ID: 1096995600

View in Genome Browser
Species Human (GRCh38)
Location 12:55836089-55836111
Sequence CAGAGGGGGAAGAGTTAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 590
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 532}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096995600_1096995603 -8 Left 1096995600 12:55836089-55836111 CCATTCTAACTCTTCCCCCTCTG 0: 1
1: 0
2: 3
3: 54
4: 532
Right 1096995603 12:55836104-55836126 CCCCTCTGACTCTCCTGCGCAGG 0: 1
1: 0
2: 2
3: 14
4: 178
1096995600_1096995607 4 Left 1096995600 12:55836089-55836111 CCATTCTAACTCTTCCCCCTCTG 0: 1
1: 0
2: 3
3: 54
4: 532
Right 1096995607 12:55836116-55836138 TCCTGCGCAGGGTCTGTTCCTGG 0: 1
1: 0
2: 1
3: 22
4: 243
1096995600_1096995605 -7 Left 1096995600 12:55836089-55836111 CCATTCTAACTCTTCCCCCTCTG 0: 1
1: 0
2: 3
3: 54
4: 532
Right 1096995605 12:55836105-55836127 CCCTCTGACTCTCCTGCGCAGGG 0: 1
1: 0
2: 2
3: 14
4: 152
1096995600_1096995610 23 Left 1096995600 12:55836089-55836111 CCATTCTAACTCTTCCCCCTCTG 0: 1
1: 0
2: 3
3: 54
4: 532
Right 1096995610 12:55836135-55836157 CTGGTTTCCCAGATGCATAAAGG 0: 1
1: 0
2: 1
3: 12
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096995600 Original CRISPR CAGAGGGGGAAGAGTTAGAA TGG (reversed) Intronic
900491471 1:2951416-2951438 GAGAGGAGGAAGAGTAAGCAGGG + Intergenic
901156986 1:7146687-7146709 CAGAGGGGGTAGGGAGAGAAGGG + Intronic
901296820 1:8167229-8167251 CAGAGGGGGAGGAGGAACAATGG + Intergenic
901892887 1:12283217-12283239 CTGAGGGGCAAGACTGAGAAAGG - Exonic
902247061 1:15127970-15127992 CAGAGAAGGAAGAGATGGAAGGG - Intergenic
903524474 1:23982652-23982674 AATAGGGTGAAGATTTAGAATGG + Intergenic
903845718 1:26278957-26278979 CAGAGGTGGCAGAGATAGATAGG - Intronic
905143811 1:35870738-35870760 CAGAGGGGAAAGAATGGGAATGG - Intronic
906057398 1:42927824-42927846 GAGAGGGGGAAAAGTTAGACTGG + Intronic
906238017 1:44223383-44223405 AAGAGGGGGAAGGGTTAGGATGG + Intronic
907261648 1:53222672-53222694 AAGAGAGGAAAGAGTTAAAAAGG + Intergenic
907636291 1:56137649-56137671 GACAGGGGGAAAAGATAGAATGG - Intergenic
907726222 1:57023212-57023234 CAGAGGTGGAAGAGTGGAAATGG + Intronic
907878749 1:58522923-58522945 CAGGGGTGGCAGAGGTAGAACGG + Intronic
908145170 1:61234021-61234043 CAGAAGGGGAAGTGAGAGAATGG + Intronic
908284144 1:62575283-62575305 CAGAGGCAGAAGAGGTGGAAGGG - Intronic
909477200 1:76094281-76094303 CCCTGGGGGAAGTGTTAGAAAGG + Intronic
911100303 1:94090485-94090507 CAGTAGGGGTAGAGTGAGAATGG - Intronic
911721081 1:101191883-101191905 CAGAGGGAGAAGAGGAAGAGAGG + Intergenic
912243810 1:107939878-107939900 CAGAGGAGGAAGAGTAAGACAGG + Intronic
912455595 1:109794716-109794738 CTGATGGGGAAGAGGAAGAAAGG + Intergenic
912520836 1:110243621-110243643 AAGAGGAGGAAGAGGGAGAAGGG + Intronic
912581656 1:110726324-110726346 CAGAGAGATAAGAGTGAGAAAGG + Intergenic
912984572 1:114414528-114414550 AAGCGGGGTAAGAGTTAGTAGGG - Intronic
913164822 1:116175386-116175408 CAGAGGGGATAAAGTCAGAATGG + Intergenic
913647231 1:120869937-120869959 CAGAGGTGGAAGAGGGTGAAGGG - Intergenic
914079411 1:144392925-144392947 CAGAGGTGGAAGAGGGTGAAGGG + Intergenic
914099768 1:144573577-144573599 CAGAGGTGGAAGAGGGTGAAGGG - Intergenic
914174310 1:145261471-145261493 CAGAGGTGGAAGAGGGTGAAGGG + Intergenic
914299221 1:146364104-146364126 CAGAGGTGGAAGAGGGTGAAGGG + Intergenic
914528977 1:148502655-148502677 CAGAGGTGGAAGAGGGTGAAGGG + Intergenic
914637414 1:149564453-149564475 CAGAGGTGGAAGAGGGTGAAGGG - Intergenic
916264041 1:162871843-162871865 CTTGGGGGGAAGAGTGAGAAGGG + Intergenic
916865421 1:168851248-168851270 TAGAGCAGGAAGAGTTAAAATGG + Intergenic
916991404 1:170249536-170249558 CTCAGTGGGAGGAGTTAGAAAGG - Intergenic
918214819 1:182384338-182384360 GAGAGGGGGAAGAGTTGGAGTGG + Exonic
919261056 1:195194642-195194664 AAGAAGGAGAAGAGATAGAATGG - Intergenic
919984524 1:202663652-202663674 GTGAGGGGGAAGAGGTAAAAGGG - Intronic
920684748 1:208100977-208100999 AAGAGGGGGAGGAGTTTGGAGGG - Intronic
920877166 1:209847605-209847627 CGGAGGGGAAAGAGCTATAATGG - Intronic
921641101 1:217555708-217555730 CAGAGGAGGAAAAGTTGGAAAGG - Intronic
922949022 1:229542674-229542696 CAGAGTGGGAAGAGACAGGATGG + Intronic
923161272 1:231316917-231316939 CAGAGGTGGAAGAGATGGAGGGG - Intergenic
923874317 1:238030973-238030995 CAGATGGGAAAGAGAGAGAAAGG + Intergenic
923993481 1:239465851-239465873 AAGAGGTGGAAGAGGTAGACAGG - Intronic
1063010794 10:2020075-2020097 CAGGTGGGGCAGAGCTAGAAGGG - Intergenic
1063051649 10:2455876-2455898 CAGAGGTGGAAGAGGTAGAGGGG + Intergenic
1063262044 10:4400611-4400633 CAGAGGGGCATGAGATGGAAGGG - Intergenic
1063521832 10:6748322-6748344 CAGAGTGGAAAGAATAAGAAAGG - Intergenic
1063887363 10:10593298-10593320 CAGAGATGGAAGATCTAGAACGG + Intergenic
1064006086 10:11700241-11700263 CAGAGGGGAGAAAGTTAAAATGG + Intergenic
1064521663 10:16209443-16209465 TTGAGAGGGAAGAGTGAGAAGGG - Intergenic
1065793025 10:29279022-29279044 CAGAGGTGGAGGAGGTAGAAGGG - Intergenic
1065852452 10:29802011-29802033 CAGAGGGGGAAGATTCTGGAAGG + Intergenic
1066129751 10:32381355-32381377 CAGAGGTGGAGGAGGTGGAAGGG + Intergenic
1066317162 10:34259480-34259502 CAGAAGGGGCAGAGTCAGGAAGG - Intronic
1067825332 10:49568030-49568052 AAGAGGTGGAGGAGGTAGAAGGG + Intergenic
1067837453 10:49650493-49650515 CAGATGGGGAAGAGGCAGAAAGG + Intronic
