ID: 1096979794

View in Genome Browser
Species Human (GRCh38)
Location 12:55721815-55721837
Sequence TTGCTGCAGCAGAGGCAGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 660
Summary {0: 1, 1: 0, 2: 8, 3: 70, 4: 581}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096979794_1096979807 23 Left 1096979794 12:55721815-55721837 CCCTGCTGCCTCTGCTGCAGCAA 0: 1
1: 0
2: 8
3: 70
4: 581
Right 1096979807 12:55721861-55721883 CACCAGCGTCCTGGGTCGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 310
1096979794_1096979806 15 Left 1096979794 12:55721815-55721837 CCCTGCTGCCTCTGCTGCAGCAA 0: 1
1: 0
2: 8
3: 70
4: 581
Right 1096979806 12:55721853-55721875 ATCAACATCACCAGCGTCCTGGG 0: 1
1: 0
2: 0
3: 10
4: 111
1096979794_1096979801 -10 Left 1096979794 12:55721815-55721837 CCCTGCTGCCTCTGCTGCAGCAA 0: 1
1: 0
2: 8
3: 70
4: 581
Right 1096979801 12:55721828-55721850 GCTGCAGCAAGCCCGGGGCCGGG 0: 1
1: 0
2: 3
3: 45
4: 419
1096979794_1096979805 14 Left 1096979794 12:55721815-55721837 CCCTGCTGCCTCTGCTGCAGCAA 0: 1
1: 0
2: 8
3: 70
4: 581
Right 1096979805 12:55721852-55721874 GATCAACATCACCAGCGTCCTGG 0: 1
1: 0
2: 0
3: 9
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096979794 Original CRISPR TTGCTGCAGCAGAGGCAGCA GGG (reversed) Exonic
900022780 1:196138-196160 TTGCTGCTGTAGTGGCACCAGGG - Intergenic
900555468 1:3278230-3278252 ATGCTGGAGGAGATGCAGCATGG - Intronic
900559049 1:3294631-3294653 TGGCTGAAGGGGAGGCAGCACGG - Intronic
900624891 1:3603586-3603608 TTGCTGCACCTGAGGCTGGAGGG - Intronic
900831222 1:4967131-4967153 CAGCTGGAGCAGAGGGAGCAGGG - Intergenic
900844824 1:5088840-5088862 TCACTGCCTCAGAGGCAGCAGGG - Intergenic
900979799 1:6039845-6039867 TTGCTTCATCAGAGCCAGGAGGG + Intronic
901054723 1:6443826-6443848 TGCCGGCAGCAGGGGCAGCATGG + Intronic
901112610 1:6810377-6810399 TTGCTTCATCAGAGCCAGGAGGG + Intronic
901153506 1:7120468-7120490 TTGCTTCATCAGAGCCAGCAGGG + Intronic
901556371 1:10034341-10034363 TTGCTGTAGCAGAGACTGAACGG + Intronic
901889555 1:12250887-12250909 TAGTTGCAGCAGAGACTGCATGG + Intronic
901889562 1:12250972-12250994 TAGTTGCAGCAGAGACTGCATGG + Intronic
901889569 1:12251057-12251079 TAGTTGCAGCAGAGACTGCATGG + Intronic
901889576 1:12251142-12251164 TAGTTGCAGCAGAGACTGCATGG + Intronic
902096657 1:13951210-13951232 TGGCTCCCGGAGAGGCAGCAAGG + Intergenic
902120439 1:14160419-14160441 TCCCTGCAGCAGTGGCAGCAAGG - Intergenic
902378319 1:16040746-16040768 ATGCCGCAGCAGAGAGAGCAAGG - Intergenic
902479637 1:16704778-16704800 TGCCGGCAGCAGGGGCAGCATGG - Intergenic
902511712 1:16970253-16970275 GTGCTGCGGCAGCGGCAGGAGGG + Exonic
902687127 1:18085498-18085520 TTGCTTCATCAGAGCTAGCAAGG + Intergenic
902875200 1:19336810-19336832 GTCCTGCAGCAGAGGCTGCTAGG - Intergenic
902936569 1:19769065-19769087 TTGCTGAAGCCCACGCAGCAGGG - Intronic
903024163 1:20415413-20415435 TGGCTGCAGCAGAGTGACCAAGG + Intergenic
903296045 1:22343675-22343697 TGGCTGCAGCAGAGTGGGCAAGG + Intergenic
904040783 1:27583598-27583620 TTGATCCAGCAGAGGAAGGAGGG - Intronic
904876901 1:33662347-33662369 TGGCTGAAGCACAGGGAGCAAGG - Intronic
905034741 1:34910541-34910563 TGGCTGCCGCAGAGAAAGCAAGG - Intronic
905295914 1:36954306-36954328 GGGCTCCAGGAGAGGCAGCAGGG - Intronic
905441321 1:37997964-37997986 TTGCTGCAGCGGGCGCAGCGAGG + Exonic
906003336 1:42446096-42446118 TCCATGCAGCAGAGGCAGCCTGG + Intronic
906135814 1:43500095-43500117 CAGCTGCATCACAGGCAGCAGGG - Intergenic
906202164 1:43967255-43967277 TTGCTGCAGAAGCGGCGGAAGGG + Intronic
906640068 1:47436570-47436592 TTGCTACAGCGGAGGCAGCTGGG + Exonic
906864737 1:49405543-49405565 GAGCAGCAGCAGTGGCAGCATGG - Intronic
907184311 1:52598120-52598142 TGGCTGGAGCAGAGTGAGCAAGG - Intergenic
907456931 1:54581991-54582013 GGGCTGGAGCACAGGCAGCAGGG - Intronic
907621061 1:55981144-55981166 TTGTTGCAACAGAGACAGCATGG + Intergenic
907832523 1:58078548-58078570 TTGTTTGAGCAGAGGCTGCAGGG - Intronic
907843383 1:58178467-58178489 TTGCTTCAGCAGATGCAGAAGGG + Intronic
909652692 1:77993209-77993231 TAGCTGCAGCAGAGACTGTATGG - Intronic
909828290 1:80153855-80153877 CTGCTCCAGTAGAGGTAGCAGGG + Intergenic
910053809 1:83007889-83007911 ATGCAGCAGTGGAGGCAGCACGG - Intergenic
910179328 1:84463973-84463995 ATGCCTCATCAGAGGCAGCATGG + Intergenic
910514014 1:88037573-88037595 TGGCAGCAGCAGTGGCAGAAGGG - Intergenic
910963717 1:92786847-92786869 TGGCTGGAGCACAGACAGCAGGG - Intronic
912033067 1:105274335-105274357 TTCCTCCAGCGGAGGGAGCAGGG + Intergenic
912225630 1:107730854-107730876 TTGCTACAAATGAGGCAGCATGG + Intronic
912447815 1:109751068-109751090 CTGCTGTGGCAAAGGCAGCAAGG - Intronic
914350532 1:146835973-146835995 CTGCTGCAGGAGAGGGAGCTGGG - Intergenic
915049265 1:153050092-153050114 TGCCAGGAGCAGAGGCAGCATGG - Intergenic
915691390 1:157694691-157694713 TTCCTTCAGCAGAGGCACCAGGG - Intronic
916040499 1:160957108-160957130 ATCCAGCATCAGAGGCAGCAGGG - Intergenic
916456104 1:164972443-164972465 AGGCAGCAGCAGAGGCAGAAGGG - Intergenic
916651309 1:166837077-166837099 TTCCTTCAGCAGAGGCCCCATGG - Intergenic
917038578 1:170777305-170777327 TTGCTGCAGAAGAAGCAGCATGG + Intergenic
918181897 1:182091414-182091436 TTGCTGCCTCAGATGCAGAAGGG + Intergenic
918547012 1:185696517-185696539 TAGCTGCAGCAGAAGGAGGACGG - Intergenic
919860037 1:201733794-201733816 TGGCTGAAGCAGAGTTAGCAAGG + Intronic
920082872 1:203388855-203388877 TTGCTTCATCAAAGGCAGCAAGG - Intergenic
921164857 1:212499648-212499670 TGGCTGGAGCAGAGTGAGCAGGG + Intergenic
921218406 1:212955913-212955935 CTCCTGCAACAGAGGCAGCCAGG - Intronic
921329666 1:214022947-214022969 AAGCTGCAGCAGAGTCACCAGGG - Intronic
922677828 1:227563624-227563646 CTGCAGCAGCAGAGTCACCAGGG - Exonic
922794658 1:228334143-228334165 AAGCTGCAGCAGTGGCAGGACGG - Intronic
923300807 1:232638856-232638878 TTGCTGAAGAATAGGGAGCAAGG - Intergenic
923506290 1:234609196-234609218 TTGCAGCAGCAGCAGCAGCTTGG - Exonic
924331765 1:242946716-242946738 TCACTGTGGCAGAGGCAGCATGG - Intergenic
