ID: 1096978188

View in Genome Browser
Species Human (GRCh38)
Location 12:55712344-55712366
Sequence TGGGCTTCAAGAGAGGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 235}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096978188 Original CRISPR TGGGCTTCAAGAGAGGGGGT TGG (reversed) Intronic
900368313 1:2320424-2320446 TGGGCTGCAAGGACGGGGGTGGG + Intergenic
900553233 1:3267171-3267193 AGGGCTGGAAGAGAGGGGATGGG - Intronic
901051897 1:6429546-6429568 TCTGCTTGAAGTGAGGGGGTGGG - Intronic
901238112 1:7678398-7678420 TGGGCTTCAAGGGAGCAGGCAGG + Intronic
902455728 1:16532864-16532886 TCGGCTTCAGTAGATGGGGTCGG + Intergenic
902482338 1:16718468-16718490 TCTGCTTGAAGTGAGGGGGTGGG + Intergenic
902496444 1:16875048-16875070 TCGGCTTCAGTAGATGGGGTCGG - Intronic
904928894 1:34070692-34070714 TGGTCTGCAAGGGTGGGGGTGGG - Intronic
904974109 1:34442782-34442804 TGGCCTGCAAGTGAGGGGCTGGG - Intergenic
907386201 1:54127216-54127238 ATGGTTTCAGGAGAGGGGGTTGG - Intergenic
907668803 1:56456636-56456658 TTGGCTTCCAGAGGAGGGGTTGG - Intergenic
910053655 1:83006293-83006315 TGGGCATCAAGAGCAAGGGTGGG + Intergenic
910173357 1:84401512-84401534 TGGGCTTCAGGAGAGGTGGAAGG - Intronic
912473225 1:109920076-109920098 CAGGCTCCAAGAGAGAGGGTGGG + Intronic
912845658 1:113072877-113072899 TGGGCTTTAAGAAAGGGGAGTGG - Intergenic
913424645 1:118713651-118713673 GGGGCTCCAAGAGAGGGTCTTGG - Intergenic
913661097 1:121007161-121007183 TCGGCTTCAGTAGATGGGGTTGG + Intergenic
914012465 1:143790338-143790360 TCGGCTTCAGTAGATGGGGTTGG + Intergenic
914165367 1:145170845-145170867 TCGGCTTCAGTAGATGGGGTTGG - Intergenic
914436432 1:147664278-147664300 GGGGCTGCTAGAGAGGAGGTGGG - Intronic
914651094 1:149698948-149698970 TCGGCTTCAGTAGATGGGGTTGG + Intergenic
914713348 1:150234861-150234883 TCGCCTTAAAGAGACGGGGTTGG - Intronic
914826065 1:151138611-151138633 TGGGGTACAAAAGAGAGGGTGGG - Exonic
915163454 1:153935023-153935045 GGGGCTCCAAGACAGGGAGTGGG - Intronic
915168164 1:153960075-153960097 GGGGCTTCAAGAGAGGGGCAGGG - Exonic
919767253 1:201135420-201135442 TGGGGTTGAAGGGAGGGGGAAGG - Exonic
920034317 1:203056101-203056123 TGGGCTGCAAGAGAGAGGGATGG - Exonic
920764918 1:208823138-208823160 TAGTCTTTGAGAGAGGGGGTAGG + Intergenic
921123822 1:212159431-212159453 TAGGCACCAAGAGAGGGGTTGGG + Intergenic
922746787 1:228048757-228048779 AGGGCATGAGGAGAGGGGGTGGG - Intronic
922851420 1:228736217-228736239 TGGGCTTGGAGAGAGGAGGGCGG + Intronic
922851685 1:228738216-228738238 TGTGCTTCAAGTGATGGGGCTGG - Intronic
922975599 1:229781040-229781062 TTGTCATCAAGAGAGGAGGTAGG + Intergenic
923035427 1:230281709-230281731 CGGGCGTCAAGAGCAGGGGTGGG + Exonic