1068105470 10:52609547-52609569 CAGAGAGAGAAGAGTTGTAATGG - Intergenic
1068720419 10:60239181-60239203 CATAAGGAGAAGAGATAGAATGG + Intronic
1069135340 10:64756819-64756841 CAGAAGGGGAAGAGGAAGCAAGG + Intergenic
1072061308 10:91813581-91813603 CAGTGGGGAAAGGGTTAAAAAGG + Intronic
1072158851 10:92747943-92747965 CAGAGGGAGAAGAGGGGGAAGGG - Intergenic
1073175828 10:101556928-101556950 AAGAAGGGGAAGGGTTAGGAGGG - Exonic
1073441287 10:103554178-103554200 CAGAGGGGGAAGAGGGAGGCTGG - Intronic
1073622378 10:105062618-105062640 CAGAAGGGTAAGAGGCAGAAGGG + Intronic
1074507914 10:114087579-114087601 CAGAGGGGCCAGAGACAGAAGGG + Intergenic
1074833828 10:117269960-117269982 CAGAAGGGGAAGAGCTGGCAGGG + Intronic
1074878780 10:117635079-117635101 AAGAGGGTGAACATTTAGAAAGG - Intergenic
1075617496 10:123902276-123902298 TAGCGTGGGAAGAGTCAGAATGG - Intronic
1076020348 10:127067150-127067172 GGGAGGGAGGAGAGTTAGAAGGG + Intronic
1076210760 10:128642814-128642836 CAAAGCTGGAAGAGTCAGAAAGG + Intergenic
1076680258 10:132168066-132168088 CCGTGGAGGAAGAGTGAGAAGGG + Exonic
1076838343 10:133032422-133032444 CAGAGGGGCAAGAGCTAGCCGGG + Intergenic
1078270415 11:9789431-9789453 CAGGGGAGGAAGAGTATGAATGG + Intronic
1078280688 11:9898058-9898080 AACAGGAGGAAGAGTCAGAAGGG + Intronic
1078686492 11:13537037-13537059 CAGAGGTGGAACAGTTTGGAGGG + Intergenic
1079452262 11:20607172-20607194 CAGAGGGGACAGAGTAAGAAAGG - Intronic
1079688999 11:23399383-23399405 CAGTGGTGGCAGAGTGAGAATGG + Intergenic
1079807188 11:24947369-24947391 AAGAGGAGGAAGAGGTAGAAAGG + Intronic
1081469284 11:43354852-43354874 AAGAGGGGGAAGAGCTGGCATGG - Intergenic
1081637899 11:44733012-44733034 CAGATGGGGAAGAGGGAGAAGGG + Intronic
1081744048 11:45460658-45460680 CAGAGGAGCAAGAGATAGAGTGG - Intergenic
1081985916 11:47304123-47304145 CAGAGGGAAAAAAGTTAGAATGG - Intronic
1082697668 11:56389368-56389390 CAAAGGAGGAAGAGTAAGACAGG + Intergenic
1085070273 11:73537492-73537514 CAGAGGAGGCAGAGTGAGAGTGG + Intronic
1085531926 11:77197081-77197103 CAGACGGGGAAGAGAGGGAATGG - Intronic
1085659257 11:78348159-78348181 CAGAAGCAGAAGAGGTAGAAGGG + Intronic
1086249260 11:84794796-84794818 CAGAGGGGGCTGAGTCAGCAGGG - Intronic
1087449407 11:98299413-98299435 AAAAGGGGGAAGAGTGGGAATGG - Intergenic
1089045006 11:115493293-115493315 AAGAGGGGGAAGAGTAGGGAAGG + Intronic
1089093901 11:115902064-115902086 CATAGGGTGCAGACTTAGAAAGG + Intergenic
1089960469 11:122613377-122613399 GAGAGGGGGAAGAGTTGCAGTGG + Intergenic
1090047348 11:123347572-123347594 CAGGGAGGGAAGGGGTAGAAGGG - Intergenic
1090899614 11:131016628-131016650 AAGAGGTGGAAGAGGTAGAAGGG + Intergenic
1091189062 11:133674710-133674732 TAGAAGGGGAAGAGGTAGACTGG - Intergenic
1093081876 12:14821889-14821911 TAGAGTGGGAAGAGTGAAAAGGG + Intronic
1093104168 12:15065917-15065939 CTGAGGGAGCAGAGTTAGACAGG + Intergenic
1093409525 12:18847655-18847677 CAGTGGGAGAAGAGATAGAAAGG + Intergenic
1093419053 12:18953572-18953594 GAGAGGGGGAATAGTTGGCAGGG - Intergenic
1094096091 12:26706525-26706547 CACATGGGGAAGAGGGAGAAAGG - Intronic
1094148994 12:27261169-27261191 GAGAGGTGGAAGGGTTAGCAAGG + Intronic
1094246723 12:28305577-28305599 CAGAGAGGGAACAGGTTGAAAGG - Intronic
1095512230 12:42964933-42964955 CAGAGAGGCAAGAGGTAGAAAGG - Intergenic
1096194015 12:49637391-49637413 CTGAGGGGGAAGAGAGGGAATGG - Exonic
1096811429 12:54172898-54172920 CAGACTGGGAACAGCTAGAAAGG - Intronic
1096995600 12:55836089-55836111 CAGAGGGGGAAGAGTTAGAATGG - Intronic
1097891147 12:64779159-64779181 CTTAGGGGGAAGAGATAAAAAGG + Intergenic
1098461920 12:70741737-70741759 GGGAGGGTGAAGTGTTAGAACGG + Intronic
1098596721 12:72280746-72280768 CAGAGACTGAAGAGTCAGAAGGG + Intronic
1099318314 12:81112016-81112038 CACACTGGGATGAGTTAGAAAGG + Intronic
1100057261 12:90527165-90527187 AGGAGGGGGAAGAGGTAGGAGGG - Intergenic
1100057267 12:90527181-90527203 AGGAGGGGGAAGAGGTAGGAGGG - Intergenic
1100169965 12:91963324-91963346 CAGAGGGAGCAGTGTCAGAATGG - Intergenic
1100178090 12:92053392-92053414 CAGAGAGGGAATAGTCAGAGAGG - Intronic
1100575089 12:95883506-95883528 AAGAGGAGGAAGAGTTAGTGAGG - Intronic
1100682777 12:96947332-96947354 CTGTGGGGGCAGATTTAGAAAGG + Intronic
1102057144 12:109905177-109905199 CTGGGGTGGAAGAGTTTGAAGGG + Intronic
1102193956 12:111011141-111011163 CAGAAAGGGAAAAGTTAGACTGG - Intergenic
1102403997 12:112656565-112656587 AAAAGGGGGAAGAGTGGGAAGGG - Intronic
1103486719 12:121288129-121288151 CAGTGGGGGAAGAGGAAGGAAGG - Intronic
1103882169 12:124174652-124174674 CAGAGGAGGATGTGTAAGAATGG + Intronic
1104753354 12:131253852-131253874 CAGAAGGGGAAGAGGAAGCAAGG - Intergenic
1105251319 13:18700771-18700793 CAGAGGGTGAAGACTTAGGGAGG - Intergenic
1105632401 13:22183395-22183417 CTTGGGGGGAAGAGTTGGAAGGG - Intergenic
1105839876 13:24244881-24244903 CAGAGAAGCAAGAGTTAAAAGGG + Intronic
1105846660 13:24299601-24299623 CAGAGTGGGCAGAGGTAGAGAGG + Intronic
1108467378 13:50730196-50730218 CAGAGCTGGAAGAGGTGGAAGGG + Intronic
1108504222 13:51096223-51096245 CAGAGGGGCAAAAGTGAGGAGGG - Intergenic
1108781128 13:53835524-53835546 CAGAGGTGGAGGAGGTGGAAGGG - Intergenic
1108908708 13:55514584-55514606 AAGAGGTGGAAGAGGTGGAAGGG + Intergenic
1109002176 13:56819101-56819123 CAGAAGGGGGAGAGTTGGAAGGG + Intergenic
1109238868 13:59858300-59858322 CAGCTGGGGAAGAGCTAGATGGG + Intronic
1109759722 13:66812068-66812090 CTTAGGGGGAAGAGTGGGAAGGG - Intronic
