ID: 1097003976

View in Genome Browser
Species Human (GRCh38)
Location 12:55901813-55901835
Sequence CCGTGGGGCTCTCTGGGGTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 265}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097003976_1097003984 11 Left 1097003976 12:55901813-55901835 CCAGACCCCAGAGAGCCCCACGG 0: 1
1: 0
2: 2
3: 35
4: 265
Right 1097003984 12:55901847-55901869 GTCCATTCCCTATTCCCCAAAGG 0: 1
1: 0
2: 0
3: 7
4: 148
1097003976_1097003988 20 Left 1097003976 12:55901813-55901835 CCAGACCCCAGAGAGCCCCACGG 0: 1
1: 0
2: 2
3: 35
4: 265
Right 1097003988 12:55901856-55901878 CTATTCCCCAAAGGCCTCAGAGG 0: 1
1: 0
2: 4
3: 46
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097003976 Original CRISPR CCGTGGGGCTCTCTGGGGTC TGG (reversed) Exonic
900206843 1:1435292-1435314 CCCTGGGGTTCTCTTGGGCCTGG + Intronic
900389326 1:2427240-2427262 CAGTGGGGCGCCCTGGGGCCAGG + Intronic
900534705 1:3171060-3171082 CCGTGGGGCGCTGAGGGGTGCGG - Intronic
900585440 1:3430398-3430420 CTGGAGGGCTCTCTGGGATCTGG - Intronic
900591753 1:3463300-3463322 CCGCCGGGCTCTCTGTGCTCAGG - Exonic
900618027 1:3574050-3574072 CAGTGGGGGTCTCTCGGGTGTGG - Intronic
900938851 1:5784810-5784832 CCGTGTGGCACTGTGGGGCCAGG - Intergenic
900962251 1:5932448-5932470 CCGTTGGGCTCTCCGAGGTGTGG - Intronic
901084193 1:6600909-6600931 CAGTGGGGCTCTGAGGTGTCAGG - Intronic
901494462 1:9613343-9613365 CCTTGGGGCTCCCTGGCTTCGGG - Exonic
901924430 1:12556901-12556923 CTGCGGGCCTCTCTGTGGTCAGG + Intergenic
902042063 1:13499786-13499808 CCGTGGGTCGCACTGTGGTCTGG - Intronic
902098042 1:13962458-13962480 ATGTGGGGCTCTCTGGGGCCAGG + Intergenic
902560830 1:17276584-17276606 CCGTGGAGCTCTTTGTGGACTGG + Exonic
902601064 1:17540320-17540342 CCTTGGGGGTCCCTGGGATCGGG + Intronic
903226393 1:21896346-21896368 CCGTGGGGCTCAGTGGGAGCTGG - Intronic
904600823 1:31671695-31671717 CCCAGGGGCTCTATGGGGCCTGG - Intronic
905212869 1:36386200-36386222 CCGCGAGGTTCTGTGGGGTCGGG - Intergenic
905307775 1:37031510-37031532 CAGAGGGGCTCTCTGGGCTGAGG - Intronic
906423096 1:45687091-45687113 CCGTGTGGCCCGCTGGGGACTGG - Intronic
907300013 1:53481235-53481257 CTTTGGGGCTCTCTGGCTTCTGG - Intergenic
907310855 1:53538254-53538276 CCGTGAGGCTCTCGAGGGTCTGG + Intronic
908520578 1:64937270-64937292 CTGTGGAGCTCTCTGGGGGTTGG - Intronic
912948387 1:114103792-114103814 TGCTGGGGCGCTCTGGGGTCAGG + Intronic
912951303 1:114122535-114122557 ACGTGGGGCTGCCTGGGGTCTGG + Intronic
913418330 1:118636392-118636414 CCCTGGGCTTCTCTGGGGACTGG + Intergenic
915564961 1:156707995-156708017 CAGTGGGGCTCCCTGGGGTGGGG + Intergenic
918428426 1:184434265-184434287 CCGAGGGTCTCTGTGGTGTCAGG + Intronic
920398016 1:205660508-205660530 CCGTGGGCTTCCCTGGTGTCAGG - Intronic
920919283 1:210284880-210284902 TTGTAGGGCTCTCTGGGGTCTGG - Intergenic
922557245 1:226541809-226541831 CCGTGGCCGCCTCTGGGGTCTGG + Intergenic
922803226 1:228373436-228373458 GCGTTGGGGTGTCTGGGGTCAGG - Intronic
923458221 1:234184903-234184925 CAGTGAGTCTCTCTGGGGGCAGG - Intronic
1062925024 10:1309756-1309778 GGGAGGGGCTCTCTGGGGTGTGG + Intronic
1063458384 10:6201147-6201169 CCCTGGGGTTCGCGGGGGTCGGG - Intronic
1065811492 10:29447655-29447677 CCCTGGGGCTCCCTGGGGGCTGG + Intergenic
1067080509 10:43209805-43209827 GGGTCTGGCTCTCTGGGGTCAGG - Intronic
1067095630 10:43297707-43297729 TCGTGGGCCTCTCTTGGGGCAGG + Intergenic
1067192451 10:44082770-44082792 ATGTGGGGCTTTCTGTGGTCTGG - Intergenic
1067655424 10:48188155-48188177 CTGTGGGGCTCTGAGGGGTGGGG - Intronic
1070617616 10:77981103-77981125 CCATGGGACTCTCTGGGCTTTGG + Intronic
1070774781 10:79103282-79103304 CCGTGGGGATGCCTGGGGTGGGG + Intronic
1070935661 10:80293001-80293023 CCGTGGTGCTGCCTAGGGTCAGG - Intergenic
1072530476 10:96313952-96313974 CTGTCAGGCTCTCTGGGCTCTGG - Intronic
1072711342 10:97717626-97717648 CCCTGGTGCTGTCTGTGGTCAGG + Exonic
1073368649 10:102966985-102967007 CCATGGGGCTACCTGGGGTCTGG + Intronic
1074869037 10:117562670-117562692 CCCTGTGGCTCTCTCAGGTCAGG - Intergenic
1075465678 10:122648627-122648649 CCGTGGGGCCAGCTGGGGTGTGG - Intergenic
1075633575 10:124015887-124015909 CCTTCGTGCCCTCTGGGGTCGGG - Intronic
1075713292 10:124542145-124542167 ACCTGGGGCAGTCTGGGGTCTGG + Intronic
1076139640 10:128068903-128068925 AAGTGGGGCTCTCTGTGGACAGG - Intronic
1076741586 10:132488359-132488381 CCCTGAGGCTCTGCGGGGTCCGG + Intergenic
1076787786 10:132759649-132759671 GTGGGGGGCTCTCGGGGGTCCGG + Intronic
1076887564 10:133269620-133269642 CCGAGGGGCCCTCGGGGGTGGGG - Intronic
1077117839 11:893374-893396 CTGTGGAGGGCTCTGGGGTCGGG - Intronic
1077332370 11:1989241-1989263 CCTTGGGGGTCTCTGTGGCCTGG + Intergenic
1077514116 11:2991704-2991726 TCGTGAGCCTCTGTGGGGTCAGG - Intronic
1080191666 11:29557603-29557625 ACATGGGGCTCACTGTGGTCAGG - Intergenic
1082835226 11:57646458-57646480 CCCTTGGGCTGTCTGGGGACTGG - Intronic
1082893066 11:58161081-58161103 CTGGGGGCCTGTCTGGGGTCGGG + Intronic
1083258765 11:61511831-61511853 CAGTGGGCCTTTCAGGGGTCTGG + Intergenic
1083657132 11:64234980-64235002 CCGAGGGGATCTGCGGGGTCCGG + Intronic
1083714809 11:64569101-64569123 ACTTGGGGCTCTCTTGGGGCAGG - Intronic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1084165591 11:67373430-67373452 GCGCGGGGCTCCCGGGGGTCAGG + Intronic
1084564611 11:69921908-69921930 CCCTGGGGCTCCCTGGTGGCTGG + Intergenic
1090431168 11:126647871-126647893 TCATGGTGCTCTCCGGGGTCTGG + Intronic
1202815351 11_KI270721v1_random:44417-44439 CCTTGGGGGTCTCTGTGGCCTGG + Intergenic
1091781324 12:3216155-3216177 CCCTGGGGCCCTCTGGGAGCTGG + Intronic
1094057020 12:26278206-26278228 CCACGGGGCTCTCTGAGGACGGG + Intronic
1094522617 12:31208865-31208887 CCGTGGGGAGCTGTGGGGTTGGG - Intergenic
1094852395 12:34388158-34388180 GCGTGGGGCCCACGGGGGTCAGG - Intergenic
1097003976 12:55901813-55901835 CCGTGGGGCTCTCTGGGGTCTGG - Exonic
1102111849 12:110371069-110371091 CCCAAGGGCCCTCTGGGGTCAGG + Intergenic
1102385320 12:112504157-112504179 TCCTGGTGCTCCCTGGGGTCTGG - Intronic
1102454843 12:113065068-113065090 TCGTGGGGCCCACTGGGGCCTGG + Intronic
1104613385 12:130248640-130248662 CCTGTGGGCTCTCTGGGGTGCGG - Intergenic
1104714970 12:131010675-131010697 CGGTGGGGCTCCGTGGGGCCAGG + Intronic
1105202156 13:18190177-18190199 CCCTGGGGTTCTCAGGGGCCTGG - Intergenic
1106956394 13:34942867-34942889 CCGTGGGGCTCATTGCCGTCGGG + Exonic
1108848236 13:54700207-54700229 CCTTGGGGCTCTGTGGTTTCTGG - Intergenic
1109348561 13:61146126-61146148 CCTTGGGGCTCTGTGGTTTCTGG + Intergenic
1112364314 13:98743555-98743577 CCCTGGAGCACTCTGTGGTCTGG - Intronic
1113025750 13:105939021-105939043 GCCTGGGGCTCTCTGGGCACTGG + Intergenic
1113901197 13:113799116-113799138 CCATGGGGCTTTCTGCTGTCTGG + Intronic
1115641357 14:35337564-35337586 CTGTGGGTCTCTGTGGGGCCTGG - Intergenic
1116025395 14:39508392-39508414 CCCTGGGCCTTTCTGGGGACTGG - Intergenic
1116036979 14:39638955-39638977 CAGTTAGGCTCTTTGGGGTCAGG + Intergenic
1117733291 14:58745456-58745478 GAGTGGAGCTCACTGGGGTCTGG + Intergenic
1121122488 14:91384814-91384836 CCTTGGGGCTGTCTGTGGCCAGG - Intronic
1121440407 14:93945243-93945265 CTCTGGATCTCTCTGGGGTCAGG + Intronic
1122599570 14:102914623-102914645 CCCTTTGGCTCCCTGGGGTCTGG - Intergenic
1122743880 14:103886994-103887016 CTGAGGGGCTCTATGGGGCCTGG - Intergenic
1122904328 14:104795127-104795149 CCGTGGGGCTCCCCGGGCGCTGG - Intronic
1123039754 14:105485678-105485700 GTGTGGGGCTCTCTGGAGTGTGG + Intergenic
1124962585 15:34409797-34409819 GCGTGGGGCTCTCTGGCCGCAGG - Intronic
1124979210 15:34556019-34556041 GCGTGGGGCTCTCTGGCCGCAGG - Intronic
1125415235 15:39445281-39445303 CCCTGGGGCTCTCTGAGGGATGG + Intergenic
1129227833 15:74180160-74180182 CGGCAGGGCTCGCTGGGGTCTGG - Exonic
1134195532 16:12156527-12156549 TCATGGTGCTCTCTGGGGGCAGG - Intronic
1136137046 16:28262495-28262517 CCCTGAGGCTCCCTGGGGACTGG + Intergenic
1136994962 16:35182986-35183008 ACCTGGGGTTCTCTGGGGGCAGG - Intergenic
1139269234 16:65666474-65666496 CCATGGGGCTCTCTGAGCCCAGG - Intergenic
1141661884 16:85445831-85445853 CCTTGCAGCTCGCTGGGGTCAGG + Intergenic
1142075315 16:88114383-88114405 CTGTGGGGGTCTCTGGGGTGGGG + Intronic
1142468404 17:148555-148577 TCCTGGGCCTCTCTGGGGCCTGG + Intronic
1142743507 17:1943470-1943492 CCGTGGGGCTCTCTGGGTCTTGG + Intronic
1143614913 17:8044010-8044032 CAGTGGGGCTATCTTGGCTCAGG - Intronic
1144655062 17:17029959-17029981 CAGCGGGGGTCTCTGGGGCCTGG - Intergenic
1145835470 17:27951319-27951341 CTGTGGGGCTGCCTGGAGTCAGG - Intergenic
1146057103 17:29586980-29587002 GGATGGGGCTCTCTGGGGACAGG + Intronic
1147608144 17:41785820-41785842 CCGTGGCTCGCCCTGGGGTCTGG - Intronic
1147727140 17:42572957-42572979 CCGTGGGCCCCTCAGGGGTCTGG + Exonic
1148615480 17:48997292-48997314 CCGAGGGGCCCTGTGGCGTCGGG + Intergenic
1148647463 17:49227330-49227352 CCCTGTTGCTCTCAGGGGTCCGG + Intronic
1148805210 17:50260502-50260524 TCGTGGGGCTCTCTGCAGGCGGG + Intergenic
1148819214 17:50350859-50350881 CAGTGGGGCTATCTGGGGGAGGG + Intronic
1148852167 17:50560653-50560675 CTGCGGGGCTGTCTGGGGGCGGG + Intergenic
1149470833 17:56913985-56914007 CCATGGCGCTCCCAGGGGTCGGG + Exonic
1150248785 17:63694714-63694736 TCCTCGGGCTCTCTGGGATCAGG - Exonic
1151376384 17:73691626-73691648 CATGGGGCCTCTCTGGGGTCTGG + Intergenic
1151512167 17:74567475-74567497 CCATGGGGCACTATGTGGTCAGG + Intergenic
1151539731 17:74758875-74758897 CCCTGGGGATCTGTGGGGCCTGG - Intronic
1151943984 17:77309373-77309395 CTGTGGGCCTCTGTGGGCTCTGG + Intronic
1152205836 17:78973986-78974008 CCATGGGGCTGTCGGGGGCCAGG - Intronic
1152227112 17:79097621-79097643 CCGTGGGGCTCCGGGGGCTCTGG - Intronic
1152635799 17:81430052-81430074 CGGTGGGCCTCTCTGGGGCTTGG + Intronic
1152687251 17:81700706-81700728 CCGGGAGGCTCTGTGGGGCCTGG - Exonic
1152725348 17:81942247-81942269 TCCTGGGGCTCGCGGGGGTCGGG + Intronic
1153322367 18:3785749-3785771 CTGTGGTTCTCTTTGGGGTCTGG + Intronic
1153944952 18:10009956-10009978 CCGTGGTCCTCTCCAGGGTCCGG + Intergenic
1157470840 18:47986881-47986903 CTATGGGGCTCTCTGGGTGCAGG - Intergenic
1157716817 18:49893694-49893716 CCCTGGAGATCCCTGGGGTCTGG + Intronic
1158441669 18:57480077-57480099 CAATGGGGCTCTCTAGGGGCAGG - Exonic
1160049727 18:75421576-75421598 ACGTGGAGCTCTGTGGGGTCAGG + Intronic
1160341974 18:78097188-78097210 CCATTGGGCTCACTGGGGTGAGG + Intergenic
1160499892 18:79396376-79396398 CCGTGGGGGGCGCAGGGGTCCGG - Intronic
1160728533 19:629800-629822 CCCAGGGGCTCTCGGGGGCCTGG + Exonic
1161091244 19:2361080-2361102 GCCTGGAGCCCTCTGGGGTCAGG + Intergenic
1161320119 19:3637225-3637247 GAGAGGGGCTCGCTGGGGTCTGG + Intronic
1161610398 19:5238851-5238873 CCGAGGGGCTGTCTGCGGTCAGG + Intronic
1162420900 19:10565609-10565631 CCGCAGGGCGCTCTGGGGTTGGG + Intronic
1162968713 19:14167720-14167742 CCCTGGCTCTCTCTGGGGCCCGG - Intronic
1163116924 19:15194607-15194629 CCATGGGGCTTTCTGGGGAACGG + Intronic
1163298574 19:16428846-16428868 CCGTGGCACTCACTGGGCTCAGG + Intronic
1163526818 19:17826507-17826529 CAGTGGGGCTCTCTGAGTCCTGG - Exonic
1163575695 19:18109871-18109893 CCCTGGGGCTCTCTGGGAGCCGG - Intronic
1163688958 19:18728153-18728175 CCAAGGGGGACTCTGGGGTCAGG + Intronic
1164781589 19:30897353-30897375 CCCTGGGGCACTCTGGGGTTGGG + Intergenic
1165027389 19:32971790-32971812 GCGTGGGGCTCTGTGGGGCCGGG - Intronic
1165034242 19:33021686-33021708 CCGTGGGGTGCACAGGGGTCCGG - Intronic
1166142047 19:40810534-40810556 CCATGGGGCTGGCTGGGGGCAGG - Intronic
1166185473 19:41136260-41136282 CCATGGGGCTGGCTGGGGGCAGG + Intergenic
1166221004 19:41364437-41364459 CCGAAGAGCTCTCTGTGGTCCGG + Intronic
1166780686 19:45340972-45340994 TCCTGGGGCTCTCCGGGATCTGG + Intronic
1166784993 19:45362412-45362434 CCGTGGGACTCTGTGGGATGTGG - Intronic
1167137479 19:47625842-47625864 CCGTGGGGCTGTGTGGGGGCCGG + Intronic
1167693058 19:50999115-50999137 GCGAGGGGCTCTCTGGATTCTGG + Intronic
1168355346 19:55696604-55696626 CCGGGGGACGCTCTGGGCTCAGG + Intronic
925029330 2:637014-637036 CCGTGGGCCTCGCAGCGGTCCGG - Intergenic
926124674 2:10264791-10264813 GCGTGGGGCTGTGTGGGGTGTGG + Intergenic
926163880 2:10506031-10506053 CTCTGGGGTTCTCTGGGGTTAGG + Intergenic
927148802 2:20184132-20184154 CCTTGGGGCTTTCAGGGGGCAGG + Intergenic
927195083 2:20541384-20541406 ACGTGCTGCTCTCTGGGGTCTGG - Intergenic
927492278 2:23528539-23528561 CCTGGAGGCTCTCTGGGCTCAGG - Intronic
932063521 2:68529752-68529774 CCGTGGGGCTGTTGGGGGTGTGG + Intronic
932480208 2:72034592-72034614 TAGTGGGTCTCTCGGGGGTCAGG + Intergenic
932607432 2:73174817-73174839 CTGCGGGGCCCTCTGGGATCTGG - Intergenic
932839277 2:75066631-75066653 CCGAGAGTCTCTCTGGGCTCAGG - Intronic
933992599 2:87644148-87644170 CCGAGGGGCTCCCTGGGGACTGG - Intergenic
934047674 2:88185964-88185986 CCGCGGGAGTCTCAGGGGTCAGG - Exonic
936090805 2:109500337-109500359 CCCAGGGGCTCTCTGGGCTGTGG - Intronic
936301254 2:111306693-111306715 CCGAGGGGCTCCCTGGGGACTGG + Intergenic
937039611 2:118810757-118810779 TCATGGTGCTCTCTGAGGTCAGG - Intergenic
938318511 2:130346233-130346255 ACGTGGAGCTCACTGAGGTCGGG + Exonic
946418415 2:219551979-219552001 CCGAGGGGCTCTCCTGGGCCGGG - Intronic
946740088 2:222792654-222792676 CAGTGGAGCTTTGTGGGGTCTGG + Intergenic
947211122 2:227709655-227709677 CTGTGGGGCTCCCTGAGGTAGGG + Intronic
947752959 2:232542232-232542254 ACCTAGGGCTCTTTGGGGTCAGG - Intronic
948607736 2:239146769-239146791 CAGTGGGGCTGTGGGGGGTCAGG - Intronic
949035411 2:241813825-241813847 TCACGGGGCTCTCTGGGGACAGG - Intronic
949035428 2:241813884-241813906 TCACGGGGCTCTCTGGGGACAGG - Intronic
949035445 2:241813943-241813965 CCACGGGGCTCTCTGGGGACAGG - Intronic
1168771446 20:419376-419398 CCGCGGGGCCCTCTGGAGCCAGG + Exonic
1168954645 20:1826385-1826407 CCAAGGGGCCCTCTAGGGTCAGG + Intergenic
1170096223 20:12648539-12648561 CTCTGGAGCTCTCGGGGGTCAGG + Intergenic
1172101063 20:32484060-32484082 CCGGCGGGCTGTCTGCGGTCAGG + Intronic
1173855343 20:46246809-46246831 CCGAGCGGCTCCCTGGGGTGGGG + Intronic
1174002410 20:47384416-47384438 CCCTGGGGCTCTCAGGGGGCTGG + Intergenic
1175419713 20:58823540-58823562 CCATGGGGCCCACTGGGGTCGGG - Intergenic
1175457654 20:59127472-59127494 CCGTGGGGCTGGCTGGGAACAGG - Intergenic
1175529286 20:59663042-59663064 CCCTGGGCCTCTCTAGCGTCTGG + Intronic
1175714594 20:61247049-61247071 CAGTGGGTCCCTCTGGGGCCTGG + Intergenic
1176160222 20:63643836-63643858 GCATAGGGCTCTCTGGGGACAGG + Exonic
1176179414 20:63742432-63742454 CCGTGGGGGACACTGGAGTCAGG - Exonic
1176715796 21:10347831-10347853 CCCTGGGGGTCTCAGGGGCCTGG + Intergenic
1179290391 21:40013249-40013271 CCGTGGGGCGCTTCAGGGTCCGG + Exonic
1179501660 21:41813040-41813062 CTGGGGGGCTCTGGGGGGTCAGG + Intronic
1179543272 21:42098211-42098233 TCGTGGGGCTCTCTGGGATCCGG - Intronic
1179638605 21:42731895-42731917 CCCTGGGGCTCTCTGGGCCTGGG - Exonic
1179875693 21:44266233-44266255 CCTTGGGGCTTTCTGGGGCATGG - Intergenic
1180107619 21:45630287-45630309 CCATGGAGATCTCTGGGGTTGGG - Intergenic
1180602545 22:17032122-17032144 CCCTGGGGGTCTCAGGGGCCTGG - Intergenic
1180857708 22:19058854-19058876 CTGTGTGGCTCTCTGGGCCCTGG - Intronic
1181116367 22:20634638-20634660 CCTTGTGGCTCTGTGGGGTTGGG + Intergenic
1183529689 22:38346716-38346738 CTGTGGGGCTCACCTGGGTCCGG + Intronic
1183639190 22:39082971-39082993 CTCTGGGCCTCTCTGGGGTCCGG + Intronic
1184272418 22:43392411-43392433 GCATGGGGCTCCCTGGGATCTGG + Intergenic
1184351004 22:43944205-43944227 CCGGGGGGATGTCTGTGGTCAGG + Intronic
1184448296 22:44567155-44567177 CCGCGGGGATGACTGGGGTCTGG + Intergenic
1184677582 22:46052230-46052252 CCTAGGGGTCCTCTGGGGTCTGG - Intronic
1185247683 22:49781710-49781732 GCGTGGGGCCCTCAGGGCTCTGG - Intronic
949968436 3:9380136-9380158 CCTGGGAGCTCTCTGAGGTCAGG - Intronic
950452635 3:13073732-13073754 CCGCGGAGCTCTCGGGGCTCTGG + Intergenic
953407633 3:42667298-42667320 CCTTGGGGCTCTCTGGTCTCAGG + Intergenic
954639371 3:52088946-52088968 CCGTGGTTATCTCTGGGGCCTGG - Intronic
954663293 3:52237497-52237519 CCGAGGGGGTCACTGGGGACTGG - Intronic
957952210 3:87141533-87141555 CCCTGTGGCTCCCTGGGGTTGGG + Intergenic
958955966 3:100466366-100466388 CCCTGTTGCTCTCAGGGGTCAGG + Intergenic
962259993 3:133895988-133896010 CCGGGGGGCTCTCAGGGGTACGG - Intergenic
965285206 3:166810923-166810945 GCGTGCGGCTCGCTGGGGACTGG - Intergenic
965319463 3:167233783-167233805 CTGTGTGGCTCTCTGGAGTCTGG + Intergenic
968504320 4:964892-964914 CCGTGGGGCACCGTGGGGTCAGG - Intronic
969665496 4:8554926-8554948 CCCTGGGGGTCGCTGGGGTCGGG - Intergenic
972352890 4:38253491-38253513 CTGTGGGGCTTTCTGCTGTCGGG + Intergenic
974112072 4:57537271-57537293 CAGTTAGGCTCTCGGGGGTCAGG + Intergenic
978642116 4:110882908-110882930 CGGTGGGTCTCTAGGGGGTCAGG + Intergenic
984845385 4:184103856-184103878 GCCAGGGGCTCGCTGGGGTCAGG - Intronic
985359246 4:189155128-189155150 CCCTGTGGCTCTGTGAGGTCTGG - Intergenic
987118147 5:14742616-14742638 CCCTGGAGCTCTCTGAGGGCAGG + Intronic
988503012 5:31799177-31799199 ACGTGGGGCCCTGTGGGGTCTGG + Exonic
992645254 5:78805768-78805790 CCGGGTGGCTCTGTGGGTTCCGG + Intronic
992868665 5:80983385-80983407 TTGTGGGGCTCACTGGGATCTGG + Intronic
994247054 5:97489598-97489620 CCGTGGAGCTAGCTGGGGCCAGG - Intergenic
994614807 5:102091020-102091042 CAGTAGGACTCTCTGGGGGCAGG - Intergenic
995391526 5:111645484-111645506 ACGTGGAGCTCACTGTGGTCAGG + Intergenic
997207203 5:132056914-132056936 CACTGGGCCTCTCCGGGGTCCGG + Intergenic
998095660 5:139394419-139394441 CCTTGGGGGACTCTGGGGCCGGG + Exonic
999384574 5:151145168-151145190 CCCTGGGGCTCTGTGGGGCTGGG + Intronic
1000631533 5:163596191-163596213 CAGTGTGGCTCTCTGGGGCAAGG + Intergenic
1002327815 5:178420981-178421003 CCCTGCGGCTCCCTGGGGTTGGG - Intronic
1002535804 5:179874761-179874783 CCCGGGGGTGCTCTGGGGTCAGG - Intronic
1003266394 6:4568292-4568314 CCCCGGCGCTCCCTGGGGTCAGG + Intergenic
1003569902 6:7248848-7248870 CCGCCGGGCTCTCTGGGTTAAGG - Exonic
1004688661 6:17972946-17972968 CCATGGGGCTCTTCAGGGTCTGG - Intronic
1005327307 6:24715280-24715302 CTGTGGGGATCTCTTGGTTCAGG + Intronic
1006458359 6:34144510-34144532 TTGTGGGGGTCTCTAGGGTCTGG - Intronic
1007377991 6:41469438-41469460 CCTTGGGGGTCTCTGGGGTGGGG - Intergenic
1007581568 6:42963213-42963235 AGGTGGGGCCCTCTGGGGTGGGG + Exonic
1007606821 6:43123552-43123574 CCGTGTTGCTCTCTGGGCTCAGG - Intronic
1007725346 6:43912791-43912813 CCTGGGGTGTCTCTGGGGTCAGG - Intergenic
1009906224 6:69872849-69872871 CACTGGGGAACTCTGGGGTCTGG + Intronic
1017021548 6:150143648-150143670 CCGCGGTGCCCTCTGGCGTCGGG + Intronic
1018767787 6:166947391-166947413 CTTTGGGGCTCTGAGGGGTCGGG - Intronic
1019016818 6:168885999-168886021 CGGTGGGGCCTTCTGGGGACAGG + Intergenic
1019546698 7:1580999-1581021 CTGAGGGTCTCTCTGGTGTCAGG + Intergenic
1019896456 7:3987245-3987267 CCGTGGTGCTCTCTTGGGTCCGG + Exonic
1022908902 7:34881338-34881360 ACCTGGGGCTATCAGGGGTCAGG - Intergenic
1025109661 7:56203462-56203484 CTGGAGAGCTCTCTGGGGTCTGG + Intergenic
1025878361 7:65509062-65509084 CCGAGGGGCTCTCCCGGCTCGGG - Intergenic
1029482817 7:100823425-100823447 CCTTGGGCCTCCCTGGGGGCCGG + Intronic
1032446937 7:131992155-131992177 CCGAAGGGCTCTGTGAGGTCAGG + Intergenic
1032784876 7:135193195-135193217 CTGTGGCTCTCTCTGGGGCCAGG - Intronic
1034242489 7:149621233-149621255 CCCTGGGGCGCCCTGGGGTTGGG - Intergenic
1035066131 7:156106186-156106208 CCCTGGGGCTCCCTGGTGTGAGG + Intergenic
1035069264 7:156129383-156129405 CCTAGAGGCTCTCTGGGGGCTGG - Intergenic
1035356694 7:158280010-158280032 CCGCGGGGCTCTGTGGGTTCGGG - Intronic
1035485300 7:159218811-159218833 CCGTGGGGCTCTGTTCGGTGGGG - Intergenic
1035705234 8:1669975-1669997 CCCTGGGCCTCGCTGGGCTCCGG + Intronic
1039762657 8:40594147-40594169 CAGTGGGGCTGTCAGGTGTCAGG - Intronic
1039811057 8:41048775-41048797 CCTTGGGCTTCTCTGGGGACTGG - Intergenic
1041350849 8:56946607-56946629 CCCTAGGGCTCTTTGGGTTCAGG - Intergenic
1042681313 8:71388206-71388228 CCTTGGGGATCACTGGTGTCTGG - Intergenic
1042863450 8:73335901-73335923 CCCTGGGGATCCCTGGGCTCTGG + Intergenic
1044300288 8:90575634-90575656 CCAAGGGCCTCTCTGGGGTAGGG + Intergenic
1045336271 8:101206187-101206209 CCGCCGGGCTCGCTGGGGGCCGG - Intronic
1049092501 8:140526863-140526885 CCGTGTGTCACTCTGTGGTCAGG - Intergenic
1049095991 8:140548446-140548468 CCGTGGAGCTCTTTGATGTCAGG - Intronic
1049357039 8:142194042-142194064 CCCTTGGGCCCTCTGTGGTCTGG + Intergenic
1049549870 8:143252281-143252303 CTGTAGGGCTCTCTGAGGTCGGG + Intronic
1049587577 8:143439154-143439176 GGGTGGGCCTCTCTGGGGTCGGG - Intronic
1049644133 8:143728516-143728538 TCGTGGGCGTCCCTGGGGTCGGG - Exonic
1049645523 8:143734038-143734060 CAGTTGGGCTCCCGGGGGTCGGG - Intergenic
1049741454 8:144242962-144242984 CCTAGGTGCTCACTGGGGTCCGG - Intronic
1049804077 8:144531024-144531046 CCGAAAGGCCCTCTGGGGTCAGG - Intronic
1052413139 9:28147675-28147697 CCGTGGGGCTGTTGGGGGTGCGG - Intronic
1057238915 9:93391590-93391612 CGGTGGGTGTCTCTGGGCTCTGG - Intergenic
1057949447 9:99358352-99358374 AGGGTGGGCTCTCTGGGGTCTGG - Intergenic
1058816233 9:108684999-108685021 GGGAGGAGCTCTCTGGGGTCAGG - Intergenic
1060300022 9:122369719-122369741 CCCTGGGGCTCTCAGGGTGCCGG - Intergenic
1060763501 9:126275790-126275812 CCGCAGGGCGCTCTGGGCTCCGG - Intergenic
1060789818 9:126478489-126478511 CCGAGGTCCTCCCTGGGGTCTGG - Intronic
1060806547 9:126581189-126581211 CTGTGGGTCCCTCTGGGGTTGGG + Intergenic
1061301680 9:129709305-129709327 ATCTGGGTCTCTCTGGGGTCGGG - Intronic
1061482709 9:130904837-130904859 CCCTTCGGCCCTCTGGGGTCAGG - Intronic
1061949850 9:133930177-133930199 CGGTGGGGCTGTCTGGGGAGAGG - Intronic
1062469518 9:136696417-136696439 CCCTGGGGCCCCCTGGGGCCTGG + Intergenic
1188444425 X:30241824-30241846 CAGTGGGGCTTTCTGTGTTCTGG - Intergenic
1189213100 X:39301266-39301288 CCATGGGACTCTCTGATGTCTGG - Intergenic
1189847289 X:45149242-45149264 CCGTGGGACTCTGGAGGGTCTGG + Exonic
1192590010 X:72351762-72351784 CGGTGGGGCTCATTGCGGTCTGG + Exonic
1195323695 X:103741247-103741269 GAGTGAGGCTCTCTGAGGTCTGG - Intergenic
1197729536 X:129797880-129797902 CCGTGGGCCTCTCCAGGGCCTGG + Intergenic