ID: 1096989035

View in Genome Browser
Species Human (GRCh38)
Location 12:55783497-55783519
Sequence CTGTTCACTGAGACTTAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 96}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096989028_1096989035 28 Left 1096989028 12:55783446-55783468 CCATGCCATTCTTTGCCTTGTCA 0: 1
1: 0
2: 2
3: 40
4: 505
Right 1096989035 12:55783497-55783519 CTGTTCACTGAGACTTAAGCTGG 0: 1
1: 0
2: 0
3: 21
4: 96
1096989033_1096989035 -6 Left 1096989033 12:55783480-55783502 CCTAAACCAATAAGATTCTGTTC 0: 1
1: 0
2: 0
3: 14
4: 195
Right 1096989035 12:55783497-55783519 CTGTTCACTGAGACTTAAGCTGG 0: 1
1: 0
2: 0
3: 21
4: 96
1096989027_1096989035 29 Left 1096989027 12:55783445-55783467 CCCATGCCATTCTTTGCCTTGTC 0: 1
1: 0
2: 3
3: 21
4: 274
Right 1096989035 12:55783497-55783519 CTGTTCACTGAGACTTAAGCTGG 0: 1
1: 0
2: 0
3: 21
4: 96
1096989032_1096989035 1 Left 1096989032 12:55783473-55783495 CCATTAGCCTAAACCAATAAGAT 0: 1
1: 0
2: 1
3: 8
4: 145
Right 1096989035 12:55783497-55783519 CTGTTCACTGAGACTTAAGCTGG 0: 1
1: 0
2: 0
3: 21
4: 96
1096989031_1096989035 5 Left 1096989031 12:55783469-55783491 CCTTCCATTAGCCTAAACCAATA 0: 1
1: 0
2: 2
3: 7
4: 117
Right 1096989035 12:55783497-55783519 CTGTTCACTGAGACTTAAGCTGG 0: 1
1: 0
2: 0
3: 21
4: 96
1096989029_1096989035 23 Left 1096989029 12:55783451-55783473 CCATTCTTTGCCTTGTCACCTTC 0: 1
1: 0
2: 2
3: 48
4: 550
Right 1096989035 12:55783497-55783519 CTGTTCACTGAGACTTAAGCTGG 0: 1
1: 0
2: 0
3: 21
4: 96
1096989030_1096989035 13 Left 1096989030 12:55783461-55783483 CCTTGTCACCTTCCATTAGCCTA 0: 1
1: 0
2: 1
3: 15
4: 129
Right 1096989035 12:55783497-55783519 CTGTTCACTGAGACTTAAGCTGG 0: 1
1: 0
2: 0
3: 21
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096989035 Original CRISPR CTGTTCACTGAGACTTAAGC TGG Intronic
900785730 1:4648962-4648984 ATGTTGACTGAGCCTTAAGGGGG - Intergenic
906841517 1:49144578-49144600 CTGCTCCCTCAGACCTAAGCTGG + Intronic
910016808 1:82535149-82535171 CTGTTCACTGAGCCGTGGGCAGG - Intergenic
910700324 1:90067313-90067335 CAGTTCAGTGGGAATTAAGCTGG - Intergenic
916209836 1:162351500-162351522 CTGTCCACTGAGACAGAAGGGGG - Intronic
916423219 1:164655778-164655800 CTATTCACTGAGATTTAGGGAGG - Intronic
920696476 1:208184832-208184854 CTGTTCCCCCAGGCTTAAGCGGG + Intronic
922483820 1:225957988-225958010 CTGCACACTGAGCCTTAAACGGG - Intergenic
922985606 1:229863957-229863979 CTGCTCACTGAAAGTCAAGCAGG + Intergenic
1062898216 10:1121282-1121304 ATGTTCACTGAAACTTAACTTGG + Intronic
1068775081 10:60860297-60860319 CTCTTGGCTGAGACTTCAGCAGG - Intergenic
1075631233 10:124001758-124001780 CTGGTCACTGCGACTGAAGATGG + Intergenic
1078784223 11:14472275-14472297 CTGTTCATTGACAATTTAGCTGG - Intronic
1080342062 11:31275872-31275894 CTGGCCAATGAGACATAAGCAGG + Intronic
1086605554 11:88692089-88692111 CTGAACATTGAGACTTTAGCAGG - Intronic
1088157042 11:106819218-106819240 GTGTTCACTGAGTCTTCAGCAGG - Intronic
1088189535 11:107212499-107212521 CTTTTCACTGTGACATTAGCTGG - Intergenic
1089670616 11:120054496-120054518 CTGTCCACTGGCACTGAAGCAGG + Intergenic
1093935765 12:24998564-24998586 CTGTTCACTGAGACATTCCCAGG - Intergenic
1096989035 12:55783497-55783519 CTGTTCACTGAGACTTAAGCTGG + Intronic
1097745828 12:63302287-63302309 CTCCTCACTGATAATTAAGCTGG - Intergenic
1098270456 12:68764832-68764854 CTGTTCACTGAGCTTAAAGTGGG - Exonic