1110649508 13:77926660-77926682 CAGAGGTGGAAGAGTTTAGAGGG - Intergenic
1110810593 13:79807659-79807681 CAGAGGGGGCTGAGGTAGCAGGG - Intergenic
1110935264 13:81279708-81279730 CAGAGGTGAAAGAGGTGGAAGGG - Intergenic
1111253644 13:85638909-85638931 CAGAGGGGGATGAGGCAGCAGGG + Intergenic
1111929341 13:94497740-94497762 CAGAGGTGGAAGAGGTAGAGGGG + Intergenic
1112067323 13:95807329-95807351 AAGAGGTGGAGGAGGTAGAAGGG + Intronic
1113088403 13:106592179-106592201 AAGAGGTGGAGGAGGTAGAAGGG - Intergenic
1113815055 13:113163755-113163777 AAGAGGGAGAAGATTAAGAAAGG - Intronic
1114672537 14:24419125-24419147 GAGAGGAGGAAGAGAAAGAATGG - Exonic
1114722244 14:24894859-24894881 AATAAGGAGAAGAGTTAGAATGG - Intronic
1114890564 14:26917171-26917193 AAGAGAGGAAAGAGTAAGAAAGG + Intergenic
1115004414 14:28464569-28464591 AAAAGGTGGAAGAGTGAGAAGGG - Intergenic
1115277321 14:31622836-31622858 CAGAGGGGGATATGTTAGATTGG + Intronic
1115440117 14:33424717-33424739 AGGAGGGGGAAGTGTTAGAAGGG + Intronic
1115831523 14:37348057-37348079 CAGAGGGGGAAGAGCCAGAAAGG - Intronic
1116129735 14:40839686-40839708 CAGAAGTGGAGGAGTTGGAAGGG - Intergenic
1117225023 14:53648350-53648372 CAGAAGGAGAAGAGAGAGAATGG + Intergenic
1117747785 14:58888820-58888842 CAGAGAATGAAGAGTTTGAAAGG - Intergenic
1118682769 14:68260332-68260354 CAGCGGGGGTAGAGATAGTAGGG + Intronic
1119434739 14:74590839-74590861 CAGAAGGGAAAGAGTGGGAAGGG + Intronic
1119679911 14:76584601-76584623 CAGAGGGGGAAGAGGTGGAGGGG + Intergenic
1120645288 14:87067032-87067054 CAGAGGCAGAAGAGTGATAAAGG - Intergenic
1120679187 14:87459378-87459400 CAGAGGTGGAAAAGAAAGAAAGG - Intergenic
1121187025 14:91982456-91982478 CAGAGGGGGAAAAGGGAGAGGGG + Intronic
1123113836 14:105885011-105885033 CAGGCGGGGAAGATTCAGAAAGG - Intergenic
1123116063 14:105894646-105894668 CAGGCGGGGAAGATTCAGAAAGG - Intergenic
1124605914 15:31170349-31170371 CAGATGGGGAAGAGCTAGGTTGG + Intergenic
1125496010 15:40194710-40194732 CTGAGGGGGAAGAATCAGAGTGG - Intronic
1125716825 15:41824095-41824117 CAGAGAGGGGAGAGTAAGGATGG - Intronic
1126747696 15:51843136-51843158 CAGAGTTGGAAGAGCTAGAAAGG + Intronic
1126791538 15:52226124-52226146 GACAGGGGGAAGACTGAGAAAGG + Intronic
1127400653 15:58582161-58582183 AAGAAGGGGAAGAGGAAGAAAGG + Intergenic
1127818139 15:62630890-62630912 GAGAGGGGGAGGAGTGTGAAGGG + Intronic
1127830640 15:62747988-62748010 CAGAGGTGGAAGAGGTGGAAGGG + Intronic
1128368845 15:67024357-67024379 CAGAGGGGCCAGAGTTTTAAAGG + Intergenic
1128570913 15:68732065-68732087 CGGTGGGGGATAAGTTAGAATGG - Intergenic
1128992703 15:72273741-72273763 AAAAGGGGAAGGAGTTAGAAAGG - Intronic
1129623235 15:77168946-77168968 CAGGGGTGGTAGATTTAGAAAGG + Intronic
1129712570 15:77827997-77828019 CTGAAGGAGAAGAGTTGGAAGGG - Intergenic
1129917761 15:79289430-79289452 CTGAAGGGGAAGAGTTAAAATGG + Intergenic
1129923941 15:79345294-79345316 CAGAGGGTGAAGGGTGGGAAGGG - Intronic
1130156501 15:81355045-81355067 GAGTGGGGGAGGAGTTGGAAAGG - Intronic
1130617229 15:85422362-85422384 AAGATGAGGAAGAGTTAGCAGGG + Intronic
1131135526 15:89931953-89931975 CAAAGGTGGAAGAGGTGGAAGGG + Intergenic
1131529522 15:93179838-93179860 CAGACAGGGAAGAGGGAGAAAGG + Intergenic
1132020732 15:98359734-98359756 AAGAGGTGGAAGAGTTGGAAGGG + Intergenic
1132333197 15:101026550-101026572 CAGAGGGCCAAGAGTTTGGAGGG + Intronic
1133546594 16:6813705-6813727 CAGAGGGAGAAGATTTTGATAGG - Intronic
1133575751 16:7087524-7087546 AAGAAGGGCAAGAGTTAGGAAGG + Intronic
1134372837 16:13641434-13641456 CAGAAGGGGAAGGGGAAGAAAGG - Intergenic
1134601382 16:15536353-15536375 CAGAGGGGAAACAGGTAGAGGGG - Intronic
1134649594 16:15898184-15898206 AGGAGGGGGAGGAGATAGAAGGG - Intergenic
1134805378 16:17119756-17119778 CAGAGGGGGCAGAGCCAGCATGG + Intronic
1135120631 16:19763388-19763410 CAGAGGTGGCAGAGGTGGAAGGG + Intronic
1135625134 16:23988439-23988461 GAGAGGAGGAAGAGAGAGAAAGG - Intronic
1135700563 16:24628478-24628500 CAGAGGTGGAGAAGGTAGAAAGG - Intergenic
1135932213 16:26747718-26747740 CAGAGGGGAGAGAGAGAGAAAGG - Intergenic
1137342863 16:47627140-47627162 CAGAGCAGGAAGAGGCAGAAAGG - Intronic
1137774224 16:51042066-51042088 CAGAGAGGAAAGAGCTAGAAGGG + Intergenic
1137949993 16:52774536-52774558 AGGATGGGCAAGAGTTAGAAAGG - Intergenic
1138070635 16:53989776-53989798 CAGAGGCAGAAGAGGTGGAAGGG - Intronic
1138443066 16:57046694-57046716 CAGAGGGGGCAGAGCTGGCAGGG + Intronic
1138542208 16:57695251-57695273 GAGATGGGGAAGTGCTAGAAGGG - Intronic
1138956195 16:61973140-61973162 CAGAGTCAGAAGAGGTAGAAGGG - Intronic
1140638437 16:76943857-76943879 CAGAGGGGGAGAAGGAAGAAAGG - Intergenic
1140938336 16:79697012-79697034 CACTGGGGAAAGAGTTACAAAGG - Intergenic
1141651111 16:85393774-85393796 CAGTGGGGGAATAGATAGAGGGG - Intergenic
1142320282 16:89377845-89377867 CGGGGGTGGAAGAGGTAGAAGGG - Intronic
1142519446 17:494617-494639 CAGAGCTGGAAAAGGTAGAATGG - Intergenic
1144153611 17:12475556-12475578 TAGAAGGGGGAGAGTTGGAAGGG + Intergenic
1144387961 17:14767338-14767360 GAGAGGGGGCAGGGATAGAAAGG + Intergenic
1144507949 17:15849336-15849358 GAGAGGAGGAAGAGGTAGAGAGG - Intergenic
1145172073 17:20666968-20666990 GAGAGGAGGAAGAGGTAGAGAGG - Intergenic
1146284930 17:31567950-31567972 AAGAGGGGCAAGAGACAGAAGGG + Intergenic
1147836360 17:43334873-43334895 CAAAGGGGGAAGAGTAAGGAGGG + Intergenic
