ID: 1097006932

View in Genome Browser
Species Human (GRCh38)
Location 12:55926761-55926783
Sequence TTTAGGTTCTTCAGGCTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 178}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097006932_1097006941 16 Left 1097006932 12:55926761-55926783 CCCCCAAGCCTGAAGAACCTAAA 0: 1
1: 0
2: 0
3: 23
4: 178
Right 1097006941 12:55926800-55926822 CAACTGCTGGAGAAAAGCTAAGG 0: 1
1: 0
2: 1
3: 17
4: 223
1097006932_1097006944 27 Left 1097006932 12:55926761-55926783 CCCCCAAGCCTGAAGAACCTAAA 0: 1
1: 0
2: 0
3: 23
4: 178
Right 1097006944 12:55926811-55926833 GAAAAGCTAAGGGCCCGTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1097006932_1097006939 3 Left 1097006932 12:55926761-55926783 CCCCCAAGCCTGAAGAACCTAAA 0: 1
1: 0
2: 0
3: 23
4: 178
Right 1097006939 12:55926787-55926809 GATATGAGTGGTCCAACTGCTGG 0: 1
1: 0
2: 0
3: 4
4: 58
1097006932_1097006937 -9 Left 1097006932 12:55926761-55926783 CCCCCAAGCCTGAAGAACCTAAA 0: 1
1: 0
2: 0
3: 23
4: 178
Right 1097006937 12:55926775-55926797 GAACCTAAAAGAGATATGAGTGG 0: 1
1: 0
2: 0
3: 26
4: 223
1097006932_1097006943 26 Left 1097006932 12:55926761-55926783 CCCCCAAGCCTGAAGAACCTAAA 0: 1
1: 0
2: 0
3: 23
4: 178
Right 1097006943 12:55926810-55926832 AGAAAAGCTAAGGGCCCGTGAGG 0: 1
1: 0
2: 0
3: 9
4: 126
1097006932_1097006942 17 Left 1097006932 12:55926761-55926783 CCCCCAAGCCTGAAGAACCTAAA 0: 1
1: 0
2: 0
3: 23
4: 178
Right 1097006942 12:55926801-55926823 AACTGCTGGAGAAAAGCTAAGGG 0: 1
1: 0
2: 1
3: 17
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097006932 Original CRISPR TTTAGGTTCTTCAGGCTTGG GGG (reversed) Intronic
900539938 1:3197590-3197612 TGTAGATTCTTCAGTCTTAGTGG - Intronic
902098760 1:13967736-13967758 ACTAGGATCTTAAGGCTTGGCGG - Intergenic
903948211 1:26977665-26977687 CTTAGCTTCTTCAGACTTTGAGG + Intergenic
904501073 1:30913223-30913245 TTTTGGTTCCTCAGTTTTGGGGG - Intergenic
904916911 1:33976899-33976921 TTTAGGTTCTTCAAGTGTCGTGG + Intronic
910173202 1:84400079-84400101 TTTAGGTTGGCCAGGCGTGGTGG + Intronic
910431292 1:87162017-87162039 TCTAGGTTTTGCAGGCTTAGAGG + Intronic
910599309 1:89013495-89013517 TTTAGGCTCTGCAGGCTAGGTGG + Intronic
910603621 1:89058307-89058329 TTTAGGCTCTTCAGGCTGGATGG + Intronic
912096493 1:106150581-106150603 TTTAGATTTTACAGGCTTGTAGG + Intergenic
912236169 1:107853560-107853582 TTTTGGTTCTTGAGGGATGGGGG - Intronic
912658892 1:111511294-111511316 TTTAGGATCTTCATGCTTTGGGG - Intronic
915466821 1:156103142-156103164 TGGAGGTTCTCCAGGGTTGGAGG - Intronic
917563400 1:176184076-176184098 TTCTGGTTCTTTAGTCTTGGAGG - Intronic
918148126 1:181775823-181775845 TTTAGGCTCTGCAGGCTGTGTGG - Intronic
920697077 1:208189132-208189154 TTCAGGATCTTAAGGCTTGGAGG - Intronic
922233943 1:223709156-223709178 TTGTGCTTGTTCAGGCTTGGGGG + Intronic