1099102070 12:78454819-78454841 CTGTGCACTGAGACTTCAAAAGG - Intergenic
1099931105 12:89076012-89076034 CTGATCACTGAAGCTAAAGCAGG + Intergenic
1100781520 12:98031855-98031877 CTGTACATTGAGAAGTAAGCTGG - Intergenic
1103879036 12:124151930-124151952 CTGTTGACTGAGACAGAATCTGG - Intronic
1110138164 13:72094357-72094379 CTGTTCTATGAGAATTCAGCTGG - Intergenic
1111816518 13:93160750-93160772 CTTTCCACTGAGACCTTAGCTGG - Intergenic
1112824305 13:103374330-103374352 CTGTACACTGAGAGTAGAGCAGG + Intergenic
1120171393 14:81249863-81249885 CTGTTGGCTGAGACTTTCGCTGG + Intergenic
1120484579 14:85096274-85096296 CTGTTAGCTGAGACTTAAGTTGG - Intergenic
1121164373 14:91777767-91777789 CTGTTCACTGTAACCTTAGCTGG + Intronic
1121254409 14:92520583-92520605 CTGTTCTCTGAAAGATAAGCTGG + Intronic
1122084095 14:99287502-99287524 CAGTTGACTGAGCCTTCAGCGGG + Intergenic
1124820775 15:33044027-33044049 CTGTGCACTGAGATTAGAGCAGG - Intronic
1126059823 15:44769754-44769776 CTGTACACTGGGACTCTAGCAGG - Intergenic
1127161132 15:56187534-56187556 ATGGTCACTTAGACTGAAGCAGG + Intronic
1130765970 15:86871575-86871597 CTGTTCACTAAGCCTTAAGATGG + Intronic
1133167770 16:3960680-3960702 CTGTTGACTGAGACTCTAACAGG + Intronic
1134052134 16:11144701-11144723 CTCTTCACTGTGACTTAACTGGG - Intronic
1134217251 16:12325916-12325938 CTGTTCAGGGAGACTGAGGCAGG + Intronic
1135683404 16:24478260-24478282 CCGATCACTGAGACTTCTGCTGG + Intergenic
1136711410 16:32240209-32240231 CTGTTCTCAGAGGCTTATGCGGG + Intergenic
1136756500 16:32689196-32689218 CTGTTCTCAGAGGCTTAAGCGGG - Intergenic
1136811611 16:33181177-33181199 CTGTTCTCAGAGGCTTAAGCGGG + Intergenic
1136818087 16:33291257-33291279 CTGTTCTCAGAGGCTTAAGCGGG + Intronic
1136824651 16:33347786-33347808 CTGTTCTCAGAGGCTTAAGCGGG + Intergenic
1136829717 16:33446557-33446579 CTGTTCTCAGAGGCTTAAGCGGG + Intergenic
1202990189 16_KI270728v1_random:4146-4168 CTGTTCTCAGAGGCTTAAGCGGG + Intergenic
1203058644 16_KI270728v1_random:949550-949572 CTGTTCTCAGAGGCTTAAGCGGG - Intergenic
1144056406 17:11545779-11545801 CTGTCAACTGAGACCTCAGCTGG + Intronic
1151817498 17:76478547-76478569 CTCTGCACTGACTCTTAAGCTGG - Intronic
1154532533 18:15362200-15362222 CTGTTCACAGAGCCTGAGGCAGG + Intergenic
1156515518 18:37676189-37676211 CTGTTTATTGGGACTTCAGCTGG + Intergenic
1157283462 18:46361033-46361055 CTGCTCACTGAGAGGTTAGCTGG - Intronic
1160067171 18:75586500-75586522 CTTTTCACTGCCACTTCAGCAGG + Intergenic
926149137 2:10415092-10415114 CAGAGCACTGAGACTCAAGCTGG - Intronic
928348483 2:30522762-30522784 CTCTAAACTCAGACTTAAGCAGG - Intronic
932526577 2:72475921-72475943 CTGGTCACTGGCACCTAAGCTGG + Intronic
939834994 2:147119043-147119065 TTGTTAACTGAGAGTTAAGCTGG + Intergenic
940235682 2:151508567-151508589 ATGTTCACTGAGCCATGAGCAGG + Intronic
945577014 2:211544013-211544035 CTGTGCAGTGAGACTTTAACTGG - Intronic
947055835 2:226102358-226102380 CTGTTCACTGAGTTTTAAAAAGG - Intergenic
1181940014 22:26468482-26468504 CTGGTCACTGAGCCTGAGGCTGG - Intronic
1185220985 22:49629199-49629221 CTGTTCACTGAGCCTGCAGGAGG + Intronic
950721443 3:14885575-14885597 CTGTTGTCCGAGACTTAAGCTGG + Intronic
951132966 3:19069636-19069658 CTGTTGGCTGAGACCTAAGCTGG + Intergenic
954100411 3:48367990-48368012 TTGTTCACTGCCACTTATGCAGG - Intergenic
956791317 3:72682268-72682290 CTGTTGACTGAGGCTTTAGCTGG - Intergenic
957177095 3:76825215-76825237 CTGTTTAATGACACTGAAGCTGG - Intronic