1148794665 17:50191246-50191268 CAGAGGGGAAAGGGGAAGAAGGG + Intronic
1150892380 17:69167928-69167950 AAGAGGTGGAAGAGGTGGAAGGG - Intronic
1151828219 17:76535417-76535439 CAGTGGGGGAAGGGGAAGAAAGG - Intronic
1152774406 17:82191531-82191553 CAGAGGTGGAGGAGGTGGAAGGG - Intronic
1154437618 18:14359187-14359209 CAGAGGGTGAAGACTTAGGGAGG + Intergenic
1155021550 18:21901399-21901421 TGGATGGGGAAGATTTAGAAAGG - Intergenic
1155081173 18:22411354-22411376 CAAAGGGGGAAAATCTAGAATGG - Intergenic
1155178743 18:23324731-23324753 CAGGGGAGGAAGAGTGGGAAGGG + Intronic
1155318449 18:24595120-24595142 AAGAGGGGGAAGATGAAGAAAGG + Intergenic
1155394539 18:25373050-25373072 CAGAAGGGAAAGATTGAGAAAGG - Intergenic
1155691909 18:28635016-28635038 CAGAGGGGGCATAGTGAGGAGGG + Intergenic
1155900892 18:31388896-31388918 CACGGGGTGAAGATTTAGAAAGG + Exonic
1156184100 18:34641438-34641460 CAGAGGGGGAAGGTTTAGCCTGG - Intronic
1156498641 18:37543009-37543031 CAGAGATTGAAGAGTTAAAATGG - Intronic
1157174205 18:45436400-45436422 CACAGAGGGAAGAGCTGGAAAGG + Intronic
1157398783 18:47368278-47368300 CAGAGATGGAGGAGGTAGAAGGG + Intergenic
1158198136 18:54910739-54910761 CAGAGGGGGTTGAGGCAGAAGGG + Intronic
1159441195 18:68483108-68483130 AGCAGGGGGAAGAGATAGAAAGG + Intergenic
1160331892 18:78001272-78001294 CAGAAGGGGAAGGGTGAAAAGGG - Intergenic
1161145923 19:2678031-2678053 CACAGGTGGCAGGGTTAGAAAGG - Intronic
1162941580 19:14013374-14013396 CAGTGGGGGAAGGGTGGGAAGGG + Intergenic
1163163901 19:15482277-15482299 CAGAGGTGGAAGAGGAGGAAGGG - Intronic
1164893475 19:31846253-31846275 AAGAGGTGGAGGAGGTAGAAAGG + Intergenic
1166328889 19:42067511-42067533 CAGAGTGGGAGGAGTGTGAAGGG + Intronic
1166349031 19:42185609-42185631 CAGGGGGACAAGAGTGAGAAGGG - Intronic
1167007715 19:46786739-46786761 CAGAAGAGGACCAGTTAGAAAGG - Intronic
1167019745 19:46864127-46864149 CTGATTGGGTAGAGTTAGAAAGG + Intergenic
1167692902 19:50997885-50997907 CTGAGGGGGAAGAGGTTGTAAGG + Intronic
1167792780 19:51691459-51691481 AAGAGGGGGAAGGGGGAGAAGGG + Intergenic
925480189 2:4261879-4261901 AAGAAGGGAAAGAGGTAGAAAGG + Intergenic
925705918 2:6684705-6684727 TGGAGGGGCAAGAGTGAGAATGG + Intergenic
925748254 2:7063370-7063392 TACAGGAGGAAGAGTTAGATGGG + Intronic
926499065 2:13630138-13630160 CAGAGGTGGCAGAGATACAAAGG - Intergenic
926574582 2:14566256-14566278 GAGAGGGGGCACAGTTTGAAAGG - Intergenic
926978704 2:18542714-18542736 CAGATGTTGAAGAGTTAAAACGG + Intergenic
927291706 2:21410973-21410995 CAGAGGGAGAAGCTTTAAAATGG - Intergenic
927359484 2:22215946-22215968 GAGAGGGGGAAAAGGGAGAACGG + Intergenic
927754271 2:25696307-25696329 CATAGGGGCAAAGGTTAGAAGGG + Intergenic
929161413 2:38836275-38836297 CAGAGGTGGAAGAAGTGGAAGGG - Intronic
930073456 2:47388014-47388036 AAGAGGTGGAGGAGGTAGAAGGG + Intergenic
930299025 2:49592418-49592440 CAGAGGGGGAAGAGTAGGAGGGG + Intergenic
930522328 2:52482974-52482996 CGGAGGAGGCAGAGTTAGATTGG - Intergenic
930635620 2:53802534-53802556 CTGTGTGGGAAGAATTAGAAAGG - Intronic
930867029 2:56131792-56131814 CAGAGGAGGAATTGTCAGAAAGG + Intergenic
931320398 2:61170319-61170341 AAGAGGTGGAGGAGGTAGAAGGG - Intergenic
931460588 2:62447180-62447202 CAGATGGGGAAGGGTTAAGAAGG + Intergenic
931634377 2:64328395-64328417 CAGAGGGGAAAGAAACAGAAGGG + Intergenic
932408425 2:71529632-71529654 CAAAGTGGGAAGATTTATAAGGG - Intronic
933097745 2:78209118-78209140 CAAAGGGAGAAGAGTTGGAAGGG + Intergenic
933190431 2:79328034-79328056 GAAAGAGAGAAGAGTTAGAAGGG + Intronic
933367598 2:81373616-81373638 AAGAGGGTGAAGAATGAGAATGG + Intergenic
933830674 2:86205440-86205462 AAGAGGTGGAGGAGTTAGAAGGG + Intronic
933876486 2:86625228-86625250 TAGTGGGGGAGGAGTTGGAAGGG + Intronic
934096982 2:88615748-88615770 CAGAGGGGCAAGAAGTAGATTGG - Intronic
935540312 2:104340582-104340604 CGGAGGGGAAAGAGTGAGGAAGG - Intergenic
935975132 2:108570709-108570731 AAGAGCGGGAGGAGTTAGCAAGG + Intronic
936496555 2:113027263-113027285 AAGAGGTGGAGGAGTTAGAGGGG + Intronic
936638411 2:114285306-114285328 GATAGGGGAAAGAGTTAGACAGG - Intergenic
936690656 2:114884518-114884540 CAGAGGAGTAAGAGTCAGATTGG - Intronic
937521093 2:122712820-122712842 CAGAGGGGGGCGTGTTAGCAAGG - Intergenic
937670095 2:124529581-124529603 AAGAGAGGCAGGAGTTAGAAGGG + Intronic
938388250 2:130883051-130883073 CATAGGGGTTAGAGGTAGAAAGG - Intronic
938746977 2:134288819-134288841 GAGAGGGAGAAGAGTGGGAAGGG - Intronic
938943445 2:136189279-136189301 CAGGGGAGGAAGATTTTGAAAGG - Intergenic
939566445 2:143791267-143791289 AAGAGGGGGAAGTGTTATATGGG - Intergenic
939903521 2:147880890-147880912 CAGGGGTGGAAGGGCTAGAAAGG + Intronic
939911096 2:147984190-147984212 AAGAGGTGGAGGAGGTAGAAGGG - Intronic
941144334 2:161824882-161824904 CAGAGGCAGAAAAGGTAGAAGGG - Intronic
941234117 2:162947673-162947695 TAGAAGGGGAAGAGATAGAGTGG + Intergenic
943638607 2:190334197-190334219 CAGGTGTGGAAGAGATAGAATGG + Intronic
944376120 2:199044165-199044187 GAGAGGAGGAAGAGGAAGAAGGG - Intergenic
944403748 2:199358851-199358873 CAGAGGGTGGAGACTAAGAAAGG - Intronic
945945800 2:215994567-215994589 AAGAGGGAGAAGAGGGAGAAGGG + Intronic
946137530 2:217659904-217659926 CTGAGGGGGAGGAGGTGGAATGG + Intronic
947263575 2:228251963-228251985 CAGTGGGGGAAGAGGTGGTAAGG + Intergenic
947480503 2:230495171-230495193 AACAGGAGGAAGTGTTAGAAAGG + Intronic
947557088 2:231102708-231102730 AAGAGGTGGAGGAGGTAGAAGGG + Intronic
