ID: 1097005735

View in Genome Browser
Species Human (GRCh38)
Location 12:55916451-55916473
Sequence CCATACCCTCTAGTGAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 87}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097005735_1097005739 26 Left 1097005735 12:55916451-55916473 CCCAGTTTCACTAGAGGGTATGG 0: 1
1: 0
2: 0
3: 0
4: 87
Right 1097005739 12:55916500-55916522 ACATTTAAAAGTAGTCAGCCAGG 0: 1
1: 1
2: 1
3: 19
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097005735 Original CRISPR CCATACCCTCTAGTGAAACT GGG (reversed) Intronic
904557009 1:31372031-31372053 CCATACCATCTAGTTCAACAGGG - Intronic
914711003 1:150213684-150213706 CCTTCCCCTCTAGATAAACTAGG - Intergenic
919135182 1:193498462-193498484 CCATTTCCTCAAGTGCAACTTGG - Intergenic
922974977 1:229777065-229777087 CCTTACTCTCTGGTGAGACTGGG - Intergenic
1064609111 10:17078830-17078852 CCATACCCTCTATTTGACCTAGG + Intronic
1069841370 10:71341392-71341414 CCAAACCCTCTGCTGAAATTAGG - Intronic
1074509266 10:114098265-114098287 CCATAGCCTCTTGTGTAGCTGGG + Intergenic
1074579507 10:114705358-114705380 CCATATCCTAAAGTGAAACATGG + Intergenic
1075561137 10:123469400-123469422 CCATAGTCTCCAGTGATACTAGG - Intergenic
1079772619 11:24481724-24481746 GCATACCCACTTGTCAAACTAGG + Intergenic
1081081489 11:38746167-38746189 CCTTAGCCTCTTGTGTAACTGGG + Intergenic
1082558380 11:54589967-54589989 CCATCTCCTCTAGGGAAAGTTGG + Intergenic
1085157409 11:74308738-74308760 TAAGACCATCTAGTGAAACTAGG - Intronic
1085948250 11:81298180-81298202 TCAAACCCTCTAGAGAAAGTTGG - Intergenic
1086197056 11:84153378-84153400 TCAACCTCTCTAGTGAAACTGGG + Intronic
1086588812 11:88487158-88487180 CAATACCCTTTAATGAAATTGGG + Intergenic
1086857250 11:91879620-91879642 CCATATACTCTAGTGGAAATAGG - Intergenic
1087478956 11:98675021-98675043 CCATTCTCTCTAGTGTAACATGG + Intergenic
1089775605 11:120833410-120833432 CCCTCTCCTCTCGTGAAACTTGG - Intronic
1092052928 12:5485720-5485742 CCAAACACTCTAGTGACTCTGGG - Intronic
1094148910 12:27260368-27260390 TCATAACATCTAGTGAAAGTAGG + Intronic
1096993634 12:55825341-55825363 CCATACACTCCAGTGTAAGTAGG + Intronic
1097005735 12:55916451-55916473 CCATACCCTCTAGTGAAACTGGG - Intronic
1101680872 12:106963977-106963999 CCATACCCTATAGAGAAATATGG - Intronic
1101871606 12:108570325-108570347 CCCTATCTTCTAGTGAAAATGGG + Intergenic
1102428271 12:112861687-112861709 CCTTAGCTTCTAGTGTAACTGGG + Intronic
1102726044 12:115066087-115066109 CCACACACTCTAGTGAAGCCTGG + Intergenic
1108534951 13:51366164-51366186 GCAAACACTCTAGTGAAATTTGG + Intronic
1116367275 14:44083081-44083103 CCCTAACCTCTAGAGAACCTAGG - Intergenic
1117785923 14:59284911-59284933 TCAACCCCTCTAGTGAGACTGGG - Intronic
1122740298 14:103868213-103868235 CCATCCTCGCTAGTGAAAATTGG + Intergenic
1129445952 15:75618122-75618144 CCTTTCCATCTAGTGAACCTTGG - Intronic
1133214518 16:4283499-4283521 CCATACCCTCAAGTGGGTCTGGG + Intergenic
1138847287 16:60581756-60581778 CCATATGCTCTTGTGAAACCTGG + Intergenic
1147575517 17:41596672-41596694 CCATGCCCTCTTTTGGAACTGGG - Intergenic
1147767504 17:42846506-42846528 CCTTAGCCTCAAGTGACACTGGG + Intronic
1152242847 17:79169246-79169268 CCAGCCCCTCCAGTGAAACCCGG - Intronic
1155942316 18:31811545-31811567 CCAATCCCTCTAATGAATCTAGG - Intergenic
1158611825 18:58947308-58947330 CCACACTCTCTACTGAAACGAGG - Intronic
1158924895 18:62245860-62245882 CCAAACCCTCTAGTGGAAGGGGG + Intronic
