ID: 1096985919

View in Genome Browser
Species Human (GRCh38)
Location 12:55757392-55757414
Sequence ATGCTCCCTCATTGCGAGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 54}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096985913_1096985919 5 Left 1096985913 12:55757364-55757386 CCGCAGTTCATGGATGTACCTGG 0: 1
1: 0
2: 1
3: 8
4: 99
Right 1096985919 12:55757392-55757414 ATGCTCCCTCATTGCGAGGCAGG 0: 1
1: 0
2: 1
3: 7
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096985919 Original CRISPR ATGCTCCCTCATTGCGAGGC AGG Exonic
903008506 1:20314306-20314328 ATGTTCCCTAAGTGCCAGGCTGG - Exonic
904575729 1:31503979-31504001 CTGCTCCCTCACTTCCAGGCAGG - Intergenic
908772656 1:67610408-67610430 CTGCTCCCTCCATGCCAGGCTGG - Intergenic
910331206 1:86073943-86073965 ATGCTCCCTCCTTGTAAGGCAGG - Intronic
917837807 1:178954569-178954591 ATGCTCCCACGCAGCGAGGCGGG - Intergenic
921468577 1:215521406-215521428 AGGCTTCCTCATTGTGTGGCTGG + Intergenic
923322546 1:232849182-232849204 ATTTTCCCTCATTTCGAGGGTGG + Intergenic
1073442194 10:103558831-103558853 ATGCTCCCTCAGGGCAAGGAAGG + Intronic
1075630419 10:123997364-123997386 CTGCTCCCTGAATGCTAGGCTGG + Intergenic
1076160429 10:128240136-128240158 ATGCTCCCTCTCTGAGGGGCAGG + Intergenic
1077080703 11:723359-723381 ATGCTCCCTCACTTTGAGGGGGG - Intronic
1080128474 11:28765995-28766017 ATGCTCCCTCCTTGGGTGCCAGG - Intergenic
1083270222 11:61568491-61568513 ATGCTCCCTCCTGGGGAGGCAGG - Intronic
1085426601 11:76410223-76410245 TTTCTCCCTCTTTGGGAGGCTGG - Intronic
1089577064 11:119452459-119452481 ATGCTCCCTCACTGTGAGGCAGG + Intergenic
1091305919 11:134536026-134536048 ATGCTTCCTCACAGGGAGGCAGG + Intergenic
1091347176 11:134863350-134863372 ATTCTCCCTCTTTGCAAGCCAGG + Intergenic
1091544473 12:1492191-1492213 ATGCTTCCTGATAGCCAGGCTGG + Exonic
1091592971 12:1856257-1856279 ATGCTCCCTCACTGCCATGAGGG + Intronic
1094834786 12:34317260-34317282 AGGCACCCTCATTGCGAACCAGG + Intergenic
1096985919 12:55757392-55757414 ATGCTCCCTCATTGCGAGGCAGG + Exonic
1097182080 12:57177457-57177479 AGGCTGCCTCAATGCGGGGCAGG - Exonic
1107115084 13:36738301-36738323 ATGCTCCCTCGTTTCTAGCCAGG + Intergenic
1112496387 13:99908464-99908486 AGGCTTCCACACTGCGAGGCGGG - Intergenic
1113192916 13:107770966-107770988 AGGCTCCCTCATTCCTAGGAAGG - Intronic
1117625357 14:57631554-57631576 AACCTCCCTCATAACGAGGCAGG - Intronic
1128084480 15:64876357-64876379 CTGCTGCCTCATTGCGAGGGTGG + Intronic
1129913224 15:79245260-79245282 ATGCTCCCTCACTGTGTGGGCGG + Intergenic
1130687155 15:86048713-86048735 ATGCTTCCTCTTTGCAATGCTGG + Intergenic
1137001709 16:35235100-35235122 ATGCTCCATCCTTGGGAGGTGGG - Intergenic
1152941681 17:83176058-83176080 GTGCTCCCTCAAGGGGAGGCTGG - Intergenic
1160161647 18:76477422-76477444 TTGCTTCCTCATTGTGGGGCTGG - Intronic
1165907938 19:39204943-39204965 AGGCTCCCTCCCTGGGAGGCAGG + Intergenic
927517987 2:23683025-23683047 CTGCTCCCTGATTGCCAGGCAGG - Intronic
932121136 2:69101532-69101554 TTGCTCCCTCAATGTGAGCCAGG - Intronic
937399520 2:121569809-121569831 AGTCTCCCTCTTTGCCAGGCTGG - Intronic
1178895900 21:36556580-36556602 ATGCATCCTCAGTGGGAGGCTGG + Intronic
953315134 3:41920246-41920268 ATGCTTCCTCACTTGGAGGCAGG + Intronic
954784884 3:53085301-53085323 AGGCTGCCTCACTGTGAGGCTGG - Intronic
956179832 3:66507022-66507044 ATTCTCCCTCCTTGCAGGGCAGG - Intergenic
960262912 3:115588643-115588665 ATGCTCTCTCAATGCCAGCCAGG - Intergenic
961484943 3:127209927-127209949 ATGCTTCCTCATGGCGCTGCTGG - Intergenic
961831848 3:129627043-129627065 TTGCTCCCTCCAAGCGAGGCGGG - Intergenic
971469416 4:27004589-27004611 CTTCTCCCTCACTGTGAGGCAGG - Intronic
981475907 4:145186658-145186680 ATGCTCCCTCATGCGGAGGCTGG - Intergenic
994236668 5:97370632-97370654 ATCCTGCCACATTGCGAGGTGGG + Intergenic
1002645778 5:180653263-180653285 ATGCTCTCTTTTTGGGAGGCAGG + Intergenic
1006511519 6:34524080-34524102 ATGCTCCCTCATCTGGAAGCTGG + Intronic
1007245747 6:40461033-40461055 ATGCTTCCTGATTGCCTGGCTGG - Intronic
1012227633 6:96723152-96723174 AGGCTCCATCATTGTCAGGCAGG + Intergenic
1024610211 7:51057834-51057856 ATGCTGTCCCCTTGCGAGGCAGG + Intronic
1034617964 7:152435651-152435673 AAGCGCCATCTTTGCGAGGCCGG + Exonic
1037616342 8:20522600-20522622 ATGCTCACTGAGTGCCAGGCTGG + Intergenic
1039777033 8:40746952-40746974 AAATTCCCTCATTCCGAGGCTGG + Intronic
1041545583 8:59038895-59038917 CTGCTCCCGCATCGCGGGGCAGG - Intronic
1042958828 8:74280812-74280834 ATGCTCCGTAATTGCAAGGCAGG - Intronic
1045371460 8:101528543-101528565 ATGTGCCCTCATTGCAAGGCAGG + Intronic
1050205034 9:3187339-3187361 ATGCTCCCTCCCTGAGACGCAGG - Intergenic
1053131679 9:35618941-35618963 ATGCACCCTCATGGGGAGCCAGG + Intronic
1061378337 9:130239366-130239388 ATGGACCCTCAATGAGAGGCAGG + Intergenic
1062379454 9:136280287-136280309 CTGCTCTCTCAGTGCCAGGCAGG + Intergenic
1187047959 X:15666562-15666584 TTTCTCCCTCCTTGCGAGGGTGG + Intergenic
1196588450 X:117458329-117458351 ATACTTCCTCAGTGCCAGGCTGG + Intergenic