ID: 1096991993

View in Genome Browser
Species Human (GRCh38)
Location 12:55812128-55812150
Sequence CAGAGTGAGCAATGGTAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096991993_1096991995 -9 Left 1096991993 12:55812128-55812150 CCTTATTACCATTGCTCACTCTG 0: 1
1: 0
2: 1
3: 11
4: 150
Right 1096991995 12:55812142-55812164 CTCACTCTGATAAGCCAAACTGG 0: 1
1: 0
2: 0
3: 10
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096991993 Original CRISPR CAGAGTGAGCAATGGTAATA AGG (reversed) Intronic
903319245 1:22532207-22532229 CAGAGTGAACAGTGGTACGAGGG + Intergenic
904296474 1:29522488-29522510 CAGAGTGAGGAAAGGTGATCTGG - Intergenic
905502316 1:38449519-38449541 CAGAATGAGTAATAGTAATGGGG + Intergenic
905530569 1:38675475-38675497 CAGAGTTAGCAAGAGGAATAGGG - Intergenic
907330076 1:53664978-53665000 CAGAGTGAGCAATGGGGCGAGGG + Intronic
908150223 1:61293141-61293163 AAGAGAGGGCAATGGTAACATGG - Intronic
910355864 1:86353823-86353845 CAGTGTGGGCAATGGTAACAGGG + Intronic
910803220 1:91165408-91165430 CAGATGGAGCAATGGCGATAAGG + Intergenic
914853781 1:151335069-151335091 AAGAGTGAGGAATGGTAGGAAGG + Intergenic
919040226 1:192377806-192377828 CAGATTCAGCCATAGTAATAAGG - Intergenic
919939366 1:202275838-202275860 CTCAGAGAGCAAGGGTAATATGG + Intronic
922803763 1:228375534-228375556 CACAGTGAGGAATGGTAGGAGGG - Intronic
923137532 1:231131497-231131519 CAGAGGGTGCAGAGGTAATAAGG - Intergenic
1065411577 10:25435296-25435318 CAAAGTGAGAAAGGATAATAAGG + Intronic
1066222734 10:33351772-33351794 GAGAGTGAGCAAAGGTAGAAAGG - Intergenic
1067927225 10:50522082-50522104 CTGAGTAATGAATGGTAATATGG - Intronic
1069181274 10:65362163-65362185 CAGTAGGAGAAATGGTAATAAGG + Intergenic
1069249915 10:66255254-66255276 TAGAGTGAGCAAAGGGAAAAGGG + Intronic
1071356386 10:84800471-84800493 CAGACTGACCAATGGGAACATGG - Intergenic
1073844705 10:107541825-107541847 CAGAGGGACCAATGATAATTGGG + Intergenic
1075145203 10:119876778-119876800 CTGAGAGAGCACTGGAAATATGG + Intronic
1075826763 10:125363719-125363741 AGGAGTGGGCAATAGTAATAAGG - Intergenic
1077985913 11:7350905-7350927 GAGAGTGAGCAATGGGATCAGGG - Intronic
1079117960 11:17652574-17652596 CAGAGGGAGCAGTGGAAAGAAGG + Intergenic
1081543402 11:44052347-44052369 CAGATGGAGCAATGGTTATCAGG - Intronic
1092598614 12:10034679-10034701 CAGAGTGTGCAATGGAGGTATGG + Intronic
1093850039 12:24025227-24025249 GAGAGTGAGAAATGGAAAGATGG + Intergenic
1096296712 12:50390247-50390269 CAGAGTGTGCATTGGGAAAAAGG - Intronic
1096421661 12:51463942-51463964 CAGAGGGAACAATGGTAGGAAGG - Intronic
1096984157 12:55745350-55745372 CAGAGTTAGCTCTGGTAATGGGG + Intronic
1096991993 12:55812128-55812150 CAGAGTGAGCAATGGTAATAAGG - Intronic
1098511966 12:71326458-71326480 CAGAGTGTACAATGGTCATTGGG + Intronic
1099278296 12:80607035-80607057 CAAAGTGAGCAAGGGAAAGAGGG + Intronic
1100734134 12:97508161-97508183 CAGAGTCAGCAATGGTAAGAAGG + Intergenic
1101617663 12:106354067-106354089 CAGCGTGAGCAATGGCATGAGGG - Intergenic