1159482958 18:69014561-69014583 CAATATACTATAGTGAAACTAGG - Intronic
1159977787 18:74737025-74737047 CCATTCCTGCTAGTAAAACTAGG + Intronic
1165604754 19:37092349-37092371 CCATTCCCTCTTTTGAAAGTGGG - Intronic
1166374180 19:42317870-42317892 CTATACCCTCTGGTGAGAATTGG + Exonic
1166941204 19:46367121-46367143 TCACACCATCTGGTGAAACTGGG - Intronic
1167068780 19:47207126-47207148 CCATACCCTCTTGAGTAGCTGGG - Intronic
928826673 2:35430061-35430083 CAATCCCCTCTACTAAAACTAGG - Intergenic
929152569 2:38760588-38760610 CCTTAGCCTCTAGAGTAACTGGG + Intronic
936240094 2:110780538-110780560 CAAAACTCTTTAGTGAAACTGGG - Intronic
938550167 2:132373041-132373063 CCATTGACTCTTGTGAAACTGGG + Intergenic
938954508 2:136285445-136285467 CCCTCCCCTCTAGTGGTACTTGG + Intergenic
941216514 2:162716213-162716235 TCATAGCCTTTAGTGAAACAAGG + Intronic
943391286 2:187271935-187271957 TCATAGCCTCTAGTGGAGCTAGG + Intergenic
948875655 2:240826258-240826280 CCACACCCTTTAGGGAAACGTGG + Intergenic
1170481019 20:16764882-16764904 CACTACCCACTAGTGGAACTTGG + Intronic
1178678490 21:34651725-34651747 CTATACCTTCAAGTGAACCTAGG - Intergenic
1180885232 22:19238716-19238738 ACGCAGCCTCTAGTGAAACTAGG - Intronic
1181900662 22:26152872-26152894 TCAGACCCTCTCCTGAAACTGGG - Intergenic
950155282 3:10717118-10717140 CCATATCATCCAGTGAAGCTAGG + Intergenic
951225076 3:20111441-20111463 CCCTGCCAGCTAGTGAAACTTGG - Intronic
962695017 3:137939450-137939472 CTATGCCCTCCAGTGAAAGTGGG + Intergenic
971375281 4:26051157-26051179 CCATACCCTCAAGTTAATCGAGG - Intergenic
972528743 4:39942237-39942259 CCCTCCGCTCTAGTCAAACTGGG + Intronic
974193545 4:58539566-58539588 TCATACCCTATAGTAAAACAGGG - Intergenic
978740689 4:112134798-112134820 CCACAGCCTCCAGAGAAACTGGG - Intergenic
980784471 4:137534207-137534229 CCAAACCCTATAGGCAAACTAGG + Intergenic
982718576 4:158836128-158836150 CCCTACCTTCCAGTGAGACTAGG + Intronic
983642616 4:169957118-169957140 CCTTAGCCTCTAGAGAAGCTGGG + Intergenic
991117729 5:62973331-62973353 CCATACCCTCCTGTGCAGCTAGG + Intergenic
995240233 5:109877153-109877175 ACATACCCTCTGGAGAATCTAGG - Intergenic
996487047 5:124048734-124048756 CCATGGCCCCTAGTGAAACAAGG + Intergenic
1012949815 6:105505839-105505861 CTAGACCCTCCAATGAAACTTGG - Intergenic
1015376722 6:132518087-132518109 CCATCCCCTTCAGTGAAATTAGG + Intergenic
1017103521 6:150867305-150867327 CCTTAGCCTCCAGTGTAACTGGG + Intronic
1025080445 7:55977273-55977295 CCTCACCCTCTAGGGTAACTGGG - Intronic
1026230003 7:68474490-68474512 CCATACCCTCCAGTGACATGAGG - Intergenic
1027914505 7:84298528-84298550 CCATTCACTCTAAGGAAACTGGG + Intronic
1030082848 7:105792220-105792242 CACTTCCCTCTAGGGAAACTAGG - Intronic
1033448112 7:141439464-141439486 GCATACCCTTCAGTGAAACAAGG + Intronic
1035638409 8:1164027-1164049 TCATCTCCTCTAGTGAGACTCGG + Intergenic
1041436458 8:57847513-57847535 ACATACCCACTAAAGAAACTAGG + Intergenic
1059596046 9:115721835-115721857 CCATTCCTTCTAGAGGAACTAGG + Intergenic
1060899039 9:127241374-127241396 CCGTAAACTCTAGTGACACTGGG + Intronic
1185752068 X:2619775-2619797 GCATTCCCTGTAGAGAAACTTGG + Intergenic
1187416651 X:19099066-19099088 CCTTACCCTCCAGAGAAGCTGGG - Intronic
1190527092 X:51339177-51339199 CCTTAGCCTCTAGAGTAACTGGG + Intergenic
1192181363 X:68917826-68917848 CCACCCCCTCTAGTGAAAAAGGG + Intergenic
1197538556 X:127724071-127724093 CCAGCCCCTCTAGTGATACGTGG - Intergenic