948031998 2:234826489-234826511 CAGAGTGGGAGGAGGTGGAAAGG - Intergenic
948164345 2:235849939-235849961 CTGAGAGGGAAAAGTGAGAAAGG - Intronic
948294860 2:236853103-236853125 CAGAAAGGGAAGAGTTGGACTGG - Intergenic
948308784 2:236969631-236969653 CAGAGGGGCAGGCTTTAGAAAGG - Intergenic
1168744832 20:229922-229944 CAGAGGGGGTAGAGCTAGGGAGG + Intergenic
1171242178 20:23580511-23580533 CTTGGGGGGAAGAGTGAGAAGGG - Intergenic
1171305216 20:24099489-24099511 CAGTGAGGGAAGAGTAAGGAGGG - Intergenic
1171935246 20:31268938-31268960 CTTAAGGGGAAGAGTGAGAAGGG + Intergenic
1172477625 20:35250743-35250765 AGCAGGGGGAAGAGTGAGAAGGG + Intronic
1173190325 20:40871025-40871047 CAAAGGGGGAAGAGTTAATGGGG - Intergenic
1173390319 20:42626355-42626377 TAGAGTGGTAAGTGTTAGAATGG - Intronic
1173402739 20:42739552-42739574 AAGATGGGGAAGTGTTAGACAGG + Intronic
1174627607 20:51928220-51928242 GAGAGAGGGAAGAGGGAGAAAGG + Intergenic
1174641765 20:52050442-52050464 CAGAAGGAGAAGAGGAAGAAGGG - Intergenic
1175076458 20:56378866-56378888 CAGAGATGGAAGGGTTGGAAGGG + Intronic
1175315900 20:58046483-58046505 CAGAGGTGGCAGAGATAGGATGG + Intergenic
1175717631 20:61266005-61266027 CAAACGAGGAAGAGTTAGAAGGG - Intronic
1176836838 21:13800655-13800677 CAGAGGGTGAAGACTTAGGGAGG - Intergenic
1176899169 21:14418805-14418827 CAGAGGGAGAAGAGAGAGAGAGG + Intergenic
1177173947 21:17683607-17683629 CTTAGGGGGAAGAGTGAGAGGGG - Intergenic
1177330665 21:19656796-19656818 CACAGAGAGAAGATTTAGAAAGG + Intergenic
1177460034 21:21397463-21397485 CAGAGGGGGTTGAGGTAGCAGGG + Intronic
1177567106 21:22838175-22838197 CAGAGGGGGAAGGGAAGGAAGGG + Intergenic
1177877929 21:26657421-26657443 CAGAGGTGGAGGAGGTAGAAGGG - Intergenic
1178130218 21:29563808-29563830 CAGAGGAGGAAGTTTTAGTACGG + Intronic
1179168327 21:38952810-38952832 CTGAGTGGGAAGATTTGGAAGGG - Intergenic
1179535966 21:42052353-42052375 CTTAGGGGGAAGAGTTGGAGGGG - Intergenic
1181312644 22:21953462-21953484 CAGAGGTGGCAGTGTGAGAAAGG - Intergenic
1182103793 22:27674775-27674797 GAAAGGGGGAAGAGAGAGAAAGG - Intergenic
1182985734 22:34714388-34714410 GAGAGGGGGAAGAGTGTGACTGG - Intergenic
1183693374 22:39404141-39404163 CAGAGGAAGAAGAGTCAAAAAGG + Intronic
1183825714 22:40385302-40385324 CAGAGGGATAAGAGCTAGAAAGG + Intronic
1184450771 22:44581264-44581286 CAGAGGCGGAAGAGGCAGAGAGG + Intergenic
1184811433 22:46835633-46835655 CAGAGGGAGAAAAGAGAGAAAGG + Intronic
1185396312 22:50592116-50592138 CAGAAGGAGAAGAGATGGAATGG + Intronic
949364273 3:3263683-3263705 AAGAGGTGGAGGAGGTAGAAGGG + Intergenic
949364382 3:3264820-3264842 AAGAGGTGGAGGAGGTAGAAGGG - Intergenic
949383077 3:3467363-3467385 AAGAGGAGGAAGTGTTAGAAGGG - Intergenic
949576731 3:5345630-5345652 CAGAGGGGGAACTGGGAGAAGGG + Intergenic
950259898 3:11536130-11536152 GTGAGGGGGAGGAATTAGAAAGG + Intronic
950872648 3:16242938-16242960 GAGAGAGGGAAGAGTAAGATAGG + Intergenic
952096923 3:29964868-29964890 CAAAGGGGGAAGAGTGGGAGGGG - Intronic
952978192 3:38713997-38714019 CAGAGCGCGAAGGGTTCGAAGGG + Exonic
953419139 3:42741198-42741220 ATGAGGAGGAAGAGTTATAAAGG - Intronic
954719923 3:52552912-52552934 CAGAGGAGGAAGTGTTTGTAGGG - Intronic
955386860 3:58487392-58487414 CTGAGGGGGAAGACTTGGCAGGG + Intergenic
955790406 3:62583350-62583372 CAGAGGGGGAAGACATATTAGGG + Intronic
956809704 3:72853014-72853036 CAAAGGGGGGAGAGTGAGAGGGG - Intronic
958484478 3:94686339-94686361 CAGAAGGGGGAGAGTGGGAAGGG + Intergenic
959054930 3:101558138-101558160 CAAAGGGGTAAGAGAAAGAAAGG - Intergenic
959601351 3:108190013-108190035 CAGAGGTGGCAGAGGCAGAAGGG + Intronic
959922095 3:111879542-111879564 CAGAAGTGGAGGAGGTAGAAGGG + Intronic
960170502 3:114455035-114455057 GAGAGGGGGAAGAGAGAGAGGGG + Intronic
960360926 3:116710229-116710251 CAGAGAGGGAGTAGATAGAATGG - Intronic
960720634 3:120622072-120622094 GAGAGGGGAAAGAGAGAGAAAGG - Intergenic
961850067 3:129807632-129807654 CAGAGGGTCAAGAATCAGAATGG + Intronic
962201395 3:133403687-133403709 GAGGGGGAGAAGAGTTGGAAAGG + Intronic
962460918 3:135612009-135612031 CAGAGGTGGAACAGTTTGGAGGG + Intergenic
963001684 3:140687514-140687536 CAGAGGGGGAAGAAGGGGAAGGG + Intronic
963266710 3:143246936-143246958 CAGAGGAGGAACAGTTAGGCCGG + Intergenic
964297306 3:155247772-155247794 AAGAGGGAGAGGAGGTAGAAGGG + Intergenic
965120309 3:164546113-164546135 CAGAGTGGGGAGGGTGAGAAGGG + Intergenic
966420836 3:179732814-179732836 CAGTGGGGGAAGAGAGACAAGGG - Intronic
966908176 3:184542721-184542743 CAGAGAGGGGAGAGAGAGAAGGG + Intronic
967313709 3:188130771-188130793 CAGAGGTGAAAGAGGTGGAAGGG + Intergenic
967319325 3:188179784-188179806 AAGAGGAGGAAGAGGAAGAAAGG - Intronic
967999188 3:195191238-195191260 CAGAGGTGGAGGAGGTGGAAGGG - Intronic
970500552 4:16672470-16672492 CAGAGAGGCAAGAGTTAAATGGG + Intronic
971248759 4:24954068-24954090 CAGAAGGAGAAGAGAGAGAAAGG + Intronic
971621557 4:28860474-28860496 CAGAAGTGGAAGAGGTAGAAAGG + Intergenic
972503023 4:39695653-39695675 CAAAGGGGGACCAGTTAGAAGGG - Intergenic
972955951 4:44391370-44391392 AAGAGGTGGAGGAGGTAGAATGG - Intronic
973808064 4:54544640-54544662 CAGTGTGGGAAGAGAAAGAAGGG - Intergenic
974020529 4:56688258-56688280 GAGAGGGGGAAGAGGAAGGAAGG + Intergenic
974874426 4:67685783-67685805 CAGAAGGGCAAGAGTAAGAGAGG - Intronic
975237072 4:72011558-72011580 CACATGGGTAAGAGTAAGAAGGG - Intergenic