1066064127 10:31750112-31750134 TGGGCTTCAGGGGAGAGGGGAGG + Intergenic
1066492012 10:35903055-35903077 TGGGTTTCAGGAGAGGAGATTGG - Intergenic
1068436619 10:57000736-57000758 AGGTCTAGAAGAGAGGGGGTTGG + Intergenic
1069652086 10:70056603-70056625 TGGACTTGAAGGGAGGGTGTTGG + Intronic
1071475724 10:86023545-86023567 TGGTGTTCAAGAGAGGGGTCTGG - Intronic
1071476650 10:86031398-86031420 TGGACTTCAAAAGGGGGGGCAGG + Intronic
1071569772 10:86690552-86690574 TGGGCTACAAGAGCAGAGGTGGG - Intronic
1071858052 10:89645319-89645341 TGGGCTTGCAGAGAGGAGATGGG + Exonic
1072221999 10:93334505-93334527 TGGGCTTCTAGAGACGGGTGAGG + Intronic
1072805973 10:98424282-98424304 TGGGCCTCAGGACAAGGGGTGGG - Intronic
1074107630 10:110400320-110400342 TGGGGTCCAAGAGAGGGGAACGG - Intergenic
1077465740 11:2732915-2732937 TGGGCCTCCAGAGGGTGGGTGGG - Intronic
1078571108 11:12458680-12458702 TGGGCTGCCACAGAGGGGGTAGG - Intronic
1079123294 11:17699965-17699987 TGGCCTTCCAGAGAAGGGGAAGG + Intergenic
1081761294 11:45577948-45577970 AGAGCTTCAGGAGTGGGGGTGGG - Intergenic
1082104846 11:48210567-48210589 TGGTCTTCTAGTGAGTGGGTGGG + Intergenic
1083637814 11:64129762-64129784 TAGGCTTCAGGATTGGGGGTGGG + Intronic
1084548766 11:69828274-69828296 TTGACTTCAAGAGAGGAGCTTGG + Intergenic
1084669183 11:70595263-70595285 GGGGCTTCCTGAGAGGGGGTCGG - Intronic
1084746571 11:71173880-71173902 AGGGCTTCAAGAGGGGAGGAAGG + Intronic
1085039767 11:73319994-73320016 TGGGCACCTAGGGAGGGGGTGGG + Intronic
1085095791 11:73760211-73760233 TGGGGCTCAAGAAAGGGGGCCGG + Intronic
1085393293 11:76193473-76193495 TGGGTTTCATGAGCAGGGGTAGG + Intronic
1085594124 11:77792359-77792381 TGGGCTGGGAGAGTGGGGGTGGG - Intronic
1085617992 11:78016337-78016359 TGGACTTCAAGAGAAGGGTCTGG + Exonic
1085743575 11:79096498-79096520 GGGGCTTACAGAGTGGGGGTGGG - Intronic
1086900947 11:92366867-92366889 TGGGCTTCATTAGAGGTGGTGGG + Intronic
1087836789 11:102883156-102883178 GGGGCTTCAAGTGAAGGAGTGGG - Intergenic
1088333470 11:108677112-108677134 TGGACTTCAACAGATGGGCTGGG + Exonic
1088617195 11:111642672-111642694 TGGGAATCTAGAGAGGGGATGGG - Intronic
1088916244 11:114230055-114230077 TGGGCTTCAACCGAGAGGGCGGG - Intronic
1090270378 11:125381649-125381671 TGGGCTTGCAGGGATGGGGTGGG - Intronic
1090846014 11:130530479-130530501 TGGCCTCCAAGAAAGGGGATGGG + Intergenic
1091026808 11:132148772-132148794 TGGGCTCCAAGAGAGACGGCTGG + Intronic
1091749014 12:3011070-3011092 TGGGCCTCAAGAGACGGGTAGGG + Intronic
1091804950 12:3349203-3349225 TGGGCTTCATTCGTGGGGGTTGG - Intergenic
1093633227 12:21435072-21435094 TGGCCTTCAAGAGATTAGGTGGG + Intergenic
1096227435 12:49875411-49875433 TGGGCTGCAGGAGAGGGTGAGGG + Intronic