1105589926 13:21782871-21782893 ATGAGTGAGCAATGTTAACAGGG - Intergenic
1111485627 13:88895554-88895576 CAGAGTGAGCACTGGGAGCAGGG - Intergenic
1112827642 13:103410376-103410398 CAAAGACAGCAATAGTAATAAGG + Intergenic
1114590585 14:23861001-23861023 CAGTGTCAGCAATGGTGATGTGG + Intergenic
1120537496 14:85715012-85715034 AAGAGTGAGAAATGGCAAGAAGG + Intergenic
1120902489 14:89587920-89587942 CAGATAGAGCAATGGGCATATGG + Intronic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1124996806 15:34731633-34731655 CAGAGGAAGGGATGGTAATAGGG + Intergenic
1125188415 15:36960278-36960300 TAGAGTAAGCAATGGAAATGTGG + Intronic
1126329833 15:47520348-47520370 CAGAGTGAGGAATAGGAATCAGG + Intronic
1127638149 15:60890586-60890608 CAGAGAGAGCAGTGGTGATAAGG + Intronic
1128187205 15:65652501-65652523 CTGAGTGAGGAAGGGTGATAGGG - Intronic
1128484569 15:68072004-68072026 CAGCATGAGCAAAGGTAATGAGG + Intronic
1128763230 15:70233567-70233589 CTGAGTGAGGATTGCTAATAGGG + Intergenic
1131731444 15:95286258-95286280 AAGAGTGAGCAGTGGTAGAAAGG - Intergenic
1132160544 15:99537525-99537547 CAGAGTCAGGAATGGGAGTATGG + Intergenic
1144992697 17:19244785-19244807 CAAAATGAGAAATGGTGATAGGG - Intronic
1146606701 17:34265648-34265670 CAGAGAAAGCAATGCTAAGAGGG - Intergenic
1148991104 17:51668064-51668086 CAGAGGGAGCCATGGTATTTGGG - Intronic
1150201606 17:63362726-63362748 CAGAGTGGGCACTGGGAACAGGG + Intronic
1153652041 18:7249455-7249477 CAGAGTGAGAAATAGAAACAGGG - Intergenic
1155026585 18:21946115-21946137 GAGAGTGAGCAATGGTGAGGCGG + Intergenic
1156877621 18:42034497-42034519 CAGACTGAGAAATGTTAAAAAGG - Intronic
1158094679 18:53757186-53757208 CAGAGTGAGCAAATATAAAAAGG - Intergenic
1158470592 18:57733032-57733054 CAGAGTGGGCAGTGGTAGTTAGG - Intronic
1158605662 18:58893833-58893855 CAGAGAGAGCAGTGGTTACATGG + Intronic
1159195570 18:65110013-65110035 AAGATTGACCAATGGTCATATGG - Intergenic
1161496733 19:4590697-4590719 CAGAGTGAGGAATGGGAGGAAGG + Intergenic
1161636223 19:5390905-5390927 CAGAGTGAGTAATGGGGAGATGG - Intergenic
1161646217 19:5454995-5455017 CAGAGTGAGGGATGGTGACAGGG + Intergenic
1162937575 19:13989044-13989066 GAGAGTGAGCAATGGGGGTAGGG + Intronic
1163357841 19:16826028-16826050 CTGGGTGAGAAAAGGTAATATGG + Intergenic
1166391000 19:42408900-42408922 CAGAGTGAGCAGTGGGGAGAGGG + Intronic
925404767 2:3598855-3598877 TAGAGTGAGGAACTGTAATAAGG + Intronic
926933930 2:18067953-18067975 CAGTGTTAGAAATAGTAATAAGG + Intronic
926989345 2:18660783-18660805 AAGAGTGACAAGTGGTAATATGG - Intergenic
927282626 2:21323619-21323641 CACAGAGAGGAATGGTAACATGG + Intergenic
927631791 2:24780883-24780905 GATAGTGAGCCATGGCAATATGG + Intergenic
928110915 2:28508004-28508026 TAGAGTGACTAATGGTAATAAGG + Intronic
932303875 2:70687713-70687735 CAGTGGGAGAAATTGTAATAAGG - Intronic
935349399 2:102140812-102140834 CAGATAGAACAGTGGTAATAAGG + Intronic
939355404 2:141095070-141095092 CAGAGAGAGCAATTGTAAAAGGG - Intronic
940192303 2:151054897-151054919 CAGAGTGAGCAAGGGGCATGAGG - Intergenic