975603288 4:76125805-76125827 GAGAGGGAGAAGAGGGAGAAAGG + Intronic
976064020 4:81163014-81163036 CAAAGGGGGAAAAGCTTGAAAGG + Intronic
976450638 4:85186763-85186785 CAGAAGGGGAAGAGAAAGCAAGG + Intergenic
976685840 4:87813765-87813787 CTTGGGGGGAAGAGTGAGAAGGG - Intergenic
977537396 4:98270773-98270795 CAGAGGTGGAGGAGGTAAAAGGG - Intronic
978013672 4:103719089-103719111 CAGAGAGGAAAGAGGGAGAAGGG - Intronic
978570960 4:110136830-110136852 AAGTAGGGGAAGAGTGAGAAAGG + Intronic
979459721 4:120968142-120968164 TAGAGGTGGAGGAGGTAGAAGGG - Intergenic
979700244 4:123658744-123658766 CAGAGGGGGAAGGATGAGGAGGG + Intergenic
979902668 4:126243033-126243055 CAGAGTGGGAAGAAATAGACAGG - Intergenic
980209870 4:129773216-129773238 GAAAGGAGGAAGAGCTAGAATGG - Intergenic
980498537 4:133616963-133616985 GAGAGGCTAAAGAGTTAGAAAGG + Intergenic
980869021 4:138589288-138589310 CAGTGGGGAAAGAGTTAGGCTGG - Intergenic
981258892 4:142696083-142696105 CAGACGAGGAAAGGTTAGAAAGG + Intronic
982266403 4:153542224-153542246 CAGAGGAAGAGGAGTTAGAAAGG + Intronic
983147533 4:164235730-164235752 CAGAAGGGGAAGAGTGGGAGGGG + Intronic
983434920 4:167700917-167700939 CAGAGGGGCAGATGTTAGAAAGG - Intergenic
984190874 4:176604322-176604344 AAGAGGTGGAGGAGTTGGAAGGG + Intergenic
984822919 4:183898720-183898742 CAGGGAGGGAAGAGTTTTAAGGG + Intronic
985036617 4:185846811-185846833 GAGAGGGGGAAGGGGGAGAATGG + Intronic
985117358 4:186605290-186605312 AAGAGGAGGAAAAGTGAGAAGGG + Intronic
985477885 5:90141-90163 CAGAGGGGATGGAGTTAGAAAGG - Intergenic
985721926 5:1493989-1494011 CAGAGGAGGAAGAGGCAGGAAGG + Intronic
986763168 5:10898386-10898408 CAGAGGTGGAGGAGGTGGAAGGG + Intergenic
987118613 5:14745973-14745995 AAGAGGTGGCAGAGTTAGCAGGG + Intronic
987650087 5:20729883-20729905 CAGAGGAGGAAAAAGTAGAATGG - Intergenic
988770284 5:34426534-34426556 CAGAAGGTGAAGAGTAAGTAAGG + Intergenic
988880141 5:35493593-35493615 AAGAGGTGGAGGAGGTAGAAGGG + Intergenic
989141988 5:38210602-38210624 GAAAGGGGGAGGAGTGAGAAAGG + Intergenic
989181482 5:38581670-38581692 CAGAGGGAGAAGAGTAATACTGG + Intronic
989825904 5:45854365-45854387 CAAAGGAGGAAGAGAGAGAAGGG - Intergenic
990176933 5:53118482-53118504 CAGAGGGAGAAGAGGTAAACAGG - Intergenic
990327101 5:54689212-54689234 CAGATGGAGAAGAATGAGAAAGG - Intergenic
991137427 5:63198499-63198521 CAGAAGGGGGAGAGTGAGAGAGG + Intergenic
992146996 5:73860589-73860611 CAGAGTGGCAACAGTGAGAAGGG - Intronic
992697294 5:79302780-79302802 TAGAGGGAGAAGAGATGGAAAGG + Intronic
994228192 5:97279527-97279549 AAGAGAGAGAAGAGTTAAAAGGG - Intergenic
995255046 5:110036376-110036398 AAGAGGGGGAAGAGGAAGAAAGG - Intergenic
995327780 5:110911131-110911153 CAGAGGTAGAGGAGATAGAAAGG + Intergenic
995350828 5:111173481-111173503 GAGATGGGGAAGAGAAAGAAAGG + Intergenic
995472077 5:112513226-112513248 GAGATGGGGAAGAGTGGGAAAGG - Intergenic
996524092 5:124459482-124459504 CAAAGGGGAGAGTGTTAGAAGGG + Intergenic
997062936 5:130528807-130528829 GAGAGAGGGAAGAATTAGATAGG - Intergenic
997099871 5:130957330-130957352 CAGAGGGCAAAGAGTAAGCAAGG - Intergenic
997338239 5:133122678-133122700 AAGAGGGGGAGAAGATAGAAGGG - Intergenic
998172252 5:139879542-139879564 CACAGGAGCAAGAGTAAGAATGG + Intronic
998452580 5:142246183-142246205 CAGAGGGGAAAGGGGCAGAAGGG + Intergenic
998516306 5:142757677-142757699 CAGAGTGGGCAGAGGGAGAAGGG + Intergenic
999151173 5:149427204-149427226 CAGGGCAGGAAGAGTGAGAAGGG + Intergenic
999204259 5:149836872-149836894 CAGAGGAGGAAGAGGAAGAAGGG + Exonic
999470546 5:151850839-151850861 GAGAGGGGGAAGAGTTGGAGTGG - Intronic
999968517 5:156835441-156835463 CAGAGGGAGAGGGGTAAGAATGG - Intergenic
1000293283 5:159891014-159891036 CTGAGGGGATATAGTTAGAATGG - Intergenic
1000491418 5:161918874-161918896 CAGAGGGGGAAGGGTGGAAAGGG + Intergenic
1000858363 5:166428225-166428247 AAGAAGGGGAAGAGATAAAATGG + Intergenic
1000922381 5:167153502-167153524 AAGAGGGGGAGGAGGTGGAAGGG + Intergenic
1000997091 5:167970221-167970243 GAGAGGGTGATGAGTCAGAAGGG - Intronic
1001108384 5:168875185-168875207 CAGAGGGGGAAGAGAGAAAGGGG + Intronic
1001655829 5:173348742-173348764 CCCAGGTGGAAGAGATAGAAGGG - Intergenic
1003592208 6:7445826-7445848 CAGAGGGTGAAGAGTCAGAAGGG + Intergenic
1003683623 6:8279681-8279703 CAGAGAAGGAAGAGATAGAAAGG - Intergenic
1003691868 6:8362771-8362793 CAAAGGAGGAGGAGTTAGAAGGG - Intergenic
1004039421 6:11961068-11961090 CAGAGGGTGCAGGGTTAGAAAGG - Intergenic
1004520872 6:16359407-16359429 CAAAGGGGGCAGAGAGAGAATGG + Intronic
1004834186 6:19512466-19512488 AAGAGGTGGAAGAGGTGGAAGGG - Intergenic
1004918533 6:20355067-20355089 AAGAGGTGGAAGAGGTGGAAGGG - Intergenic
1005543588 6:26839333-26839355 CAGAGGAGGAAAAAGTAGAATGG + Intergenic
1006205950 6:32343043-32343065 GAGAGGGGGAAATGTGAGAAAGG + Intronic
1006670414 6:35726816-35726838 CTGTGGGGGATGAGTTGGAATGG + Intronic
1007333380 6:41132618-41132640 GAGAGAGAGAAGAGCTAGAAAGG + Intergenic
1007407479 6:41643357-41643379 CAGAGGTGCAAGAGTTACACTGG - Intronic
1007733393 6:43965437-43965459 GAGATGGGGGAGAGTTAGGAGGG - Intergenic
1007796282 6:44350537-44350559 CAGAGTGGGAGGATTTTGAAGGG + Intronic
1007984048 6:46189587-46189609 CAGAGGAGGAGGATTTGGAAAGG - Intergenic
1008200979 6:48590415-48590437 CACAGTGGGAAGGATTAGAATGG - Intergenic
1008349118 6:50468008-50468030 CAGAGAGGCAGGAGTGAGAAGGG - Intergenic
1008527150 6:52418696-52418718 TAAGGGGAGAAGAGTTAGAAAGG + Intergenic
1008876844 6:56338600-56338622 CAAAGGGAGAAGAGATAGAGAGG - Intronic
1009014415 6:57881506-57881528 CAGAGGAGGAAAAAGTAGAATGG + Intergenic
1009591318 6:65674188-65674210 TAGAAGGGGAAGAGTTAAAGAGG + Intronic
1010462062 6:76124900-76124922 AAGAGTGGGAAGAGTTAAATAGG + Intergenic
1011271969 6:85588962-85588984 CAGGGGTGAAAGAGGTAGAAGGG + Intronic
1011530497 6:88315745-88315767 CAGGGTGGGAAGAGAAAGAAGGG + Intergenic
1011566486 6:88678977-88678999 AAGAGGTGGAAGAGGTGGAAGGG - Intronic
1012314710 6:97772028-97772050 CAGAGGGGAAATAGTTCTAATGG - Intergenic
1013363327 6:109415113-109415135 GAGAGGTGGACGAGGTAGAAGGG + Intronic
1013416432 6:109929308-109929330 CAGAGGGGGAAGAGTGAAGTGGG + Intergenic
1013504421 6:110785625-110785647 CAGAGGCGGAGGAGGTAGAAGGG + Intronic
1014664292 6:124217223-124217245 GAGAGGGGGAAGAGTGAGGTAGG + Intronic
1015389508 6:132665250-132665272 AAGAGGAGGAAGAGCAAGAAAGG - Intergenic
1015452024 6:133380934-133380956 GAGAGGGAGAAGAGGAAGAAAGG - Intronic
1017014415 6:150088715-150088737 AAGAGGGGGAAGTGTCAGGATGG + Intergenic
1017813303 6:157999633-157999655 CAGAGTGGCAAGAGGTAGTAAGG + Intronic
1018244634 6:161810953-161810975 CTGATGGGGAAGAGGAAGAAAGG + Intronic
1019964095 7:4484759-4484781 GAGAGGAGGAAGAGTGAGGAGGG + Intergenic
1020193865 7:6021950-6021972 AAGAGGTGGAGGAGGTAGAAAGG - Intronic
1020942369 7:14556963-14556985 CAAAGGGGGAAAATGTAGAAAGG - Intronic
1021546869 7:21823260-21823282 CGAGGGGGGAAGAGTTAGACTGG - Intronic
1021746737 7:23748536-23748558 CAGAGAGGGAAGAAGTGGAAGGG - Intronic
1021779062 7:24084048-24084070 CTTAGGGGGAAGAGTAGGAAGGG + Intergenic
1021947241 7:25740205-25740227 CAGAGGGTGAAGAATAATAATGG - Intergenic
1022127808 7:27375113-27375135 AGGAGGGGGAAGAGAGAGAAGGG + Intergenic
1022323536 7:29309377-29309399 GGGTGGGGGAAGAGTTAGGATGG - Intronic
1022673418 7:32476881-32476903 CAGAGTGGGATGAGCTGGAAGGG - Intergenic
1022810526 7:33863575-33863597 GAGAGGGAGAACAGTAAGAAGGG + Intergenic
1023115692 7:36859889-36859911 GAGAGGTGGAAGAGGTGGAAGGG - Intronic
1023369453 7:39498544-39498566 CAGAGAGTGAAGAGAAAGAATGG - Intergenic
1023522980 7:41067415-41067437 CAGAGGGAGAAGAGTATGTATGG + Intergenic
1024792116 7:52978345-52978367 CAGGGAGGGAAGAGGAAGAATGG - Intergenic
1026176336 7:68001044-68001066 AAGAGGTGGAAGAGCTGGAAGGG + Intergenic
1026235791 7:68526154-68526176 CTTGGGGGGAAGAGTAAGAAGGG + Intergenic
1026837571 7:73648600-73648622 GAGAGGGGGGAGAGTGAAAAAGG - Intergenic
1026914259 7:74110460-74110482 CAGACAGGTAAGAGGTAGAAGGG - Intronic
1027532756 7:79355163-79355185 GAGAGGGGGAAGAATCTGAATGG - Intronic
1027560570 7:79723981-79724003 CAGAAGGGAAAAAGTCAGAATGG + Intergenic
1028086471 7:86643813-86643835 CAGAGGGAGAAGATTGATAAGGG + Intergenic
1028261211 7:88668739-88668761 CACAGAGGGAAGAGTAACAATGG + Intergenic
1028294331 7:89108816-89108838 CAAAAGGGCAAGAGTTAGAAAGG + Intronic
1028346824 7:89793536-89793558 CAGAGGGGGATGGATTAGGAAGG + Intergenic
1029452709 7:100650150-100650172 CAGAGGGGGAGGATTCAGGAAGG + Intronic
1029745241 7:102512711-102512733 GAGAGGGGGGAGAGAGAGAAGGG + Intronic
1030331969 7:108280486-108280508 CAGAATGGTAAGAGTTGGAATGG + Intronic
1031015489 7:116571299-116571321 AGGAGTGGGAAGAGTTAGACAGG + Intergenic
1031077065 7:117223079-117223101 GAGAGAGGGAAGAGTTTGGAAGG - Exonic
1031083743 7:117282368-117282390 AAGAAGGGGAAGAGGAAGAAGGG + Intronic
1031214808 7:118877127-118877149 AGGAGGGGGAAGAGGAAGAAGGG + Intergenic
1031681602 7:124681423-124681445 CAGAGGTGGAGGAGGTGGAAAGG - Intergenic
1031901730 7:127418402-127418424 CAGAGGGGAAGCAGTGAGAAAGG + Intronic
1032232066 7:130083361-130083383 CGGAGGGTAAAGAGGTAGAAAGG - Intronic
1032347211 7:131127306-131127328 CAGGTGGGAAAGAGTCAGAAAGG + Intronic
1032472297 7:132187419-132187441 CAGAGAGGGAAAGGTTAGACAGG - Intronic
1033085356 7:138336308-138336330 AAGAGGTGGAAGACATAGAAAGG - Intergenic
1033315892 7:140297237-140297259 GAGAGGTGGAAGAGTTTGGAGGG - Intronic
1033672218 7:143504165-143504187 CAGAGGTGGAAAAGGTAGACTGG + Intergenic
1034953983 7:155321957-155321979 CAGAGTGAGAAGAATTAGGAGGG + Intergenic
1036046331 8:5145337-5145359 CAGAGGGGAAATAGGAAGAAAGG - Intergenic
1036491579 8:9231119-9231141 CAGAGGAGGAAGAGAATGAAAGG + Intergenic
1036727357 8:11231707-11231729 GAGAGAAGGAAGAGTGAGAAGGG + Intergenic
1037098928 8:15018939-15018961 CAGAAGGTGAAGAGGAAGAAGGG + Intronic
1037920950 8:22805041-22805063 CAGAGTGGGGAGTGTTAGGATGG - Intronic
1038246231 8:25858977-25858999 TAGATGGGGAAGAGAGAGAAAGG - Intronic
1038249430 8:25889171-25889193 CAGAAGGGGAATAATTAAAATGG + Intronic
1039380439 8:37079935-37079957 TAGAGGCTGAAGAGTCAGAATGG + Intergenic
1039986383 8:42451645-42451667 AAGAGGAGGAAGAGATAGAGGGG + Intronic
1040013808 8:42683833-42683855 TAGAAGTGGAACAGTTAGAAGGG + Intergenic
1041213860 8:55580413-55580435 CAAAGCTGGAAGAGTCAGAACGG - Intergenic
1041300645 8:56407786-56407808 CAGAGGGGGAAGGGGTGGAGGGG + Intergenic
1042440218 8:68817441-68817463 GAGAGGGAGAAAAGTTAGAGAGG - Intronic
1043258326 8:78162735-78162757 CACAGGAGAAAGAGGTAGAATGG - Intergenic
1044226579 8:89725902-89725924 CAGTGGGGGAAGGGGCAGAATGG - Intergenic
1044404327 8:91810445-91810467 CAGAGGATGAAGAGTATGAAGGG - Intergenic
1044642690 8:94401273-94401295 AAGAGGTGGAGGAGATAGAAGGG - Intronic
1046778239 8:118186820-118186842 GAGAGAGAGAAGAGTTAAAACGG + Intergenic
1046842482 8:118875237-118875259 CAGAGGAGGAAGAGGTGGAGAGG - Intergenic
1047054885 8:121152998-121153020 CAGAGGAAGAAGAGGTAGAAGGG - Intergenic
1047298489 8:123592003-123592025 CAGAAGGGGAAGAATTAGTGTGG + Intergenic
1047322227 8:123797425-123797447 CAGAGGCAGAAGAGGTGGAAGGG - Intronic
1047338939 8:123961580-123961602 CAGAAAGGGAAGAGTAAGACAGG + Intronic
1047559881 8:125975372-125975394 GAAAGTGGAAAGAGTTAGAAAGG + Intergenic
1048658674 8:136571971-136571993 CATAGGTGGAATAGGTAGAAGGG + Intergenic
1048719716 8:137309893-137309915 CAGAGGGAGAAGTGATAGAGTGG + Intergenic
1049084273 8:140465653-140465675 CAGAGGGGAAATAGCTATAAAGG - Intergenic
1049181680 8:141226189-141226211 CAGAGGGGAAAGATGGAGAAAGG - Intronic
1050224260 9:3433245-3433267 AAGAGGCGGAGGAGGTAGAAGGG - Intronic
1050796792 9:9556352-9556374 AAGAGGTGGAGGAGGTAGAAGGG + Intronic
1050929736 9:11308165-11308187 CAGAGGAGGAAGAAGGAGAAAGG - Intergenic
1051795803 9:20868644-20868666 CAGAGTGGAAAGAGCTATAAAGG + Intronic
1053046082 9:34918341-34918363 GAGAGGGGGAAGAGTTGGAGTGG - Intergenic
1053158219 9:35794528-35794550 CAGAGGAGGAAGAGTCAGTGTGG + Intronic
1054748346 9:68878895-68878917 CAGGGGGTGAAGGGTTGGAAGGG + Intronic
1055530693 9:77179869-77179891 CAGAGGTGGAGTAGTGAGAAGGG - Intronic
1056496625 9:87161735-87161757 GAGAAGGGGAAGAGAGAGAAGGG + Intergenic
1056665251 9:88576584-88576606 GAGAAGGGGAAGAGGGAGAATGG + Intronic
1056748037 9:89321772-89321794 TTGAAGAGGAAGAGTTAGAAAGG + Intronic
1057827197 9:98380359-98380381 GAGCGGGGGAGGAGTAAGAAGGG - Intronic
1058089072 9:100783451-100783473 CAGAAGTGGAAGAGACAGAAAGG - Intergenic
1058582075 9:106469213-106469235 CAGAGGGGGAAAGGTGAGACAGG - Intergenic
1059158020 9:112006846-112006868 CAGCGGGGGGAGAGTCTGAATGG - Intergenic
1059367292 9:113796696-113796718 CAGAGGGGAATGATTCAGAATGG + Intergenic
1059499771 9:114741641-114741663 CTTAGGGGGAAGAGTGGGAAGGG + Intergenic
1059716456 9:116917681-116917703 CAGAGGAGAAAAAGTTGGAATGG + Intronic
1059843414 9:118243781-118243803 CAGAGGTGGAACAGTTTGGAGGG - Intergenic
1060452415 9:123755608-123755630 CAGAGGTGGAAGAGGTGGAAGGG - Intronic
1061083886 9:128388008-128388030 CAGAGCTGGAAGAGTTAGGGAGG - Intronic
1061281686 9:129601350-129601372 CAGAGGGGGAAGAAGGAGAGAGG + Intergenic
1061418847 9:130462419-130462441 CAGAGGGGGAAGGATTAGACTGG + Intronic
1061531605 9:131218511-131218533 CAGAGGAGGAATTGTTTGAAAGG - Intronic
1062255836 9:135620138-135620160 TAGAGGGGGAAGGGGGAGAAGGG - Intergenic
1185541527 X:906417-906439 CAGAGGGGAGAGAGAGAGAAAGG + Intergenic
1186044995 X:5526202-5526224 TAGTGGGGGAAGAGTTCGAATGG - Intergenic
1186578463 X:10791348-10791370 CAAAGGGGGAAGGTTTACAAGGG + Intronic
1187061905 X:15794669-15794691 AAGAGGTGGAGGAGGTAGAAGGG + Intronic
1187245009 X:17546121-17546143 CAGAGGGGGTACAGTGAGACTGG + Intronic
1187729279 X:22236138-22236160 CTGAAGGGGAAGAGTAGGAAGGG - Intronic
1188427360 X:30064566-30064588 GAGAGAGAGAAGAGTCAGAAAGG - Intergenic
1188652722 X:32651903-32651925 CAGAAGGCGCAGAGTTCGAATGG - Intronic
1188877831 X:35453444-35453466 TAGAGGGGGAAGGGAGAGAAAGG - Intergenic
1189025467 X:37389247-37389269 CAGAGGTGGAAGAGTGTGGAGGG - Intronic
1189127480 X:38463487-38463509 CAGAGGTTGAAGAGTTTGGAGGG - Intronic
1189414901 X:40804929-40804951 CAGAGGAGGTAGAGTTACAATGG + Intergenic
1189873600 X:45410323-45410345 CAGAAGGGGGAAAGTTGGAAGGG + Intergenic
1192136013 X:68601207-68601229 CAGAAGGAGAAGAGAGAGAAAGG + Intergenic
1192290743 X:69792109-69792131 CAGTGGGGGAATGGTTAGAAGGG - Intronic
1192796917 X:74431467-74431489 CAGATGGGGAAGGGTGGGAAGGG + Intronic
1192819054 X:74624052-74624074 AAGAGGGGCAAGAGGTGGAAGGG - Intergenic
1193180641 X:78452058-78452080 CAAAGGGAGAAGAGAGAGAAAGG - Intergenic
1194423046 X:93700476-93700498 CAGAGGGAGAAAATTTAAAATGG - Intronic
1195063624 X:101219724-101219746 GAGAGGGGGAAGAGGGAGAGAGG - Intergenic
1195259587 X:103118827-103118849 CAGAAGGGGGAGAGTGGGAAGGG - Intergenic
1195392396 X:104376314-104376336 CAGAGGTGGAAGAGGTTGAAGGG - Intergenic
1195619820 X:106941937-106941959 CAGAGGGAGATGACCTAGAAAGG - Exonic
1195966167 X:110432107-110432129 AAGAGGGAGAAGAGTTAAGAGGG + Intronic
1196098804 X:111827491-111827513 GAGATGGGGAAGAGTAGGAAAGG - Intronic
1196598603 X:117574669-117574691 AAGAGGGAGTAGTGTTAGAAAGG - Intergenic
1196655325 X:118211926-118211948 CAGAGGGGGAAGACCAGGAAAGG + Intergenic
1196852326 X:119949179-119949201 GAGAGGGGGAAGGGACAGAAGGG - Intergenic
1197006412 X:121507332-121507354 CAGAGGTGGAAGAGGTAGAAGGG - Intergenic
1197076301 X:122357618-122357640 CAGAAGGTGAAGAGTAAGCAAGG + Intergenic
1197567416 X:128104605-128104627 CAGAGGGGGCAGAAAGAGAAAGG - Intergenic
1197712420 X:129681062-129681084 TAGAGTGGGAAGAAGTAGAAGGG - Intergenic
1197958355 X:131977320-131977342 AAGAAGGGGAAAAGATAGAATGG + Intergenic
1198455991 X:136818304-136818326 CTGAGGTGGAAGAGGTGGAAGGG + Intergenic
1198608820 X:138374002-138374024 CAGAAGGAGAAGAGAAAGAAAGG + Intergenic
1199614100 X:149641640-149641662 CAGAGGAGGAAGAGGTAGGAGGG + Intergenic
1199686659 X:150271180-150271202 CAGAGGGGGAGGAGGTAGATTGG + Intergenic
1201247737 Y:12022867-12022889 GAGAGGAGGAAGAGGAAGAAAGG + Intergenic
1202299716 Y:23399480-23399502 GAGAAGGGGAAGAATCAGAAAGG + Intergenic
1202571093 Y:26271118-26271140 GAGAAGGGGAAGAATCAGAAAGG - Intergenic