924685254 1:246282469-246282491 GTGCTGCAGCCTAGGCAACAGGG + Intronic
924880177 1:248152470-248152492 TTACAGCAGCAGGAGCAGCAAGG - Intergenic
1062884268 10:1004616-1004638 CTGCTTCAGCTCAGGCAGCAGGG + Intronic
1064322904 10:14322230-14322252 CTGAGGCAGCAGAAGCAGCATGG + Intronic
1064883266 10:20081053-20081075 TTGCTCCAGCAGAGCCATCCGGG - Intronic
1065791982 10:29268862-29268884 GTGCTGTAGCAAAGGCAGCCTGG + Intergenic
1065894535 10:30151799-30151821 CTGCTCCAGTAGAGGTAGCAGGG + Intergenic
1065965395 10:30766446-30766468 TTTCTTCAGCAGTGGCAGCCTGG + Intergenic
1067082280 10:43218491-43218513 GTGCTGCTGCAGAGGGAACAAGG - Intronic
1068437459 10:57011116-57011138 ATCCTGCAGTAGAGGCACCAGGG - Intergenic
1068629339 10:59283958-59283980 TTACTGCTGCAGAGGCTGCCTGG + Intronic
1068787215 10:60989696-60989718 GTGCTGAAGCAGAAGCAGGAAGG + Intronic
1069702288 10:70435554-70435576 TCGCAGGAGCAGAGGCAGCTGGG - Exonic
1069773556 10:70914143-70914165 TTGCTCCCCCAGAGGAAGCAGGG + Intergenic
1069840687 10:71337540-71337562 AAGCAGCAGCAGAGGCAGCTGGG - Intronic
1069904034 10:71721887-71721909 TAGCTGAAGTAGAGGCAGCTGGG - Intronic
1070657649 10:78282346-78282368 TGGCTCCAGCAGAGGCAGGGAGG + Intergenic
1071572636 10:86706431-86706453 TGGCTGCAGCAGAGGCAGGCTGG - Intronic
1071784120 10:88880261-88880283 TTCCTGCAGCAGCGGCAGCAGGG + Exonic
1071882106 10:89910894-89910916 CAGCAGCAGCAGTGGCAGCATGG + Intergenic
1072047590 10:91672226-91672248 TAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1072577019 10:96709727-96709749 TCTCTGCAGCAGGGGCAGCAAGG + Exonic
1074944892 10:118271761-118271783 CTGCCTCAGCAGAAGCAGCAGGG - Intergenic
1075455147 10:122580217-122580239 TGGATGCAGCACAGACAGCAAGG + Intronic
1075782043 10:125023417-125023439 TGCCTGCACCAGATGCAGCAGGG - Intronic
1075830654 10:125408112-125408134 CTGCAGCAGCAGTGGCCGCATGG - Intergenic
1075960064 10:126560725-126560747 TAGCAGCAACAGAGACAGCATGG - Intronic
1076168803 10:128303422-128303444 TTGCTTCCTCAGAGCCAGCAGGG - Intergenic
1076190537 10:128480159-128480181 TTGCTGCAGCACAGGGCGCACGG + Intergenic
1076493292 10:130878656-130878678 TTGCAACAGTAGAGACAGCATGG + Intergenic
1076818171 10:132924761-132924783 GTGCTGCAGCAGGGGCAGGCAGG + Exonic
1077426625 11:2482810-2482832 TTGCTGCTGCAGGTGCACCAGGG - Intronic
1078506190 11:11948696-11948718 TAACTGCAACAGAGGCAGTATGG - Intronic
1078880606 11:15445218-15445240 TTGCTGCAGAACAGGAAGAATGG + Intergenic
1078908370 11:15708305-15708327 CTGCTGCTGCAGAGGAAGTAAGG - Intergenic
1079058891 11:17230264-17230286 TAGCTCCAGCAGAGGGAGCCAGG + Intronic
1079257984 11:18849021-18849043 TGGCTGGTGCAGAAGCAGCAAGG - Intergenic
1080706572 11:34701245-34701267 TGGCTGCAGCAGAGGAGGCCTGG + Intergenic
1081468328 11:43345898-43345920 TGGCTGCAGCAGAGTGATCAAGG - Intergenic
1082120809 11:48378131-48378153 TTGCTCCAGTGGAGGTAGCAGGG + Intergenic
1082253021 11:50002511-50002533 TTGCTCCAGTGGAGGTAGCAGGG - Intergenic
1082883927 11:58064669-58064691 TTGCTGTGGCTGAGGCAGAAGGG - Intronic
1082903951 11:58285699-58285721 TTGCTTCAGTGGAGGTAGCAAGG - Intergenic
1083137063 11:60688919-60688941 TTGCTGTAGCATGGGGAGCAAGG + Intergenic
1083829137 11:65219923-65219945 TGGCAGCAGCAGAGGCAGTGAGG + Intergenic
1083853900 11:65382727-65382749 TGGCTGCAGCAGAGAAAGCAAGG - Intronic
1084198366 11:67539286-67539308 TCACTGCAGCAGAGACAGCCAGG + Intergenic
1084589307 11:70080871-70080893 TTGGTGCAGGGCAGGCAGCATGG + Intronic
1084792233 11:71482184-71482206 GTCCTGCAGCTAAGGCAGCAAGG + Intronic
1085034488 11:73291940-73291962 TTGGAGCAGCTGAGGCAGCAAGG - Intronic
1085440231 11:76555001-76555023 TGGCTGCAGCATGAGCAGCAAGG + Intergenic
1085506701 11:77064939-77064961 ATGCTGCAGCACAGGGAGGAAGG + Intergenic
1086157436 11:83682997-83683019 TTCATGCTCCAGAGGCAGCATGG - Intronic
1086244687 11:84738358-84738380 TTGGTGCCAGAGAGGCAGCAAGG + Intronic
1086282098 11:85201365-85201387 AGGCTCCAGCACAGGCAGCATGG - Intronic
1086478538 11:87207774-87207796 GTGCTCCAGCAGAGGCAGTGGGG - Intronic
1087946281 11:104164201-104164223 CAGCTGCAGCACAGGCTGCAGGG + Intronic
1089019868 11:115202202-115202224 ATACTGCAGGAGAGGCAGCTGGG + Intronic
1089977743 11:122747051-122747073 TGGCTGAAGCAGAGGCTGCGGGG + Intronic
1090137330 11:124210861-124210883 TTGTGGCAGGAGAGGCTGCAGGG - Intergenic
1090178781 11:124674751-124674773 ATGCTTCAGAAGTGGCAGCAAGG + Exonic
1090771002 11:129919871-129919893 TTGCAGCAGAAGAGGCAGGTGGG - Intronic
1091105336 11:132913898-132913920 GAGCTGCAGCAGAGGCAGAGAGG - Intronic
1091206789 11:133827036-133827058 TGGCTGCAGCAGAGGGAGCAAGG - Intergenic
1091376478 12:27676-27698 TTGCTGCTGTAGTGGCACCAGGG - Intergenic
1091526996 12:1312843-1312865 TGGCTGCAGGAGAGACAGAAGGG - Intronic
1092007555 12:5082321-5082343 TTGCTCCAGCGGAGGGAGCATGG + Intergenic
1092197085 12:6555977-6555999 CTCCTGCAGCAGGAGCAGCAGGG - Exonic
1092387182 12:8044776-8044798 ATGGTGGAGCAGTGGCAGCAGGG + Exonic
1092535919 12:9386958-9386980 TTTCTGCAGAAAAGGCAGCTGGG + Intergenic
1092836456 12:12493610-12493632 TGGCTGGAGCAGAGTGAGCATGG - Intronic
1094480521 12:30877690-30877712 TGGCTGGAGCAGACCCAGCAAGG - Intergenic
1095683959 12:45010990-45011012 TGGATGCATCAGAGGGAGCATGG + Intergenic
1096979794 12:55721815-55721837 TTGCTGCAGCAGAGGCAGCAGGG - Exonic
1097043673 12:56171691-56171713 TTGCAGCAGCAGAGGCGACTCGG + Exonic
1097626434 12:62007107-62007129 TGGCTGGAGCAGAAGGAGCATGG - Intronic
1098194097 12:67981377-67981399 CTGCTGCTGCAGAGGCGACATGG - Intergenic
1098430560 12:70415071-70415093 TTTCTGGTACAGAGGCAGCATGG - Intronic
1098660558 12:73087892-73087914 TTGCTCCAGCAGTGGCTGAAAGG - Intergenic
1098742911 12:74197824-74197846 TTGCTAGAGCATAGTCAGCAAGG - Intergenic
1098936947 12:76490882-76490904 ATGCTGCAGCAGAGCCTGCACGG + Intronic
1099287921 12:80738451-80738473 TTGCTGCATCAGAGTCACCTGGG - Intergenic
1099697868 12:86044356-86044378 TGCCAGCAGCAGTGGCAGCATGG + Intronic
1100390403 12:94141806-94141828 TTACAGCAGCAGAGGCTGGAAGG + Intergenic