940429301 2:153569806-153569828 AAAAGTGAGCAAGGTTAATAGGG - Intergenic
942367884 2:175247986-175248008 CAGAGTGATCATTTGTAACAGGG - Intergenic
944847010 2:203679176-203679198 CAGAGTGAGCAAAGGCCAAATGG + Intergenic
1169523976 20:6402887-6402909 CAGCATTAGCAATGGTCATAAGG - Intergenic
1169821528 20:9716764-9716786 AAAAGTCAGTAATGGTAATATGG - Intronic
1173838737 20:46142453-46142475 CAGAGTGAGCAAGGGAGAGAGGG - Intergenic
1176290379 21:5040977-5040999 TAGAGTGAACCATGGTAATAAGG - Intergenic
1176728116 21:10460627-10460649 CAGAGTCAACAATGATACTAAGG + Intergenic
1177206969 21:18021449-18021471 CAGACTGAGAAAAGGTAACATGG + Intronic
1179866876 21:44222664-44222686 TAGAGTGAACCATGGTAATAAGG + Intergenic
1182001746 22:26925631-26925653 CAGAGTGAGCAATAGGGAAAGGG - Intergenic
1184997367 22:48218163-48218185 CAGAGTGAGCTATGGGAAAGTGG + Intergenic
950258268 3:11523625-11523647 CAGAGTGTGCAAAGGAAATCAGG - Intronic
956717438 3:72090781-72090803 CAGAGTGAGCAAAGGCAAGAAGG + Intergenic
957566566 3:81891659-81891681 CTGAGTGAGTAAGGGAAATAAGG - Intergenic
960714770 3:120564045-120564067 CAGGGAGAGCAATGATACTAGGG + Intergenic
961977254 3:131039493-131039515 TAAAGTAAGCAATGGTAAAAGGG - Intronic
967218444 3:187229347-187229369 CAGAGGCAGCAATGATAAAAAGG - Intronic
971060223 4:22959667-22959689 CAGAGTCAGCAAAGATAAAAGGG - Intergenic
971182215 4:24339464-24339486 CAGTGTGAACAAAGGTAAAAAGG - Intergenic
972910624 4:43812151-43812173 CATGGTGATCAATGGAAATATGG + Intergenic
974107324 4:57485181-57485203 CAGTGTGAGAAATAGTAACATGG - Intergenic
974498072 4:62659295-62659317 CAGAGGGAGCATTTATAATAAGG - Intergenic
975950148 4:79760782-79760804 CAGAGAGATCAATAGGAATAAGG - Intergenic
977682961 4:99815506-99815528 CCGGGTGAACAGTGGTAATAGGG + Intergenic
977740207 4:100470943-100470965 CAGAGAAAGCAATGGAAAGAAGG + Intronic
977779605 4:100965378-100965400 CAGAGAGAGAACTGGCAATAAGG + Intergenic
978770218 4:112448394-112448416 CAGAGTGTGCAATGGGAATGGGG - Intergenic
979728796 4:123996845-123996867 CCAAGTCAGCAATGGTAAAAAGG + Intergenic
984737425 4:183122893-183122915 CAGAGTGATCAATGAATATATGG + Intronic
992040596 5:72827105-72827127 AGGAGTGAGCAATGTGAATATGG + Intronic
994683672 5:102922399-102922421 CAAAGAGAGCAATGGAAATAAGG + Intronic
994839167 5:104899250-104899272 CAGAGTAATCTATGGCAATAGGG - Intergenic
995723925 5:115165853-115165875 CAGAGTGGGCACTGGGAATGGGG - Intronic
996278737 5:121700723-121700745 CAGAATGAGCAATAGTTAAAAGG + Intergenic
997221507 5:132170095-132170117 CATAGTGAGCAAAGGGAATGTGG - Intergenic
997761770 5:136455628-136455650 CAGAGTGAGCAATGGCTGTGTGG + Intergenic
998794644 5:145805207-145805229 AAGAATGATCAATGGAAATAAGG - Intronic
998863953 5:146475805-146475827 CTAAGTGACCAATGGTGATAAGG - Intronic
1001021024 5:168182735-168182757 CAGAGTCAGCAATGCTAACTGGG + Intronic
1001204099 5:169745915-169745937 CAGAGGGAGCTATGGAACTAGGG + Intronic
1003750632 6:9051390-9051412 CAGATTGAGCAGTGGCAATGTGG + Intergenic
1004173358 6:13316518-13316540 GAGAGTGAACAATGGTAGTGGGG - Intronic
1004663427 6:17729549-17729571 CGGAGTCAGCAGTGGTAATCTGG + Intergenic
1004702334 6:18091049-18091071 CAGTGTGAGCAATGGCAAGGAGG - Intergenic
1006605894 6:35257808-35257830 CAGAGAGAGCTATGGAAAAAGGG + Intergenic
1007366152 6:41394885-41394907 CAGAGTGGAAAATTGTAATAAGG + Intergenic
1008944498 6:57082985-57083007 CAGATTGAGCAAGGGTGCTAAGG + Intergenic
1009846972 6:69146324-69146346 CAGAGTGAGCACTGGGAATGGGG + Intronic
1011572209 6:88750292-88750314 TAGTGAGAGCAAGGGTAATATGG + Intronic
1012670464 6:102039124-102039146 CAGAGTGATGAATGGTGATGGGG - Intronic
1013896219 6:115091621-115091643 CAGAGTGAGCAAAGGCACAATGG - Intergenic
1014890913 6:126845132-126845154 CAGAGTGAGCAAAGGCATTGAGG + Intergenic
1017397479 6:154019293-154019315 GTGAGGGAGCAATGGTCATATGG - Intronic
1017943346 6:159073140-159073162 CAGAGGGAGCAAGGGACATACGG - Intergenic
1019927719 7:4204410-4204432 CAGGGTGGGCAGTGATAATACGG + Intronic
1026234796 7:68517720-68517742 CAGATTGAGCAAAGGTACTCTGG - Intergenic
1026467899 7:70670456-70670478 CAGAGTGAGGAAAGGAAATTGGG + Intronic
1031232909 7:119133553-119133575 CAGGGTGAGCACTGGGAAAAGGG - Intergenic
1032777878 7:135133875-135133897 CAGACTCAGCAATTATAATAAGG + Intronic
1032968263 7:137128552-137128574 CAGAGTGAGCATGGTTAATGTGG + Intergenic
1033562633 7:142547030-142547052 CAGATTGACTAATGATAATATGG + Intergenic
1033579280 7:142716826-142716848 CAGAGAGAGAAATGGTATTCTGG - Intergenic
1034601979 7:152267405-152267427 CAGAGTGAACAGTGATACTAAGG - Intronic
1035440662 7:158895410-158895432 AAAAGGGAGCAATGGCAATACGG - Intronic
1036170290 8:6477255-6477277 CAAAGTGAGAAAGGGTAAGAAGG - Intronic
1036927498 8:12921343-12921365 GAGAGGGAGCAGTGATAATAAGG - Intergenic
1039066172 8:33610141-33610163 CAGAATGAAAAATGGTAAAAAGG - Intergenic
1045151006 8:99408044-99408066 CAGAGAGAGCACTGGGAAGAGGG + Intronic
1046578935 8:116067797-116067819 CAGAATGAACAATGTTAATTGGG + Intergenic
1047644921 8:126860484-126860506 AAGAGTGGACAATGGAAATATGG - Intergenic
1048003926 8:130402854-130402876 CAGAGGGAGAAATGGTGATGAGG - Intronic
1048745147 8:137606242-137606264 CACAGGGAACAATGGTGATAAGG - Intergenic
1053442931 9:38130752-38130774 CAGAGTGAGCAGTGGAATGAAGG + Intergenic
1055777964 9:79786806-79786828 CAGAGGGATCAATTGAAATATGG + Intergenic
1056772099 9:89485291-89485313 AAGAGTGACCAATGTTACTATGG + Intronic
1059725259 9:117002446-117002468 CAGAGTAAGCAATGGAAAGAGGG + Intronic
1186860302 X:13666395-13666417 CACAGTGAGCAAGGGGAACAAGG + Intronic
1187541315 X:20198537-20198559 CTGAGGGAGCAAAGATAATATGG + Intronic
1188248781 X:27865749-27865771 CAGACTGAGTAATGTCAATAGGG - Intergenic
1188605614 X:32025416-32025438 ACTACTGAGCAATGGTAATATGG - Intronic
1194980593 X:100436320-100436342 CACAGTGACCAATGGAAATGGGG + Intergenic
1195955952 X:110330804-110330826 CACAGTAGGCAAAGGTAATATGG - Intronic
1197970169 X:132107279-132107301 CAGAGTCAGCATTGGAAACAGGG - Intronic
1200406210 Y:2814022-2814044 CAGAGTTAGCCATGGTATCATGG + Intergenic