1096239998 12:49954731-49954753 TGGGTTTCTAGAGAAGGGGAGGG - Intronic
1096978188 12:55712344-55712366 TGGGCTTCAAGAGAGGGGGTTGG - Intronic
1098560361 12:71865577-71865599 TGGGCCCCAGGAGAGGGGGTAGG + Intronic
1098571968 12:71997938-71997960 TGGGCTTCAGGATAGGGGGCAGG + Intronic
1099274822 12:80561397-80561419 TGGGCTTCAACAGAGAAGGTAGG + Intronic
1100572323 12:95854413-95854435 TGTGCTTCAGGAGAGGAGGAGGG - Intergenic
1103865545 12:124049239-124049261 TGGGCCTCAGGAGGTGGGGTGGG - Intronic
1103870304 12:124086468-124086490 TGGACTTTAAGATAGGGAGTGGG + Intronic
1104261142 12:127183286-127183308 TGGGCATCAAGAGTGTAGGTAGG + Intergenic
1107399445 13:40055230-40055252 TGAGCTTCAAGAGATGGTTTTGG - Intergenic
1110523619 13:76509606-76509628 TTGGCTTCAAAAGATGGAGTAGG + Intergenic
1119471849 14:74905473-74905495 TGGGCCTCAGGGGAAGGGGTGGG - Exonic
1122871383 14:104640594-104640616 TGGGCATCACTAGAGGGGGTTGG - Intergenic
1123827317 15:24095252-24095274 TTGGTTTCAGGAGATGGGGTGGG + Intergenic
1123861346 15:24470579-24470601 TTGGTTTCAGGAGATGGGGTGGG + Intergenic
1126339448 15:47623061-47623083 AGGGCTTCAGGAGAGGGAGGGGG - Intronic
1127692131 15:61407398-61407420 TGGGCTTCAAGAAAGGAGCTTGG + Intergenic
1129054531 15:72809509-72809531 TAGGCTTGAAGAGAAGGGGAAGG + Intergenic
1129451186 15:75652193-75652215 AGGCCTTCAAGGGAGTGGGTGGG + Intronic
1129681831 15:77662497-77662519 AAGGCTTCAAGAGAGGGTGGAGG - Intronic
1129905744 15:79186009-79186031 GGGGCTTTAAGAGTGAGGGTGGG - Intergenic
1130100793 15:80892435-80892457 TGGGTTTTAAGAGAGAAGGTGGG - Intronic
1131083418 15:89555773-89555795 TGGGCATGAAGAGACAGGGTTGG - Intergenic
1131671774 15:94627373-94627395 TGGGCTGGAAGAGTGGGGGTAGG + Intergenic
1132049159 15:98592451-98592473 TGAGCTTCATGAGAAAGGGTTGG + Intergenic
1132595270 16:746266-746288 TGGGCAGCAGGAGAGGAGGTGGG + Intronic
1132595281 16:746310-746332 TGGGCAGCAGGAGAGGAGGTGGG + Intronic
1132595314 16:746441-746463 TGGGCAGCAGGAGAGGAGGTGGG + Intronic
1132595324 16:746485-746507 CGGGCTGCAGGAGAGGAGGTGGG + Intronic
1132595336 16:746529-746551 CGGGCTGCAGGAGAGGAGGTGGG + Intronic
1132595345 16:746573-746595 TGGGCAGCAGGAGAGGAGGTGGG + Intronic
1132595380 16:746707-746729 TGGGCAGCAGGAGAGGAGGTGGG + Intronic
1136136311 16:28258838-28258860 TGGCCTCCAGGAGAGAGGGTTGG - Intergenic
1136178309 16:28533702-28533724 TGAGCCTCATGAGATGGGGTCGG + Intronic
1138213895 16:55186241-55186263 TGAGCTTCAAGGGAAGGGGCAGG + Intergenic
1139478951 16:67217757-67217779 AGGGCTTCAGCAGAGAGGGTTGG - Intronic
1140450874 16:75069876-75069898 TGGGCTGCTAGAAAGGGGGCAGG - Intronic
1144135963 17:12295141-12295163 TGGGGTTGAAGAGTGGGGGAAGG + Intergenic
1145974760 17:28977683-28977705 TGGGCTTCAGTAGGGGTGGTAGG + Intronic
