225 CTATGGAAGGTAAGACTCGGGGG - Intergenic
1060672098 9:125478827-125478849 CTGGGAAAACTGAGGCTTGGAGG - Intronic
1060755773 9:126212300-126212322 ATGCTGAAGGTGAGGCCTGGTGG + Intergenic
1061299486 9:129696729-129696751 CTGGGGAAAGTGAAGCTTTGTGG - Intronic
1061349058 9:130049468-130049490 CTTTGGGAGGTGAAGGTTGGAGG + Intergenic
1061505090 9:131027213-131027235 GTGTGGAAGCTGAGGCCTGGAGG + Intronic
1061930277 9:133828822-133828844 GTGTGGAAGGCGAGGCTGGAGGG - Intronic
1062011055 9:134267115-134267137 CTGAGGAGGGTGATGCTTGCAGG + Intergenic
1062091022 9:134678922-134678944 CTGTGCAGGGTGAGGCTCCGAGG + Intronic
1062288798 9:135785532-135785554 GTGGGGAAGCTGAGGCCTGGGGG + Intronic
1062552809 9:137097893-137097915 CGGTGGCAGGGGAGGCTTGGTGG - Exonic
1062653273 9:137589531-137589553 CTGTGGGCATTGAGGCTTGGCGG - Intronic
1185737430 X:2503944-2503966 CTGTGGGGAGTGAGGCCTGGAGG - Intergenic
1185786208 X:2893144-2893166 GTGTTGAAGGTGGGGCCTGGTGG + Intergenic
1185969185 X:4642918-4642940 GTGCTGAAGGTGAGGCCTGGTGG + Intergenic
1186053446 X:5624460-5624482 GTGTTGAAGGAGAGGCCTGGTGG + Intergenic
1187073339 X:15910598-15910620 GATTGGAAGGTGAGGGTTGGGGG + Intergenic
1187260332 X:17679606-17679628 TTGTTGAAGATGAGGCTTGGAGG + Intronic
1187568263 X:20474581-20474603 GTGTTGGAGGTGGGGCTTGGTGG + Intergenic
1188211719 X:27433646-27433668 GTGTGGGAGGTGGGGCCTGGTGG + Intergenic
1188691890 X:33139492-33139514 GTGTTGAAGGTGGGGCCTGGTGG + Intronic
1189025521 X:37389698-37389720 ATGTAGAAGGTGAGGTCTGGTGG - Intronic
1189129777 X:38485578-38485600 GTGGGGACGGTGGGGCTTGGTGG + Intronic
1189285495 X:39849487-39849509 CTGTTGGAGGTGGGGCCTGGTGG + Intergenic
1189328857 X:40130576-40130598 CTGCTGCATGTGAGGCTTGGTGG + Intronic
1190056706 X:47185419-47185441 CTGTAGAGGGTGAGGGTGGGCGG - Intronic
1190328054 X:49218767-49218789 CTGGGGATGGTGGGGGTTGGGGG + Intronic
1190794577 X:53729107-53729129 CTTTGGGAGGTGAGGTTGGGGGG - Intergenic
1191769085 X:64735668-64735690 GTGTTGAAGGTGAGGCCTGGTGG - Intergenic
1192162741 X:68800747-68800769 CTGTGTAAGCTGAGGCTCAGGGG - Intergenic
1192191603 X:68994525-68994547 CTGGGGAAGGTGGGGCTAGCAGG - Intergenic
1192793451 X:74406704-74406726 ATGTTGGAGGTGAGGCCTGGTGG - Intergenic
1192997850 X:76531453-76531475 CTGTGGCAGGGCAGACTTGGTGG + Intergenic
1193025331 X:76840503-76840525 CTGTTGTTGGTGAGGCATGGTGG - Intergenic
1193063872 X:77236212-77236234 CTGTTCAAGGCCAGGCTTGGTGG - Intergenic
1193527684 X:82612991-82613013 ATGTTGGAGGTGAGGCCTGGAGG + Intergenic
1193564037 X:83055673-83055695 ATGTTGAAGGTGGGGCCTGGTGG - Intergenic
1194093085 X:89602222-89602244 ATGTGGGAGGTGTGGCGTGGTGG + Intergenic
1194764303 X:97831421-97831443 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
1194922159 X:99779809-99779831 ATGTTGAAGATGAGGCTTAGTGG - Intergenic
1195286318 X:103387842-103387864 CTGGGGAAGGCCTGGCTTGGTGG - Intergenic
1195825984 X:109001421-109001443 CTGTGGAAGTTTATGCTTGTGGG - Intergenic
1195829777 X:109043968-109043990 CTGTGGCAAGTGAGAGTTGGAGG - Intergenic
1196004893 X:110825397-110825419 GTGTTGCAGGTGAGGCCTGGTGG + Intergenic
1196291488 X:113946881-113946903 ATGTCGAAGGTAAGGCCTGGTGG - Intergenic
1196515658 X:116606968-116606990 CTGTGGGAGGTGAGATTAGGGGG + Intergenic
1197585111 X:128337508-128337530 GTGTGGGAGGTGGGGCCTGGTGG + Intergenic
1197832247 X:130655970-130655992 GTGTGGAAGCTGAGGCTCAGTGG + Intronic
1197977867 X:132184507-132184529 ATGAGGAAAGTGAGGCTTAGAGG - Intergenic
1198709990 X:139491159-139491181 ATGTTGAAGGTGGGGCCTGGTGG - Intergenic
1199011009 X:142758989-142759011 ATGTTGGAGGTGTGGCTTGGTGG + Intergenic
1199148066 X:144395059-144395081 GTGTGGGAGGTGGGGCCTGGTGG - Intergenic
1199253277 X:145689411-145689433 ATGTTGAAGGTGGGGCCTGGTGG + Intergenic
1199485305 X:148340272-148340294 GTGTTGAAGGTGGGGCCTGGTGG + Intergenic
1199753144 X:150840091-150840113 CTCTGGAGGCTGAGGCTGGGGGG + Intronic
1199987747 X:152964610-152964632 GTGTTGGAGGTGGGGCTTGGAGG - Intronic
1201151513 Y:11097761-11097783 GAGTGGAAGGTGAGGTTTGAGGG - Intergenic
1201533896 Y:15023965-15023987 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic