ID: 1097005594

View in Genome Browser
Species Human (GRCh38)
Location 12:55915120-55915142
Sequence CAAGAGAATCCCTTGAAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125815
Summary {0: 1, 1: 1, 2: 256, 3: 9350, 4: 116207}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097005587_1097005594 8 Left 1097005587 12:55915089-55915111 CCTGCAGTCCCAGCTACTCAGGA 0: 1562
1: 45781
2: 163407
3: 220027
4: 205967
Right 1097005594 12:55915120-55915142 CAAGAGAATCCCTTGAAGGCGGG 0: 1
1: 1
2: 256
3: 9350
4: 116207
1097005591_1097005594 -1 Left 1097005591 12:55915098-55915120 CCAGCTACTCAGGAGGCTGAGGC 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
Right 1097005594 12:55915120-55915142 CAAGAGAATCCCTTGAAGGCGGG 0: 1
1: 1
2: 256
3: 9350
4: 116207
1097005589_1097005594 0 Left 1097005589 12:55915097-55915119 CCCAGCTACTCAGGAGGCTGAGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
Right 1097005594 12:55915120-55915142 CAAGAGAATCCCTTGAAGGCGGG 0: 1
1: 1
2: 256
3: 9350
4: 116207
1097005585_1097005594 27 Left 1097005585 12:55915070-55915092 CCGGGCATGGAGGCACATGCCTG 0: 30
1: 5259
2: 25365
3: 71079
4: 139768
Right 1097005594 12:55915120-55915142 CAAGAGAATCCCTTGAAGGCGGG 0: 1
1: 1
2: 256
3: 9350
4: 116207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097005594 Original CRISPR CAAGAGAATCCCTTGAAGGC GGG Intronic
Too many off-targets to display for this crispr