1146228618 17:31089399-31089421 TGATCTTCAAGCAAGGGGGTGGG + Intergenic
1146666899 17:34711229-34711251 GGGGCTTAGAGAGATGGGGTTGG - Intergenic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1147968293 17:44206035-44206057 TGGGCTTCAAGAAATGTGCTGGG - Exonic
1148383120 17:47214533-47214555 TGTGCTTAAAATGAGGGGGTTGG - Intronic
1148478863 17:47946818-47946840 TAGGTGTCAAGAGAGGGTGTGGG + Exonic
1148486652 17:47995257-47995279 TGGCAGTCAGGAGAGGGGGTGGG - Intergenic
1148616036 17:48999811-48999833 TGGGCTGAAGGAGTGGGGGTAGG - Intronic
1149893721 17:60412657-60412679 TGGGCCTGAAGGGAGGGAGTGGG + Intronic
1151825535 17:76521955-76521977 TGGGCTCCCAGAGTGAGGGTGGG - Intergenic
1152124487 17:78438174-78438196 TCAGCTTCAAGAGGAGGGGTGGG - Intronic
1152250596 17:79210673-79210695 TGCCCTTCAAGAGATGGGGCTGG + Intronic
1152848771 17:82618958-82618980 TGGGATTTGGGAGAGGGGGTAGG - Intronic
1155248668 18:23935380-23935402 TGGGCTTCAGCAGATAGGGTGGG + Intronic
1155341430 18:24818075-24818097 GAGGCTTCATCAGAGGGGGTGGG - Intergenic
1155782237 18:29850809-29850831 GGGGCTTCAAGGGAAAGGGTGGG + Intergenic
1156409101 18:36810865-36810887 TGGGCCTCAAGGGAAGGGCTAGG + Intronic
1156475275 18:37402068-37402090 TGGGTTTCAAGTGAGGGAGTTGG - Intronic
1158509705 18:58079668-58079690 TGGGCTTCAAGAATGAGAGTTGG + Intronic
1158629613 18:59100498-59100520 TGGCCTGGAAGAGAGTGGGTGGG + Intergenic
1159627348 18:70710065-70710087 TGGGGTCTAAGAGAGGAGGTAGG - Intergenic
1160814171 19:1027729-1027751 TGGGCGTCGGGGGAGGGGGTGGG - Intronic
1161729626 19:5951424-5951446 TGGGCTTCAGGAGCGGGAGGCGG + Exonic
1162547597 19:11339722-11339744 GGGGCTTTCAGAGAGCGGGTGGG + Intronic
1162782027 19:13011490-13011512 TGGACTTCAGGAGTGAGGGTGGG + Intronic
1163028882 19:14530309-14530331 TGGGCTTCAAGAGTGGCTGTGGG - Intronic
1163197527 19:15733471-15733493 GGGGCTTGAGGAGAGGGGGAAGG + Intergenic
1164441243 19:28282267-28282289 TGGTCTGAAAAAGAGGGGGTGGG - Intergenic
1166721898 19:45001697-45001719 TGGGGTTCAGGAGAGGGGTCTGG + Intronic
1166878875 19:45914713-45914735 TGGGCCACAGGAGAGGGGCTGGG + Exonic
1167264167 19:48475153-48475175 TGTGGGTCAAGAGAAGGGGTTGG - Intronic
1202706620 1_KI270713v1_random:29221-29243 TCGGCTTCAGTAGATGGGGTCGG + Intergenic
927965117 2:27263306-27263328 TGGGCTTCAGGAGCGAGGCTTGG - Intronic
928284778 2:29980295-29980317 GGGGCTCCAAGAGAAGGGCTGGG - Intergenic
929947090 2:46379927-46379949 TCGGCTTCAAGAGAGAAGGCGGG + Intronic
930172803 2:48268527-48268549 TGGGGTTCAAGAGAGAAAGTGGG - Intergenic
931618590 2:64187076-64187098 TGGGATAAAAGAGTGGGGGTTGG + Intergenic
931696688 2:64876278-64876300 TGGGTTTGGAGGGAGGGGGTTGG + Intergenic
932217281 2:69975145-69975167 TGCCCTTCAAGGGAGGGGCTGGG - Intergenic
932411369 2:71549859-71549881 TGGCCTTCAGGAGAGGTGGGAGG - Intronic
932581376 2:72994678-72994700 TGGGCTGGAGGAGAAGGGGTGGG - Intronic
934768297 2:96892820-96892842 GGGGCCTCTAGAGAGGAGGTGGG - Intronic
935599159 2:104904817-104904839 TGGGGTGCAAGAGAGGGGCGTGG + Intergenic
935930722 2:108121879-108121901 TGGAGTTGGAGAGAGGGGGTTGG - Intergenic
937871477 2:126789274-126789296 TGGCCTACAGGAGAGAGGGTGGG - Intergenic
938198949 2:129357294-129357316 TGGGCTTCCAAAGAGGGGCTGGG - Intergenic
940865184 2:158810725-158810747 AGGGCTTCAAGAGGTGGGGAAGG - Intronic
943796275 2:192000452-192000474 TGGTATTAGAGAGAGGGGGTTGG - Intronic
944329511 2:198448714-198448736 TGGGGTGCAAGAGAGGTTGTGGG + Intronic
944490469 2:200253525-200253547 TGGGCTTCTAGAGATGGTTTGGG + Intergenic
945147777 2:206756530-206756552 TGGGGTTACAGAGAGGGAGTGGG + Intronic
946618559 2:221535956-221535978 TGGGGTTGAAGAGACTGGGTAGG - Intronic
947554187 2:231075175-231075197 TGGGCTTGAAAAGAAGGGGCTGG - Intronic
947820936 2:233068978-233069000 TGGGCTCCAATTGAGGGGGTGGG + Intronic
948058304 2:235025867-235025889 GGGTCTTCAAGAAAGTGGGTGGG + Intronic
948349261 2:237324816-237324838 TGAGCGTCGAGAGAGGGGGTGGG + Intronic
1168877234 20:1180271-1180293 CTGCCTTCAAGTGAGGGGGTTGG - Intronic
1170001651 20:11621372-11621394 CAGGCTCCATGAGAGGGGGTGGG - Intergenic
1173827272 20:46055953-46055975 TGGGGTTCTGGAGAGGAGGTGGG + Intronic
1174325070 20:49772425-49772447 TGTTCTGCATGAGAGGGGGTGGG - Intergenic
1176372167 21:6068788-6068810 TGGACTCCGAGGGAGGGGGTTGG - Intergenic
1179751352 21:43469751-43469773 TGGACTCCGAGGGAGGGGGTTGG + Intergenic
1179800346 21:43808746-43808768 TGGGCTTCAAATGGGGAGGTGGG - Intergenic
1179992985 21:44958287-44958309 TGGGCCTCAAGCAAGGGTGTCGG - Intronic
1180188886 21:46153454-46153476 TCGGCTTCAGGGGAGGGGGTTGG - Intronic
1182059994 22:27390281-27390303 TGGGGGTCAAGAGGAGGGGTAGG - Intergenic
1182618938 22:31607738-31607760 TGGGCTTCCTGTGAGGGGCTGGG + Intronic
1184232043 22:43163476-43163498 TGGGCTTCAGCAGAGGGAGGGGG + Intergenic
1184871214 22:47239663-47239685 TGGGCTTCAGGAGATGAGGCAGG - Intergenic
1184984338 22:48119215-48119237 TGGGCTTCCAGGTATGGGGTAGG + Intergenic
949786174 3:7744254-7744276 TGGGCTGAAGGAGAGGGGGCAGG - Intergenic
951610848 3:24491632-24491654 TGGGCTGCAAAAGTGGTGGTTGG - Intronic
952879516 3:37974728-37974750 TGGGCTTCAAGGAAGTGGATGGG + Intronic
953283658 3:41583003-41583025 TGGCTTTCAAGAGATGGGGTGGG + Intronic
957519385 3:81299155-81299177 TTGGCTTCAATAGAGGGGTGTGG + Intergenic
960065229 3:113365130-113365152 TGGGTTTCTATAGAGAGGGTTGG + Intronic
960463604 3:117967886-117967908 TGGGCTACAAGAGAGGAGAAGGG + Intergenic
965799575 3:172477683-172477705 TATGCTTCAAGTGAGGAGGTTGG + Intergenic
966151956 3:176875352-176875374 TGGGCTTCCAGAGGGAGGGGCGG - Intergenic
969254330 4:5992119-5992141 TGGGCTTCAAGGGAAGGGGGCGG + Intergenic
974433536 4:61829338-61829360 TGTGCTTAAAAAAAGGGGGTTGG - Intronic
977470184 4:97433617-97433639 TGGGCTGCAAGAGAGAGGTTGGG + Intronic
984616449 4:181903976-181903998 TGGAGTTCAAGGGAGAGGGTGGG - Intergenic
984833078 4:183993902-183993924 TGGTCTTCAAGAGAGCGCATAGG + Intronic
985085493 4:186308706-186308728 TGTGCTGCAAGAGAGGGACTTGG + Intergenic
985122934 4:186661796-186661818 TGGGCTTGAAGAGAGGTTATGGG + Intronic
985629769 5:1008505-1008527 TTGGCTGCTGGAGAGGGGGTGGG - Intergenic
986275933 5:6274990-6275012 TTGGCTTTAAGTGAGGGGGATGG + Intergenic
986371149 5:7081482-7081504 TGGTCTCCAAGACAGGGAGTGGG + Intergenic
987012411 5:13781136-13781158 TGGGCTGCATCAGACGGGGTGGG + Intronic
990399320 5:55421911-55421933 TGGGTGTCAAGAGAGAGGGTAGG - Intronic
990791318 5:59483398-59483420 TGGAATTCCAGAGAGGGGGATGG - Intronic
991410160 5:66337913-66337935 TGAGCTTCAAGAGATGTGGCGGG + Intergenic
992136668 5:73752913-73752935 TGGGCTTCAGGAGACGGTGACGG + Exonic
993048116 5:82892386-82892408 TGGGCTCTATGAGAGTGGGTGGG + Intergenic
995210420 5:109531197-109531219 TGTGTTTTAAGTGAGGGGGTAGG + Intergenic
997882128 5:137600666-137600688 GGGAATACAAGAGAGGGGGTGGG - Intergenic
998635396 5:143949168-143949190 TGGAATTCAAGAGAGAGGTTAGG - Intergenic
1000882764 5:166716461-166716483 TGGGATTCAAGAGAGGGGGAAGG + Intergenic
1001857768 5:175027613-175027635 TGTGGTTGAGGAGAGGGGGTGGG + Intergenic
1002070799 5:176677969-176677991 TGGGGTCCAAGAGATGGGGGAGG + Intergenic
1002330077 5:178434963-178434985 TCTGCTGCAAGGGAGGGGGTCGG + Intronic
1003235108 6:4288516-4288538 ATGGCTGCAAGTGAGGGGGTGGG - Intergenic
1003342943 6:5239483-5239505 TGGGCATCTAGGGAGGGTGTGGG + Intronic
1006358700 6:33575590-33575612 TGGGCTCCAGGAGAAGGGGCAGG + Intronic
1006594058 6:35179751-35179773 TGGGCTTGCAGACAGGGAGTAGG - Intergenic
1006728171 6:36215032-36215054 TTGGCTGCAGCAGAGGGGGTGGG + Intronic
1011624888 6:89274564-89274586 TCTGCTTTAAGAGAGGGGCTGGG + Intronic
1011686717 6:89829692-89829714 AGGGCTTTAAGAGAGAGGGGCGG - Intergenic
1011798452 6:90983011-90983033 TGGGGTGCTGGAGAGGGGGTAGG - Intergenic
1013286256 6:108684797-108684819 TAGGGTTCAAGAAAGGGGGAGGG - Intergenic
1013954296 6:115822653-115822675 TGGGCTTCTGGAGAGAGGGCTGG + Intergenic
1014516646 6:122387168-122387190 TGGGGTTCAAGAAAGGGTGTAGG - Intergenic
1019710898 7:2517779-2517801 TGGGCCTCAAGAAACGGGGCTGG + Intronic
1022641674 7:32191388-32191410 TGGGGGTTAAAAGAGGGGGTAGG - Intronic
1023820228 7:43976796-43976818 GGGGCTCCAGGAGAAGGGGTGGG + Intergenic
1025776773 7:64567944-64567966 AGGGATTCTAGGGAGGGGGTGGG - Intergenic
1026831528 7:73613156-73613178 TGGGCTTCACGGGAGTGGGGAGG - Intronic
1029748516 7:102530317-102530339 GGGGCTCCAGGAGAAGGGGTGGG + Intergenic
1029766463 7:102629401-102629423 GGGGCTCCAGGAGAAGGGGTGGG + Intronic
1030666286 7:112282240-112282262 TGGGCATGGAGAGATGGGGTGGG + Intronic
1031934100 7:127718055-127718077 TGGGCTTCAAGAAATGGGGAGGG + Intronic
1032090427 7:128908977-128908999 TGGGCTTCAAAAGTGGGACTTGG + Intronic
1032090730 7:128910387-128910409 GGGGGTTCAGGAGAGGGGGGCGG - Intronic
1032389392 7:131546191-131546213 TTTGGTGCAAGAGAGGGGGTAGG + Intronic
1035219181 7:157395467-157395489 TGAGCTTCAGGAGAGGCAGTTGG + Intronic
1037507961 8:19551386-19551408 TTGGCTTGAAGGGAAGGGGTTGG - Intronic
1038449761 8:27632680-27632702 AGGGCACCAAGAGAGGAGGTGGG - Intergenic
1039711488 8:40060186-40060208 TGGGCTTCAGGAGCAGGGATGGG + Intergenic
1040842890 8:51803519-51803541 TGTTCTTCAAGAGAGAGGATGGG - Intronic
1040900117 8:52410010-52410032 TGGGAGTCAAGAAAGGGGGAGGG + Intronic
1041215858 8:55599505-55599527 TGGTCTCCCAGAGAGGGTGTTGG - Intergenic
1041591723 8:59594396-59594418 TAGGTTTCAACAGAAGGGGTTGG - Intergenic
1042574256 8:70200372-70200394 TGGGCTTCATGGAAGGTGGTTGG - Intronic
1045371806 8:101531800-101531822 TGGGGCTCCCGAGAGGGGGTGGG + Intronic
1047770501 8:128026755-128026777 TGTGCTTCCAGAGGGAGGGTAGG - Intergenic
1050618672 9:7429787-7429809 TTGGCTTCAAGAGAGGAGATAGG - Intergenic
1051893930 9:21969496-21969518 TGTGCTTGAAGAGGGGGTGTTGG + Intronic
1056960590 9:91118801-91118823 TCGGCTGCAAGAGGTGGGGTGGG - Intergenic
1057554156 9:96074181-96074203 TGGGCACCGAGAGAGGGGCTTGG - Intergenic
1060045747 9:120338679-120338701 TAGGCTGCAAGAGAGGGGGAAGG - Intergenic
1061250325 9:129422674-129422696 TGTGATTCAAGAGAGGGGCTTGG + Intergenic
1062160727 9:135078186-135078208 TGGGCTTCAGGATAGGGTGCTGG + Intronic
1187205375 X:17176599-17176621 TGGGTTTCTGGAGAGGGTGTGGG - Intergenic
1189077577 X:37933346-37933368 TGGGGCTGAAGAGAGGGGGATGG - Intronic
1192945902 X:75965423-75965445 TTGGCTTCAAGAGTGTTGGTGGG + Intergenic
1194468930 X:94268456-94268478 GGGGCTTCAAGGGAGGTGTTTGG + Intergenic
1195112136 X:101659202-101659224 TGGGCTTCACGGGAGGTGGGGGG - Intronic
1198327175 X:135585387-135585409 TGCTCTTCAAGAGTGGGGGAAGG + Intergenic
1198517465 X:137424475-137424497 TGGCCTTTAGGAGAGGGGATGGG - Intergenic
1199599589 X:149534099-149534121 AGCGCTTCATGGGAGGGGGTGGG - Intergenic
1199651044 X:149946111-149946133 AGCGCTTCATGGGAGGGGGTGGG + Intergenic
1199979513 X:152913277-152913299 TGGGCCTCAAAATAGGGGCTGGG - Intergenic