1100955868 12:99907319-99907341 TTGCTACAGCACAGGCGGCATGG - Intronic
1101168560 12:102063905-102063927 TAGCTGAAGCAGAGTGAGCAAGG + Intergenic
1101211464 12:102539117-102539139 TTTCAGCAGCAGCAGCAGCAGGG + Intergenic
1101520740 12:105479762-105479784 TTGTTGTAACAGAGGGAGCAGGG + Intergenic
1101544955 12:105703851-105703873 GTGCTGCAGCAGAGAAGGCAGGG + Intergenic
1102119327 12:110428761-110428783 ATGCTGCAGCAGAGTGAGCAAGG - Intergenic
1102600408 12:114025453-114025475 TTGCTTCATCAAAGACAGCAAGG - Intergenic
1102764678 12:115422479-115422501 TGGCTGGAGCAGAGAAAGCAGGG - Intergenic
1103046964 12:117744152-117744174 TTCAAGCAGCAGAGGCAGGATGG - Intronic
1103922685 12:124407302-124407324 ATGATGCAGATGAGGCAGCAAGG + Intronic
1104846841 12:131851204-131851226 TGGCGGCAGCAGCAGCAGCATGG - Exonic
1105705678 13:22966221-22966243 GTGCTGCAGCAGAGGGAGTGGGG + Intergenic
1105858581 13:24391206-24391228 GTGCTGCAGCAGAGGGAGTGGGG + Intergenic
1107798454 13:44079690-44079712 TGGCTGAAGCAGAGCGAGCAAGG + Intergenic
1107799200 13:44088298-44088320 TGGCTGAAGCAGAGCGAGCAAGG - Intergenic
1109222584 13:59655404-59655426 TTGCTGCCCCTGAGACAGCAAGG + Intergenic
1110666363 13:78122163-78122185 CTGCCGCAGCAGAGGCAGATGGG - Intergenic
1111064473 13:83072633-83072655 TGGCTGCAGCTGAGACAGCTGGG - Intergenic
1112314090 13:98345776-98345798 TAGTTGCAGCAGAGACTGCATGG - Intronic
1112337057 13:98524497-98524519 TGGGTTCAGCAGAGGCAGCGAGG - Intronic
1113281742 13:108796059-108796081 TGGCTGAAGCAGTGTCAGCAGGG + Intronic
1113447339 13:110379540-110379562 TGGCTGCAGCAGAAGCTGCAAGG + Intronic
1113657537 13:112077868-112077890 TCGCTGCGGCAGGGGCTGCAGGG - Intergenic
1115787980 14:36847719-36847741 TGGCTGCAGCAGAGGGTGCCTGG + Intronic
1115942750 14:38627561-38627583 TTGCTGCAGCAGTAGCAGGTTGG - Intergenic
1116343990 14:43765713-43765735 TCACTGTAGCAGAGGAAGCAGGG - Intergenic
1116782489 14:49251297-49251319 TTCCAGCAGCAGCGGCAGCATGG - Intergenic
1117124809 14:52611090-52611112 TTGATGGAGCAGAGGAAACAAGG - Intronic
1117600714 14:57371754-57371776 GTGCTACAGTAGAGGCAGAATGG - Intergenic
1117907322 14:60604108-60604130 TGCCTGTAGCAAAGGCAGCAAGG - Intergenic
1118031406 14:61821634-61821656 TTGCTTCATCAAAGCCAGCAAGG + Intergenic
1118140149 14:63071993-63072015 CTGCTCCAGTGGAGGCAGCAAGG + Intronic
1118315692 14:64724693-64724715 TTGCTTCAGCATAAGCTGCAGGG - Intronic
1118806441 14:69241234-69241256 TTGCTCCAGCAGAAGCATCCTGG - Exonic
1119270677 14:73301639-73301661 GTGCTCCAGCCTAGGCAGCAGGG - Intronic
1119325621 14:73758478-73758500 TTGCTCCAGCAGGGGGAGCCTGG - Intronic
1119618567 14:76114493-76114515 CAGCAGCAGCAGAAGCAGCATGG + Intergenic
1121156100 14:91685818-91685840 TGGCTGCAGTAGGGGCAGGATGG + Intronic
1121275120 14:92662219-92662241 CTGCTGCTGCAGAGACAGCCAGG - Intronic
1121470094 14:94146132-94146154 TGGCTGCAGCAGTTGCAGAATGG - Intronic
1122114033 14:99518773-99518795 TTTCTGCAGCACAGGCAGGAGGG + Intronic
1122492852 14:102131510-102131532 TGGCTGGAGCAGAGTGAGCAGGG - Intronic
1122820534 14:104342603-104342625 TTGCTGCTGCAGAGGCTGAGGGG + Intergenic
1125207242 15:37167601-37167623 TTGCTGCAGGAGAGGGAAGATGG - Intergenic
1125975494 15:43947771-43947793 TTGCTGAAGCAGAGGCAGCTGGG + Intronic
1126584001 15:50265542-50265564 TTCCTGCAGGAGTAGCAGCAGGG + Intronic
1126942110 15:53778742-53778764 TTGCTGGAGCTGAAGCAGCTGGG + Intergenic
1127146718 15:56032573-56032595 CTGCTGCTGCAGGGGCACCAGGG - Intergenic
1127418896 15:58785447-58785469 TTTGTGCAGCAGAGACAGTATGG - Intronic
1127745817 15:61971084-61971106 TGGCTGAAGCAGAGTGAGCAAGG + Intronic
1127784872 15:62346866-62346888 TTGTTGCAACAGAGACTGCATGG - Intergenic
1127902497 15:63351343-63351365 TTACTGCAGGAGAGCCAGCCTGG - Intronic
1128531229 15:68449551-68449573 GGGCTGCAGTAGAGCCAGCATGG - Intergenic
1128830435 15:70763481-70763503 CGGCTGCAGCAGAGGCGGCGCGG + Exonic
1128850885 15:70954849-70954871 GTGCTCCAGCAGGGGCAGCAGGG + Intronic
1128871258 15:71156951-71156973 ATGATGCAGCAGAGTAAGCAGGG - Intronic
1129238134 15:74236083-74236105 TTGCTGCAGCTTGAGCAGCATGG + Intergenic
1129330742 15:74826057-74826079 TAGCTGCTCCAGGGGCAGCAGGG + Intergenic
1129919913 15:79311278-79311300 GAGCAGCAGCAGAAGCAGCACGG - Exonic
1130551069 15:84890236-84890258 GTGCTGCCACAGAGGCAGGAAGG + Intronic
1131203964 15:90425862-90425884 TTGCTGCAGCAGAGGAAAGTGGG + Intronic
1131441542 15:92463436-92463458 GTCCTGCAGCAGGGACAGCAAGG + Intronic
1131674077 15:94653446-94653468 ATACTGCAGCAGAAGGAGCATGG - Intergenic
1131795731 15:96014573-96014595 TTTCTGCAGCAGAGACTGGAGGG - Intergenic
1132032858 15:98452524-98452546 CTGCTGCAGCAGAGCCAGAGAGG + Intronic
1132205257 15:99982112-99982134 TTCCTGCAGTAGAGGCAGTGTGG + Intronic
1132223007 15:100118823-100118845 GTGAGGCAGCAGATGCAGCATGG + Intronic
1132744316 16:1430395-1430417 TGGCTGCAGCTGAGGAAGGAAGG + Intergenic
1132747327 16:1442488-1442510 TTGCTGCAGCAGGAGGAGCAGGG - Exonic
1133295054 16:4747597-4747619 TTGCTCCAGAGGAGGCATCAGGG - Exonic
1133759282 16:8785505-8785527 TGGATGCAGCAGAGGCACAAAGG + Intronic
1134430952 16:14205915-14205937 TTCCTGCAGCAGAGGCAGTCTGG - Intronic
1135535259 16:23288966-23288988 TTGCTTCATCAAAGGCAGCAAGG + Intronic
1136080411 16:27848882-27848904 ATGCTGTAGCAGAGTGAGCAAGG + Intronic
1136192228 16:28623322-28623344 GTGCTGCAGCAACGGCTGCAGGG - Exonic
1136368351 16:29820335-29820357 CAGCTGCAGCAGAAGCAGCCCGG + Exonic
1136614257 16:31386993-31387015 TTGAAGCAGCAGTGGCAGCAAGG - Intergenic
1138413813 16:56859774-56859796 TGGCTGGAGCAGAGGGACCAAGG - Intergenic
1139099189 16:63744640-63744662 TAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139528824 16:67531651-67531673 TTGCTGGAACAGAGAAAGCAGGG + Intronic
1139877285 16:70156502-70156524 CTCCTGCAGCAGAAGCAGAATGG + Exonic
1139983506 16:70879566-70879588 CTGCTGCAGGAGAGGGAGCTGGG + Intronic
1140093547 16:71856159-71856181 TTCCTGCTGGGGAGGCAGCAGGG - Exonic
1140130618 16:72157537-72157559 TGGCTGGAGCAGAGACAGTAAGG + Intronic
1140488856 16:75317338-75317360 TTGCTAGAGCAGAGGCGGGAAGG - Intronic
1140958656 16:79891643-79891665 TTGCCCCAGTAGAGGCAGAAGGG + Intergenic
1141339270 16:83188028-83188050 TGGCTGAAGCAGAGGGAGCAAGG + Intronic
1141575021 16:84958290-84958312 TTGCTGTAGTTGAGGCAGAAAGG + Intergenic
1141646742 16:85371613-85371635 TGCCAGCAGCAGAGGCAGCTGGG - Intergenic
1141658612 16:85429641-85429663 GGGCTGGAGCAGAGCCAGCAAGG - Intergenic
1141718186 16:85739103-85739125 TGGCGGCAGGAGAGCCAGCATGG - Intronic
1142129070 16:88424562-88424584 AAGCTGCAGCTGAGGCAGCCAGG + Intergenic
1142540551 17:655401-655423 CTGCTGAGGCAGAAGCAGCAGGG + Intronic
1142789525 17:2253073-2253095 TAGCTGCAGCAGAGGGCACATGG + Intronic
1142947812 17:3448394-3448416 TAGCTGCAACAGAGACAGTACGG + Intronic
1143097723 17:4487383-4487405 TGGCTGCAGCAGAAGCAAGAGGG + Intronic
1143256007 17:5558557-5558579 TGGCTGCAGCAGCAGCTGCAGGG + Exonic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1144360503 17:14487309-14487331 TGGCTGGGGCAGAAGCAGCAGGG + Intergenic
1144782811 17:17816400-17816422 TGGGTGGAGCACAGGCAGCAGGG + Intronic
1144788591 17:17845294-17845316 TGGCTGCCCCAGGGGCAGCAGGG - Intronic
1144791558 17:17862425-17862447 TGTCTGCAGCAGCAGCAGCATGG + Intronic
1144843342 17:18202404-18202426 CTACTGCAGGAGAGCCAGCAAGG + Intronic
1145015272 17:19392422-19392444 TTGCTGCAGCAGCGGCCTCTGGG - Intergenic
1145884013 17:28370377-28370399 TTGCTGCAGCAGCCGCTGGAGGG - Exonic
1146695237 17:34903887-34903909 GTGCTGCAGGAGAGGCAGCGAGG + Intergenic
1147132121 17:38415680-38415702 CTGGTGCAGCTGAGGCTGCAGGG - Intergenic
1147537326 17:41329079-41329101 TGGCTGCAGCAGTGGCTGCAAGG - Intergenic
1147669902 17:42170962-42170984 TGGCTGCAGCGCAGGGAGCACGG + Intronic
1149441231 17:56675899-56675921 TTGCTGCAAAAAAGGCATCAAGG + Intergenic
1149851398 17:60037658-60037680 TCACTGCAGCAGTGGCAGCCAGG - Intergenic
1150867435 17:68868222-68868244 TGGGAGCTGCAGAGGCAGCACGG - Intronic
1152016942 17:77756989-77757011 TTTCTGAGTCAGAGGCAGCAAGG - Intergenic
1152386200 17:79976275-79976297 TTGCTGCAAGAGAGACAGCCTGG - Intronic
1152429446 17:80239987-80240009 TAGCTGCAGCAGTGACTGCAGGG + Intronic
1152635767 17:81429933-81429955 GGGGTGCAGCAGAGGCAGCCCGG + Intronic
1152937036 17:83145186-83145208 GTGCTGGAGCAGAGGCTGCAGGG - Intergenic
1153677326 18:7467417-7467439 ATGCAGCAGCATAGGCAGCTGGG + Intergenic
1154019198 18:10647829-10647851 TTGCTGCAGCAGTGACAGGGTGG - Intergenic
1154185018 18:12175395-12175417 TTGCTGCAGCAGTGACAGGGTGG + Intergenic
1154344063 18:13527859-13527881 GTGCTGCAGGAGTGGCAGCCCGG - Intronic
1154346739 18:13548817-13548839 TGGCTGCAGCAGGGGAGGCATGG - Intronic
1154357665 18:13633923-13633945 TGGCTGCAGCAGGGGAGGCATGG - Intronic
1155470080 18:26182621-26182643 TTTCTGCAGCACATGCATCAAGG + Intronic
1158570930 18:58596483-58596505 CTGCTGCAGCAGCCGCCGCAGGG + Intronic
1159774408 18:72586172-72586194 TGGCTGCAGCAGGGGAGGCATGG - Intronic
1159864276 18:73686441-73686463 TTGCTGGAGGAGAGGCTGGAAGG - Intergenic
1161082672 19:2319299-2319321 TTTCTCCCGCAGAGGAAGCAAGG - Intronic
1161221619 19:3120546-3120568 TGGCTGCAGCAGGGGCACCGTGG + Intronic
1161490505 19:4558401-4558423 TAGCAGCAGCAGAAGCAGCAGGG + Exonic
1161599168 19:5170422-5170444 TGGCTGCAGCAGAGTGAGCCAGG + Intronic
1161620913 19:5296680-5296702 TTGCTGGAGCAGAGTGAGGAAGG + Intronic
1161644512 19:5444743-5444765 TGGCTGCAGCAGAGGGAGCAAGG - Intergenic
1161649887 19:5477958-5477980 TGGCTGCAGCAGAGTGAGGAGGG - Intergenic
1161756423 19:6137447-6137469 TGGCTGCAGCAGAGTGAGGAGGG + Intronic
1161958636 19:7510098-7510120 TTTCTGCAGGAAAGGCAGGAGGG + Intronic
1162589807 19:11584115-11584137 TGGCTGGAGCAGAGTGAGCAAGG + Intronic
1162844470 19:13381799-13381821 TGGCTGAAGCAGAGCGAGCAAGG + Intronic
1162926583 19:13933273-13933295 TTGCTGCAGCACAACCAGCTGGG - Exonic
1164113545 19:22194278-22194300 TTTCTGCAGCAGGGGCATTAGGG - Intronic
1165059133 19:33196197-33196219 CAGCAGCAGCAGAGGCAGGAGGG - Intronic
1165328027 19:35125466-35125488 TTGCTGCAGCAGACGAAACATGG + Exonic
1166748339 19:45152509-45152531 CTGCAGCAGCAGCAGCAGCAGGG - Exonic
1166891550 19:45997066-45997088 TGGCTGCAGCAGAGTGAGCCAGG - Intronic
1167250060 19:48394777-48394799 TGGCGGCAGCAGCGGCAGCCCGG - Intergenic
1167384986 19:49157848-49157870 TTGCGGCGGCCGCGGCAGCATGG + Exonic
1167533164 19:50031618-50031640 GTGCTACAGTGGAGGCAGCAGGG - Intronic
1167553614 19:50178392-50178414 TGGCTGCAGCAGAGACCACATGG - Intergenic
1167880816 19:52455962-52455984 TAGCTACAGCAGAGGGAGCAAGG - Intronic
1167932194 19:52874932-52874954 TGGCTGGAGCAGAGGGAGCGAGG + Intronic
1167963187 19:53123600-53123622 TGGCTGGAGCAGAGGGAGCGAGG + Intronic
1167970098 19:53183843-53183865 TGGCTGGAGCAGAGGGAGCAAGG + Intronic
1168468975 19:56625645-56625667 TGGCTGAAGCAGAGTGAGCAGGG - Exonic
1202713673 1_KI270714v1_random:30684-30706 TGCCGGCAGCAGGGGCAGCATGG - Intergenic
925204113 2:1992013-1992035 TTGATGTGACAGAGGCAGCAAGG - Intronic
925796851 2:7554868-7554890 CAGCTGAAGCACAGGCAGCATGG + Intergenic
926343173 2:11921702-11921724 TTCCTGCAGGAGTGTCAGCATGG - Intergenic
927176716 2:20415080-20415102 CTGCTCCAGTGGAGGCAGCAGGG + Intergenic
927205650 2:20608723-20608745 TTGGGGCAGCAGAGTGAGCAAGG - Intronic
927553723 2:24018550-24018572 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
928497886 2:31852917-31852939 TTGCTTCATCAAAGCCAGCAAGG + Intergenic
928673661 2:33628524-33628546 TTGTTGTAGCAGAGGGAGAATGG - Intergenic
929261732 2:39873439-39873461 GAGCAGCAGCAGCGGCAGCAAGG - Intergenic
930023671 2:47016680-47016702 TTGCTGCAGAAGCAGCAGCCTGG + Intronic
930092583 2:47541987-47542009 CAGCAGCAGCAGCGGCAGCAGGG + Intronic
931743072 2:65266426-65266448 TGGCTGGAGCAGAGTGAGCAAGG + Intronic
932757166 2:74416969-74416991 ATGCTGCAGCAGAGAGAGCAAGG - Intronic
932766684 2:74474959-74474981 CTGCTGCAACAGACACAGCAGGG + Exonic
933336321 2:80964195-80964217 TAGCAGCAGCAGCAGCAGCATGG + Intergenic
933374760 2:81465334-81465356 TCGTTTAAGCAGAGGCAGCATGG - Intergenic
933787257 2:85853333-85853355 TTACTGCAGCAGAGGAAGTGTGG - Intronic
934087316 2:88520678-88520700 CTGCTGCAGCAGAGCCAGGAGGG - Intergenic
936819105 2:116497289-116497311 CTGCTGCAGCAAAGGCAGTTAGG - Intergenic
937414726 2:121705292-121705314 TTGGTGCAGGAGAGGTAGCCTGG + Intergenic
937699384 2:124846958-124846980 CTGCTGCAGTGGAGGTAGCAGGG + Intronic
937972780 2:127563585-127563607 TTGCTGCAGCAGTAGGAGCAAGG - Intronic
938990441 2:136622924-136622946 TTCCAGCAGCTGTGGCAGCATGG + Intergenic
939089110 2:137757901-137757923 TGCCAGCAGCAGTGGCAGCATGG - Intergenic
939097704 2:137853620-137853642 ATGCTGCAGCCAAGGGAGCAAGG + Intergenic
940389669 2:153117582-153117604 TTGGTGCAGTTGAGGTAGCATGG + Intergenic
940423682 2:153508056-153508078 CTGCTCCAGTGGAGGCAGCAGGG + Intergenic
941639278 2:167969961-167969983 TGGCTGGAGCAGGAGCAGCAAGG - Intronic
943151180 2:184115615-184115637 TAGCTTGAGCAGAGGCAACAAGG + Intergenic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
944641221 2:201727869-201727891 GTTCTGCAGCAGAGACTGCAAGG - Intronic
944655538 2:201873520-201873542 CAGCTGCAGCAGCAGCAGCATGG - Intronic
945630198 2:212265047-212265069 ATGCTGCAGGAGAGGCACAAGGG + Intronic
945916284 2:215707903-215707925 ATGTTGCAGCAGAGACAGCCGGG - Intergenic
946117417 2:217475467-217475489 TTGCTCCAGCACATGCAGAAAGG + Intronic
946157131 2:217814368-217814390 TAGTTGTAGCAGAGGCTGCATGG - Intronic
946385348 2:219381155-219381177 GCACTGCAGCAGAGCCAGCATGG + Intronic
947364315 2:229378483-229378505 TGGCTACTGCAGAGGCAGCAAGG + Intronic
1168902788 20:1379361-1379383 CTGCTGCTGCTGAGCCAGCATGG + Intronic
1169000330 20:2163622-2163644 TGGCTGCAGCAGAGGAAGCAAGG + Intronic
1169402392 20:5294173-5294195 ATCCTGCAGCAGAGCCAGCAAGG - Intergenic
1170801638 20:19595287-19595309 TTGGTGCTGCAGATGCAGTAAGG - Intronic
1171210169 20:23310613-23310635 TGGGGGCAGCAGAGGCAGCCAGG - Intergenic
1171343793 20:24450768-24450790 TTGCTTCAGCAGAAGCTACATGG - Intergenic
1171952471 20:31433411-31433433 TTGCTTCATCAAAGTCAGCAAGG - Intergenic
1173082912 20:39886867-39886889 GTTTTGAAGCAGAGGCAGCAGGG - Intergenic
1174033174 20:47647337-47647359 CAGCTTCAGCAGAGGCTGCAGGG + Exonic
1174387839 20:50197807-50197829 TGGCTGGAGCAGAGGCAGCAAGG + Intergenic
1174531999 20:51221722-51221744 TGGCGGGAGCAGAGGGAGCAAGG + Intergenic
1175596786 20:60241030-60241052 GTGCTGCTGCAGAGGCATCTCGG + Intergenic
1175824945 20:61931713-61931735 TTCCTGCAGCAGAGGCAGCCAGG + Intronic
1176443405 21:6798739-6798761 TGGCGGGAGCAGAGGCGGCAGGG - Intergenic
1176821573 21:13663786-13663808 TGGCGGGAGCAGAGGCGGCAGGG - Intergenic
1177740319 21:25146351-25146373 TTGCTACAGCCAAGGCTGCAAGG - Intergenic
1177770422 21:25508525-25508547 TGGCTACTGCAGAGTCAGCAAGG - Intergenic
1178431978 21:32525383-32525405 TGGCTGAAGCAGAGCCAGGAGGG + Intergenic
1178641248 21:34346023-34346045 TTGCTGCAGCTGGGGCCGGAGGG - Intergenic
1179496201 21:41772684-41772706 TGGCTGCAGCAGAGACAGTGGGG - Intergenic
1179613439 21:42566711-42566733 TTTCTGCTGCAGATGAAGCAGGG + Intronic
1180150667 21:45945598-45945620 TTGCTTCACCAGTGCCAGCAGGG - Intergenic
1180180691 21:46117526-46117548 TTGCTGCTGCAGTGGGAGCGTGG + Intronic
1180183497 21:46128378-46128400 TGGCTCCAGGAGATGCAGCAGGG + Intronic
1180218415 21:46341714-46341736 TTACTGCAGCATGGGCAACAGGG - Intronic
1180220127 21:46353265-46353287 CTGTTACAGCAGAGGCTGCAGGG + Exonic
1180914945 22:19479464-19479486 TGGCTGAAGCAGAGGCAGTCTGG - Intronic
1180942481 22:19668359-19668381 TTCCTGCACCAAAGCCAGCAAGG + Intergenic
1181278873 22:21704266-21704288 CTGCTGCAGAAGAGGCGGCGAGG - Intronic
1181630508 22:24148741-24148763 CTGTTCCAGCAGAGGCAGGAAGG + Intronic
1181971631 22:26695052-26695074 TTGCTTCATCAAAGCCAGCAAGG + Intergenic
1182697340 22:32206062-32206084 TGGCTGCAGCAGGGGCAGGTTGG + Intergenic
1183149258 22:36025186-36025208 TAGCTGGAGCAGAGAGAGCAAGG - Intronic
1183256108 22:36763432-36763454 TAGCTGCAGCTGATGCAGCTGGG - Intronic
1183569028 22:38638235-38638257 TTGCTGCAGGGGAGGCAGTGGGG + Intronic
1183704967 22:39470576-39470598 TGGCTGCTGCAGAGGCAGGAGGG + Intronic
1183737808 22:39653574-39653596 CTCCTGCAGGGGAGGCAGCATGG + Intronic
1183816016 22:40301186-40301208 CAGCAGCAGCAGAGGCAGCCAGG + Exonic
1184024717 22:41846652-41846674 CTGCTGAAGTAGAGACAGCACGG - Intronic
1184102330 22:42347407-42347429 CTGCTCCAGCAGATGCAGCCTGG + Intergenic
1184380580 22:44142855-44142877 CTGCGTCAGCAGAAGCAGCAAGG - Intronic
1185173323 22:49305694-49305716 TTCCTCCATCAGAGGCAGCCAGG - Intergenic
949875340 3:8623026-8623048 TGGCTGCAGCAGCAGCAGAAGGG + Intronic
950115660 3:10448994-10449016 TTTCTGAGGCAGAGGCAGAAGGG - Intronic
950426680 3:12928143-12928165 ATGCTGCAGCAGAGGTGGGAGGG + Intronic
950954651 3:17039224-17039246 AGGATGCAGCAGAGGCAACATGG - Intronic
950972313 3:17201590-17201612 GTGTTACAGCAGAGGCAGGATGG + Intronic
951153714 3:19323889-19323911 TTGCTCCAGTGGAGGTAGCAGGG + Intronic
952122769 3:30264363-30264385 CTGCTCCAGTAGAGGCAGCAGGG - Intergenic
952190105 3:31014134-31014156 TGGCTGCAGCTGGAGCAGCAGGG - Intergenic
952884690 3:38005284-38005306 TGGCTGCAGCAGAAGCAGTGAGG - Intronic
953545086 3:43858371-43858393 TTGGGGCTGCGGAGGCAGCAGGG - Intergenic
953605628 3:44411441-44411463 TGGCTGGAGCAGAGGGAGAATGG - Intergenic
953929141 3:46997290-46997312 TCGCTCCAGCAGGGGCAGCAGGG - Exonic
954115575 3:48465348-48465370 TTGCAGTAGCTGAGGGAGCAGGG + Intronic
954291655 3:49653142-49653164 GAGCTGCTCCAGAGGCAGCAAGG + Exonic
954365582 3:50144445-50144467 TGGCCGAGGCAGAGGCAGCAGGG - Intergenic
955018566 3:55096310-55096332 TGGCTGCAGCAGAGTGAGCAAGG - Intergenic
955864276 3:63365971-63365993 TTGCTGCAGCAAAGGAAAGAAGG - Intronic
956180718 3:66515681-66515703 TTGCTGTCTCAGGGGCAGCAGGG + Intergenic
956193387 3:66628718-66628740 TAGTTGCAGCAGAGGCCTCATGG + Intergenic
956193467 3:66629571-66629593 TTGCTGCAGCAGCAGCAGCGGGG + Intergenic
957012041 3:75017901-75017923 TTGCAGAATCAGAGGTAGCATGG + Intergenic
957190242 3:76998923-76998945 TTACTGAAGCAGACCCAGCAAGG + Intronic
958255649 3:91321753-91321775 TGGCTGAGGCAGAGCCAGCAGGG - Intergenic
958444815 3:94202655-94202677 TTGCTCCGGTAGAGGTAGCAGGG + Intergenic
958528366 3:95291813-95291835 TGGCTGCAGCTGAAGCAGCTAGG - Intergenic
958803571 3:98783223-98783245 TAGCTGCAGCAGAGGCTGGCTGG - Intronic
959125853 3:102290059-102290081 TTGCTCCAGTGGAGGTAGCAGGG + Intronic
959815309 3:110667182-110667204 CTGCTCCAGCGGAGGTAGCAGGG - Intergenic
960199603 3:114814844-114814866 TTGCTCAAGCAGATGCAGCTTGG - Intronic
960688146 3:120314234-120314256 CTGCAGCAGCAGCAGCAGCATGG - Intergenic
960929448 3:122830281-122830303 TTTCTGCAACAAAGGCAGCTGGG - Intronic
961061325 3:123831642-123831664 GAACTGCAGCAGAGGCAGCCGGG + Exonic
961311970 3:126008017-126008039 TTGCAGCAGCAGACCCTGCAGGG + Intronic
962173974 3:133133152-133133174 TTGATGCAGCAGCAGCAGCAGGG + Intronic
962210287 3:133471898-133471920 TTTCAGCAGCAGAGGGAGAAGGG + Intronic
962592722 3:136907134-136907156 CTGCTGCAGCAGCAGGAGCAAGG - Intronic
962826230 3:139102728-139102750 TTGCCTGAGCAGAGGGAGCAAGG + Intronic
963306033 3:143654019-143654041 TTGGTGCTTGAGAGGCAGCAAGG + Intronic
963925174 3:150943824-150943846 TTGCTGCTGCAGGGCCTGCATGG + Intronic
964249143 3:154690460-154690482 TTGCTGGAGCTGAGCAAGCAAGG + Intergenic
964419696 3:156488516-156488538 TGGCTGCAGCAGAGTAAGGAAGG + Intronic
964682829 3:159361419-159361441 TGGCTGAAGCAGAGAGAGCAAGG + Intronic
965384494 3:168029891-168029913 TTGCACCAGCAGAGGCTGCAGGG - Exonic
965468651 3:169063320-169063342 GTGGTGCTGCAGAGGAAGCATGG - Intergenic
965624092 3:170669854-170669876 TTGCAGATCCAGAGGCAGCATGG - Intronic
966118282 3:176491224-176491246 ATGATGCAGCAGAGGCTGCTAGG - Intergenic
966605853 3:181820929-181820951 TGGCTGGAGCAGAGTGAGCAGGG - Intergenic
966658218 3:182383724-182383746 GTGCTGAGGCAGAGGAAGCAGGG - Intergenic
967331625 3:188295987-188296009 TCCCTACACCAGAGGCAGCAAGG + Intronic
967826759 3:193883270-193883292 TTCCTGCGGCAGAAGAAGCAAGG + Intergenic
968445156 4:648753-648775 TTGCTGCAGCTCAGACAGCTGGG - Intronic
968546361 4:1200936-1200958 CTGCTGCAACAGAGCCAGGAGGG - Intronic
970200564 4:13600366-13600388 TTGCTGCAGCAGTGGAAGAAAGG - Exonic
971458016 4:26861653-26861675 GTGCTGCAGAAGTGCCAGCAGGG + Intronic
971576186 4:28278603-28278625 TTGCTGCAAAAGAGCCAGCCAGG - Intergenic
971856749 4:32054053-32054075 TTGCTGCTCCAGAGGGTGCAAGG - Intergenic
972418306 4:38863973-38863995 TGGCTGGAGCAGAGGGAGGATGG - Intergenic
973027043 4:45284935-45284957 TGGCGGCAGCAGAGGAGGCATGG - Intergenic
973155406 4:46945385-46945407 TTGCTCCAGGAGAGGCAGGTTGG - Intronic
973291749 4:48477795-48477817 TTGGTGAAGAGGAGGCAGCATGG - Intergenic
973643991 4:52931950-52931972 CAGCTGCAGCAGAGGCCCCAGGG + Intronic
973675994 4:53263635-53263657 CTGCTCCAGTGGAGGCAGCAGGG + Intronic
974310347 4:60199686-60199708 TTGCTTCTTCAGAGCCAGCAAGG - Intergenic
975329850 4:73100310-73100332 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
976015096 4:80542900-80542922 GTGCTCCAGCAGGGGCAGCAGGG - Intronic
976122922 4:81802592-81802614 TTGCAGCTGCAGTAGCAGCAGGG + Intronic
977541131 4:98319910-98319932 TTGCCGCCTCAGAGGTAGCAGGG - Intronic
977855553 4:101886318-101886340 TGGCTGAAGCAGAAACAGCAAGG + Intronic
978477626 4:109148782-109148804 TGGCTGGAGGAGGGGCAGCAGGG - Intronic
978478768 4:109163564-109163586 TTCCTGCTGCACAGGCTGCATGG + Intronic
978593928 4:110356368-110356390 ATGCTGCTGCAGATCCAGCATGG + Intergenic
979149455 4:117291378-117291400 TTGCTTCACCAAAGCCAGCAAGG - Intergenic
980070726 4:128240798-128240820 TGGCTGCAGCATAGGCTGCGTGG + Intergenic
980282146 4:130736451-130736473 CTGCAGCAGCAGGGGAAGCATGG + Intergenic
980392031 4:132159268-132159290 CTGCTCCAGTAGAGGTAGCAGGG + Intergenic
981796484 4:148600890-148600912 CTGCTCCAGCAGAGGCAGTAGGG + Intergenic
982113784 4:152080033-152080055 CTGCAGCAGCACAGTCAGCATGG - Intergenic
982348407 4:154386652-154386674 TGGCTGCTGGAGATGCAGCAGGG - Intronic
982584817 4:157222618-157222640 GGGCTCCAGCAGAGGCAGCCGGG + Intronic
983381186 4:166996358-166996380 CTGCAGCTGCACAGGCAGCAAGG + Intronic
983766442 4:171490011-171490033 TTGCAGGAGCACAGGCAGAAAGG + Intergenic
984705044 4:182841460-182841482 TTGCTCCTCCAGAGGGAGCAGGG + Intergenic
985393713 4:189518372-189518394 CTGATGCAGCAGATGTAGCATGG + Intergenic
985719475 5:1481743-1481765 TTTCCGCAGCGGAGGCAGGAAGG + Intronic
986469357 5:8058900-8058922 GAGGGGCAGCAGAGGCAGCACGG + Intergenic
987939849 5:24519902-24519924 TTCCAGTAGCAGAAGCAGCAAGG - Intronic
990157556 5:52896199-52896221 TTCCTGCTGCAGTGGCATCATGG - Intronic
993972847 5:94441369-94441391 TTTCTGAAGCACAGGCAGTAGGG + Intronic
995442324 5:112205779-112205801 CACCTGCAGGAGAGGCAGCAAGG + Intronic
996190408 5:120533673-120533695 TGGCTGGAACAGAGGGAGCAAGG + Intronic
996931749 5:128897009-128897031 ATCCTCCAGCAGCGGCAGCATGG - Intronic
997583462 5:135031209-135031231 GGGCTGCAGCAGAGGCGGCCCGG + Intronic
997602133 5:135147889-135147911 TTGCTTCATCAAAGCCAGCAAGG - Intronic
998043758 5:138970135-138970157 TTGCAGAAGCAGAGGCAGAGAGG + Intronic
998141531 5:139702277-139702299 TGGCTGGAGCAGAAGGAGCAGGG - Intergenic
999141034 5:149362060-149362082 TAGCTGCAACAGAGACTGCATGG - Intronic
999205230 5:149842851-149842873 TTGCTGCTGCAGAGGAAGGGAGG - Intronic
999868927 5:155729681-155729703 TAGAAGCAGCAGAGGCAGCCCGG - Intergenic
1001065892 5:168534874-168534896 CCTCTGCAGCAGAGGCAGCGAGG + Intergenic
1001319943 5:170672284-170672306 TGGCAGCTGCAGAGACAGCATGG + Intronic
1001776775 5:174334758-174334780 TACATGCAGCAGAGGCAGGATGG - Intergenic
1003492610 6:6636802-6636824 TTGCTGCAGCAGCAGCTGCCTGG - Intronic
1004077922 6:12362257-12362279 TAGCTGAAGCAGAGGGAGCTGGG + Intergenic
1004088037 6:12471178-12471200 TGGCTGGTGCAGAGGCAGCCTGG - Intergenic
1004517345 6:16331504-16331526 GTGCTGCAGGAGGGCCAGCAGGG - Intronic
1005916278 6:30354576-30354598 TTGCTGGAGTAGAGGCACCTGGG + Intergenic
1006255941 6:32832400-32832422 GGGCTGCAGCAGATGCAGGATGG - Exonic
1006390672 6:33756418-33756440 TGGCTGGAGCAGAGGAAGCCAGG + Intergenic
1006474599 6:34246062-34246084 ATGCTGCAGCAGAGTGAGCAAGG + Exonic
1006575527 6:35042614-35042636 TTCTTGCAGCAGAGGCAGCCTGG - Intronic
1007766609 6:44164321-44164343 TTGCTGCAGGATAGGGAGTAGGG + Intronic
1008095578 6:47336300-47336322 TAGCTGGAGCAGAGGGAGCATGG - Intergenic
1008291935 6:49726109-49726131 TAGCTGGAGTAGAGGGAGCATGG - Intergenic
1008584577 6:52937093-52937115 TGGCAGCAGCAGGGGCACCAAGG + Intergenic
1008857770 6:56112513-56112535 CTTCCCCAGCAGAGGCAGCATGG + Intronic
1009754971 6:67925843-67925865 TTGCTTCATCAGAGTTAGCAGGG - Intergenic
1010293500 6:74167865-74167887 TTGCTGCAGTAGAGGCTGTCTGG + Intergenic
1011290482 6:85772062-85772084 CAGCAGCAGCAGTGGCAGCACGG + Intergenic
1012398502 6:98825573-98825595 TTGCTGATGGAGAGGGAGCAGGG - Intergenic
1012417734 6:99027779-99027801 TGGCTGCAGCTGAGTGAGCAAGG + Intergenic
1013180413 6:107712555-107712577 AGGATGGAGCAGAGGCAGCAGGG + Intronic
1013393689 6:109713284-109713306 CAGCAGCAGCAGAGGCAGCATGG + Intronic
1013526432 6:110978499-110978521 TTTCTGCAACAAAGGCAGCTTGG - Intergenic
1013841600 6:114402236-114402258 TGTCTGCAGAGGAGGCAGCATGG + Intergenic
1014450326 6:121574205-121574227 AGTCTGCAGTAGAGGCAGCAAGG + Intergenic
1014701560 6:124695254-124695276 TTTCAGAAGCAGAGGCAGAAAGG - Intronic
1014814170 6:125917360-125917382 TGGCTGGAGAAGAGACAGCAAGG - Intronic
1015334896 6:132025700-132025722 ACGCTGCAGAAAAGGCAGCATGG + Intergenic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1016453565 6:144209168-144209190 TGCCAGCAGCAGTGGCAGCATGG + Intergenic
1016453581 6:144209263-144209285 CAGCTGCAGTGGAGGCAGCATGG + Intergenic
1017209945 6:151844532-151844554 TAGCTGCAACAGAGACTGCATGG - Intronic
1017290675 6:152731947-152731969 TTTCTGCAGCCGAGGCCACATGG - Intergenic
1017898557 6:158701817-158701839 TAGCACCAGCAGAGGAAGCATGG - Intronic
1018769026 6:166956293-166956315 CTGCTGCAGCGGAGGGAGCGCGG - Exonic
1019129740 6:169864850-169864872 TTGCTGGAGCTGCGGCAGCAGGG + Intergenic
1019190429 6:170247644-170247666 GGGCAGCAGCAGAGGCAGGAGGG + Intergenic
1019558146 7:1642635-1642657 TTTCTGCAGCTGAAACAGCACGG - Intergenic
1020020673 7:4865802-4865824 TGGCAGCAGCGGAGGCAGAAAGG + Intronic
1020133766 7:5574612-5574634 TTGCTGGAGCAGAGCCAGGTGGG - Intergenic
1020474714 7:8581916-8581938 TAGCACAAGCAGAGGCAGCAGGG - Intronic
1020730096 7:11869479-11869501 TGGCTGGAGCTGAGGCAGCTGGG - Intergenic
1020995508 7:15258678-15258700 CTGCTCCAGTAGAGGTAGCAAGG - Intronic
1021092122 7:16496091-16496113 TAGCTACAACAGGGGCAGCAAGG - Intronic
1021246683 7:18271729-18271751 ATGCTGCTGCAAAGGAAGCATGG - Intronic
1021323734 7:19242076-19242098 CTGCTCCTGCAGAGGTAGCAGGG + Intergenic
1021578572 7:22128284-22128306 TTCCAGTAGCTGAGGCAGCAAGG + Intronic
1021684178 7:23165883-23165905 CTTCTGCAGCACATGCAGCAAGG - Exonic
1021979939 7:26044468-26044490 TGGCTGGAGCAGAGTCAGCAAGG - Intergenic
1022202689 7:28132897-28132919 TTGCTACTGCAGCAGCAGCATGG - Intronic
1022479706 7:30734738-30734760 TTGAGGCAGCAGAGGGAGCTAGG - Intronic
1022710930 7:32849337-32849359 TTGCTGCTGAACAGGGAGCAAGG + Intergenic
1022913721 7:34925588-34925610 TTGCTGCTGAACAGGGAGCAAGG - Intergenic
1027691639 7:81354252-81354274 CTGCTGCAGTGGAGTCAGCAAGG + Intergenic
1027779454 7:82503980-82504002 CTGCTGCAGCAGAGGAAGAGAGG - Intergenic
1027798517 7:82723116-82723138 TTGCTTAATCAAAGGCAGCAAGG - Intergenic
1028276389 7:88863104-88863126 TTGCTGTAGCATAGTGAGCACGG - Intronic
1028593930 7:92528304-92528326 TACCTGCAGCAGATGCAGCTGGG + Exonic
1029176132 7:98665843-98665865 TGGGTGCTGCAGATGCAGCAGGG - Intergenic
1029403278 7:100358325-100358347 CGGCTGCAGCAGGAGCAGCAGGG - Exonic
1029504108 7:100951689-100951711 CTCCTGCATCAGAGGCAGCTTGG - Intronic
1029513271 7:101010117-101010139 TTGCTGCAGGAGAGGAGGGAGGG + Intronic
1030856320 7:114562153-114562175 ATGCTGCAGCAGGGTCAGAAAGG - Intronic
1031363929 7:120881110-120881132 TTTCTGCAGAAGGGTCAGCATGG - Intergenic
1031528845 7:122852685-122852707 TAGCTGGAGCAGAGAGAGCAAGG + Intronic
1031836224 7:126684997-126685019 TAGCAGCAGGAGAGGCTGCAGGG + Intronic
1032063404 7:128744670-128744692 GTGAGGAAGCAGAGGCAGCAGGG + Intronic
1032333238 7:130999758-130999780 TTGCTCACACAGAGGCAGCATGG - Intergenic
1032415495 7:131732537-131732559 TGGCTGGAGCAGAGGGAGCTGGG - Intergenic
1033142278 7:138838288-138838310 CACCTGCAGCATAGGCAGCAGGG - Intronic
1034425277 7:151010700-151010722 GGGCTGGAGCAGAGGCAGCTGGG - Exonic
1034466711 7:151234025-151234047 TGGCCGCAGCAGAGCCAACAGGG - Exonic
1034740456 7:153468750-153468772 TTCCTGCATCAGACACAGCATGG + Intergenic
1034778120 7:153850395-153850417 TTGCTTCTGCAGAGCCAGCAAGG + Intergenic
1035081729 7:156221921-156221943 TAACAGGAGCAGAGGCAGCATGG - Intergenic
1035776745 8:2193989-2194011 TTCCTGCAGTGGAGGCTGCAGGG + Intergenic
1036190552 8:6665949-6665971 TTGTGGCTGCAGAGGCAGAAAGG - Intergenic
1036463381 8:8974040-8974062 TTGCTGCATCCCAGGAAGCAGGG - Intergenic
1036586542 8:10129502-10129524 TCCCTGCATCAGAGGCTGCAGGG - Intronic
1037276097 8:17180662-17180684 TTGCTGCAGCAGTAGCATTAGGG - Intronic
1037522626 8:19694893-19694915 TCTTTGCTGCAGAGGCAGCATGG - Intronic
1037662503 8:20939814-20939836 CCGCTGAGGCAGAGGCAGCATGG + Intergenic
1038018859 8:23536429-23536451 TGGCAGGAACAGAGGCAGCAGGG - Intronic
1038170729 8:25128960-25128982 CTGCTGCAGCAGTGGCAGGGCGG - Intergenic
1039485197 8:37904466-37904488 TCCCTGCAGCAGGGGCATCAGGG - Intergenic
1040388569 8:46931339-46931361 TTGCAGCTGCAGAGGCAGGCAGG - Intergenic
1041040050 8:53837740-53837762 TTGCTCCTACTGAGGCAGCAAGG + Intronic
1041232546 8:55768395-55768417 CAGCTGCAGCAGCAGCAGCAAGG - Intronic
1041344388 8:56881418-56881440 TTGCTTCAGCAGAGGGTGAATGG + Intergenic
1042567218 8:70124233-70124255 TTGCTGAAGCCGAGACAGCAGGG + Intronic
1043554077 8:81409665-81409687 TTCCTCCAGCAGTGGCAGCATGG + Intergenic
1043737879 8:83769403-83769425 TGGCTGCAGTAGAGGAAGCATGG - Intergenic
1044287677 8:90428048-90428070 TAGCTGGAACAGAGTCAGCAAGG + Intergenic
1044576287 8:93773268-93773290 TGGCTGGAGCAGAGTGAGCAGGG + Intronic
1044720540 8:95141495-95141517 CAGCTGCAGCAGAGGCTGTAGGG - Intronic
1045152969 8:99429956-99429978 TGGCTTCAGCAGAGTGAGCAAGG - Intronic
1045248040 8:100460320-100460342 TGGCTGGAGCAGAAGCAGCTGGG - Intergenic
1045842742 8:106598504-106598526 TTGCTTCCACAGAGGAAGCAGGG - Intronic
1046254015 8:111672905-111672927 TTGCTGCAGTGTGGGCAGCAAGG - Intergenic
1047171062 8:122492626-122492648 TGGCTGCAGCAGAGTTAGCAAGG + Intergenic
1047321122 8:123784097-123784119 TTGATGCCTCATAGGCAGCAGGG - Intronic
1047463277 8:125088933-125088955 TGGCTGGAGCAGAGTCAGCTAGG + Intronic
1048164779 8:132052944-132052966 ATGATTCAGCAGAGGCAGCAGGG - Intronic
1048807078 8:138250849-138250871 TGGCTGCTGCAGAGCCACCAGGG + Exonic
1049063601 8:140295460-140295482 CTGCTGCCCCAGAGGCAGCGTGG - Intronic
1049378238 8:142299183-142299205 TTGCCACAGCAGAGGCAGGGAGG + Intronic
1049407411 8:142457878-142457900 TACCGGAAGCAGAGGCAGCACGG - Intronic
1049411924 8:142477411-142477433 GTGCTGGAGCAGAGGCTCCAGGG - Exonic
1049953013 9:663729-663751 CAGCTGGAGCAGAGCCAGCACGG + Intronic
1050333150 9:4565501-4565523 TGGCTGCAGGAGAGAGAGCAAGG + Intronic
1050424921 9:5502655-5502677 TAGAAGCAGCAGTGGCAGCATGG - Intergenic
1050709569 9:8445715-8445737 TTGCTGCATCAGAGACAATATGG - Intronic
1050981959 9:12030764-12030786 CTGGTGCATCATAGGCAGCAAGG - Intergenic
1051114157 9:13674922-13674944 TTGCTGCTGCAGCGCCTGCATGG - Intergenic
1051196244 9:14565347-14565369 TGGCTGCAGCAGAATCACCAGGG + Intergenic
1051507254 9:17840702-17840724 AAGGTCCAGCAGAGGCAGCAGGG - Intergenic
1052030109 9:23618936-23618958 TTGCTGGAGCAGAGTGAGCAGGG - Intergenic
1052296473 9:26901308-26901330 TTGCTTCATCAAAGCCAGCAAGG - Intergenic
1052652519 9:31321967-31321989 TGGCTGCAGCAGGGGAGGCATGG - Intergenic
1053371317 9:37564088-37564110 CTGCTGCAGCTGAAGCAGCTGGG - Intronic
1055187074 9:73470380-73470402 CTGCTGCAGTTGAGGTAGCAGGG + Intergenic
1057179976 9:93024531-93024553 GTCCTGCCGCAGAGGCATCAAGG + Intronic
1057200701 9:93138276-93138298 AGGGTGCAGCAGAGGAAGCAGGG - Intergenic
1057853468 9:98583446-98583468 ATGCTGCAGCTGAGGCAGTTGGG - Intronic
1059655537 9:116354297-116354319 TTCCTTCAGCAGAGGCAGGCAGG - Intronic
1061188860 9:129070442-129070464 GAGCTGCAGTAGAGGCGGCACGG + Exonic
1061820694 9:133225880-133225902 TCTCTGCAACAGAGGCAGGAAGG - Intergenic
1061893159 9:133633353-133633375 ACACTGGAGCAGAGGCAGCAGGG + Intergenic
1061913068 9:133735075-133735097 ATGCTACAGCAGTGGCCGCAGGG + Intronic
1062048045 9:134433427-134433449 TGGCTGGAGCGGAGGCAGCTGGG + Intronic
1062238580 9:135524187-135524209 TATCTGCAGCAGAGGCAGGAAGG + Intronic
1062601506 9:137320499-137320521 TTGCCACAGCAGGGGCAGCTTGG + Intronic
1203525796 Un_GL000213v1:85788-85810 TGGCGGGAGCAGAGGCGGCAGGG + Intergenic
1186549242 X:10485158-10485180 TTGCTGCAACAGAGACCGTATGG + Intronic
1186755685 X:12669157-12669179 TTGCTTCATCAGAGCCAGCAAGG - Intronic
1187521779 X:20020616-20020638 TAGCAGCAGCTGAGGCAGGAAGG - Intronic
1187549522 X:20287952-20287974 TGGCTGAAGCAGAGACAGCAAGG - Intergenic
1187731379 X:22258642-22258664 TGGCTGGAGCAGAGCGAGCAAGG + Intergenic
1188132005 X:26447654-26447676 TTGCCGCAGCTGATGCTGCATGG - Intergenic
1188156698 X:26749529-26749551 ATGCTGCAGCAGAGCTGGCAAGG + Intergenic
1189294323 X:39908176-39908198 GTGCTGTGGCAGAGGCATCACGG + Intergenic
1189567254 X:42255402-42255424 CTGCTTCAGTGGAGGCAGCAGGG - Intergenic
1189583665 X:42434908-42434930 TTGCACCAGCAGTGGCAGCATGG - Intergenic
1191075144 X:56445032-56445054 TGCCAGCAGCAGAGGGAGCATGG + Intergenic
1192190291 X:68987140-68987162 GGGCAGCAGCAGAGGCAGGATGG - Intergenic
1192609710 X:72555019-72555041 TTGCTCCAGTGGAGGTAGCAGGG - Intronic
1193736214 X:85159838-85159860 CAGCAGCAGCAGTGGCAGCATGG - Intergenic
1193817487 X:86121816-86121838 CTGCTGCAGTAGAGGTAACAGGG + Intergenic
1193913005 X:87328141-87328163 CTGTAGCAGCAGAGGCAGAAGGG - Intergenic
1194231623 X:91331733-91331755 TTGCTCCAGTGGAGGTAGCAGGG - Intergenic
1194346719 X:92773995-92774017 CAGCAGCAGCAAAGGCAGCATGG - Intergenic
1195350282 X:103989170-103989192 TTGGTGTGGCAGAGGCAGCGGGG - Intergenic
1195357170 X:104049671-104049693 TTGGTGTGGCAGAGGCAGCGGGG + Intergenic
1195419187 X:104654494-104654516 TGGCTGGAGCATAGGCAGCAAGG + Intronic
1195544476 X:106100009-106100031 CTGCAGCAGCATTGGCAGCATGG + Intergenic
1195880427 X:109586908-109586930 TGGCTGCAGCAGGGGAGGCACGG - Intergenic
1195996926 X:110740945-110740967 TTGCTACAGCAGAGACTTCAAGG + Intronic
1196377609 X:115051513-115051535 TTGCTGGGGCAGAGTAAGCAAGG + Intergenic
1196949054 X:120857635-120857657 CTGCTCCAGTGGAGGCAGCAGGG - Intergenic
1197020436 X:121681177-121681199 TTGCCTCATCAGAGCCAGCAAGG - Intergenic
1197160155 X:123313873-123313895 CTGCTGGAGAAGGGGCAGCAGGG + Intronic
1197297582 X:124737900-124737922 TAGCGGCAGCTTAGGCAGCAAGG + Intronic
1198312953 X:135438105-135438127 GTGCTGCAGCAGTGGCAGGAGGG + Intergenic
1198471120 X:136948139-136948161 TGGCGGCAGCAGAGGCAGAAAGG + Intergenic
1198785602 X:140284207-140284229 ATCTTCCAGCAGAGGCAGCATGG - Intergenic
1198861873 X:141079572-141079594 TTGATGCAGGAGAGGCAAAATGG - Intergenic
1198900817 X:141507800-141507822 TTGATGCAGGAGAGGCAAAATGG + Intergenic
1198975023 X:142327049-142327071 GAGCAGCAGCAGTGGCAGCATGG + Intergenic
1199997117 X:153032498-153032520 TTCCTGCAGCCGCGACAGCACGG + Intergenic
1200056695 X:153465339-153465361 TGGCTGCAGCAGAGGCAGAGAGG + Intronic
1200072270 X:153535146-153535168 TGGCTGCAGAAGGGGCAGCCTGG + Intronic
1200655052 Y:5890639-5890661 CAGCAGCAGCAAAGGCAGCATGG - Intergenic
1201229106 Y:11845881-11845903 TCACTGTGGCAGAGGCAGCATGG - Intergenic
1201408498 Y:13673435-13673457 TTGTTTCAGCAAAGGTAGCAGGG - Intergenic