963206879 3:142645470-142645492 CTGCTCACTCAGACTCAAGTTGG + Intronic
965749122 3:171958283-171958305 CTATTCACAGGGACTTCAGCAGG - Intergenic
973053847 4:45629988-45630010 CAATTCACTGAGACATAAGCTGG + Intergenic
973538742 4:51912227-51912249 CTGTTCTCAGAGAGTTTAGCTGG + Intronic
984257101 4:177402093-177402115 CTGTTCACTAAACCTAAAGCAGG + Intergenic
986034540 5:3925196-3925218 ATGTTCACTGAGACCAAGGCAGG - Intergenic
987284842 5:16446022-16446044 ATGTTGACTGAGACTTTAGCTGG + Intergenic
990339074 5:54804613-54804635 CTCTTCATTGTGACTTAAACAGG + Intergenic
991584500 5:68188108-68188130 TTGTTCACGGAGACTTCAACAGG + Intergenic
996712187 5:126554221-126554243 CTTTTCCCTGAGACACAAGCAGG - Intronic
997127785 5:131245578-131245600 TGGTTCACTGGGACTTAAACAGG + Intronic
998912993 5:146981335-146981357 CTCTTCAATGAGAGTTTAGCTGG + Intronic
1000413189 5:160955761-160955783 CTTTTAACTGAGACATAAACAGG - Intergenic
1001380346 5:171302107-171302129 CTGTTCACTCTGAGTTAAGTTGG - Intergenic
1004548316 6:16621262-16621284 CTGGGCTCTGAGACTGAAGCAGG - Intronic
1008898182 6:56581500-56581522 CTGTTCACTCAGAGATACGCGGG - Intronic
1009402065 6:63268722-63268744 CTGTTCAAAGTGACTTAAACTGG - Intergenic
1010107441 6:72186543-72186565 CTGTTCACTCAGATTTAAAGTGG + Intronic
1013217679 6:108043854-108043876 CTGCTCGCTGAACCTTAAGCTGG + Exonic
1013417503 6:109938119-109938141 CTGCTCACTGAGACGTTGGCTGG - Intergenic
1013846070 6:114453149-114453171 GTGGTCACTGAGACTGCAGCTGG + Intergenic
1016665156 6:146630829-146630851 CTTTTCACTGAGACTTGAGTAGG + Intronic
1021105756 7:16638076-16638098 CTATTGAGTGAGAGTTAAGCAGG - Intronic
1021895969 7:25236109-25236131 CTGTTAAATGAAACTTAAGTTGG + Intergenic
1023087304 7:36583791-36583813 CTGTTCTCTGAGCTTGAAGCAGG + Intronic
1026431919 7:70356204-70356226 GTGTTCACAGAGACTGAAGCAGG - Intronic
1029062912 7:97816887-97816909 CTTTTCCCTGAGTCTTCAGCAGG - Intergenic
1031754923 7:125626659-125626681 CTGTTCAATCAGACCTACGCAGG - Intergenic
1034259596 7:149746474-149746496 CTGTTCACAGGGAATTAAGTGGG + Intergenic
1041369404 8:57143252-57143274 CTGTTCACTGAGAGTTGAACAGG + Intergenic
1046605486 8:116367002-116367024 CTCTTCATTGACACTTAAGCAGG - Intergenic
1046802300 8:118441933-118441955 CTGTCAACTGAGACCTTAGCTGG - Intronic
1047930633 8:129725248-129725270 CTGTTCCCTGACAATAAAGCTGG + Intergenic
1051105002 9:13569400-13569422 ATGTTCACAGAGACATCAGCTGG + Intergenic
1052476627 9:28969380-28969402 CTGGTAACTGAGACTGAAGCAGG + Intergenic
1055416236 9:76086463-76086485 CTGTTCACAGAGGCCTCAGCAGG - Intronic
1055654279 9:78437724-78437746 CTGCTCACCTAGACTTAGGCAGG + Intergenic
1055903113 9:81263559-81263581 CAGTTGACTGAAACTGAAGCAGG + Intergenic
1056872974 9:90302242-90302264 GTGTTCAGTGAGAGTCAAGCAGG - Intergenic
1059187394 9:112287137-112287159 AAGTTCAGTGAAACTTAAGCAGG - Intronic
1186255940 X:7719734-7719756 CTGTTCATTGACAATTAATCTGG - Intergenic
1187694701 X:21907476-21907498 CTATTCACAGAGACTTTGGCAGG + Intergenic
1190959116 X:55228042-55228064 CTTTTCACTGAGGCTGGAGCTGG - Intronic
1199319700 X:146423415-146423437 CTTTTCACTGAGGCCTATGCTGG + Intergenic
1202276298 Y:23124056-23124078 CTGTTGACGGATACTTAGGCTGG - Intergenic
1202289730 Y:23296634-23296656 CTGTTGACGGATACTTAGGCTGG + Intergenic
1202429292 Y:24757781-24757803 CTGTTGACGGATACTTAGGCTGG - Intergenic
1202441499 Y:24912309-24912331 CTGTTGACGGATACTTAGGCTGG + Intergenic