922889796 1:229052908-229052930 ATCAAGTTCTTCAGCCTTGGAGG + Intergenic
1062764773 10:52692-52714 TATACATTTTTCAGGCTTGGTGG + Intergenic
1064171653 10:13038955-13038977 TTTAGGTTCTTCTGGATTGCGGG - Intronic
1066130045 10:32384413-32384435 TTGCCCTTCTTCAGGCTTGGAGG + Intergenic
1066216731 10:33295554-33295576 TTTAAGTTAGTCAGGCATGGTGG + Intronic
1068968411 10:62937164-62937186 TTTAACTTCTTCAGGTTTGGTGG + Intergenic
1070412630 10:76156947-76156969 TTTAGGTTCTTGGTGCCTGGAGG + Intronic
1072724800 10:97806062-97806084 CTTAGGTTATTCAGGAATGGGGG - Intergenic
1077369930 11:2177107-2177129 TCTTGGTTCTTCCAGCTTGGGGG - Intergenic
1081007432 11:37763175-37763197 TTTAGATTATTCTGGCTTGTAGG + Intergenic
1082219612 11:49618319-49618341 TTTAGGTTCTTCAGCCTGGATGG + Intergenic
1083618808 11:64039035-64039057 TTCAGCTTCTTCAGGCCTTGGGG + Intronic
1085240902 11:75054296-75054318 TTCTGGTTCTTCTGGCTTGAGGG + Intergenic
1085325617 11:75604343-75604365 TTTAGGTCCTTCTGGTTTGGAGG - Intronic
1085829059 11:79880289-79880311 TTAAGGTTCTTCCTGCTTGGAGG + Intergenic
1086630020 11:89006463-89006485 TTTAGGTTCTTCAGCCTGGATGG - Intronic
1091972574 12:4799845-4799867 TTTAAGTTATCCAGGCATGGTGG - Intronic
1092677082 12:10931982-10932004 GTTAGGTTGTTCATGCTTTGTGG - Intronic
1094541147 12:31364176-31364198 TTTAGGATCTTCATGCTTGCAGG - Intergenic
1095101951 12:38194428-38194450 TATACATTTTTCAGGCTTGGTGG - Intergenic
1097006932 12:55926761-55926783 TTTAGGTTCTTCAGGCTTGGGGG - Intronic
1098199579 12:68040591-68040613 TTTAGATCCTTTATGCTTGGGGG - Intergenic
1098297845 12:69022357-69022379 TTTAGGATCTGCAGGCTAGATGG - Intergenic
1099857104 12:88181447-88181469 TTAAGTTTCTTCAGTTTTGGTGG + Intronic
1100554130 12:95675308-95675330 TTTAGGTTCTTGATTCTTGAAGG + Intronic
1101041520 12:100760732-100760754 CTTCTGTTCTGCAGGCTTGGAGG + Intronic
1101548443 12:105739052-105739074 TTTAACTTCTTCAGGCTTCAGGG + Intergenic
1106475265 13:30093023-30093045 TTTATGTGCTTGAAGCTTGGTGG + Intergenic
1106601715 13:31193566-31193588 TTCAGGTTATTCAGGTTTAGGGG - Intergenic
1106662555 13:31815342-31815364 TTGGGGTTCTTCAGGCTTCAAGG - Intergenic
1106851466 13:33797621-33797643 TTGTGGTTCCTGAGGCTTGGAGG - Intergenic
1107236763 13:38179744-38179766 TTTAGGTAGTGCAGGCTAGGTGG - Intergenic
1108957641 13:56181370-56181392 TTAAGGTTCTTCAGGTTTTCAGG + Intergenic
1109997953 13:70154431-70154453 TTTTGGTTCATCAGGGTTGGAGG + Intergenic
1111324673 13:86678118-86678140 TTTAGGTTTTTCAGATTTGGGGG + Intergenic
1112762158 13:102703628-102703650 TTCAGGATCATCAGGGTTGGTGG + Intergenic
1114512634 14:23275440-23275462 TTTGTGTTCTTCAGGGTGGGTGG - Exonic
1114804767 14:25822178-25822200 TTTGGGTTCTTCAGGCTAAGGGG - Intergenic
1116927957 14:50660309-50660331 CTTAGCTTCTCCAGTCTTGGCGG + Intronic
1117499126 14:56334677-56334699 TTTGGGTACTTGAGGCTTGCTGG + Intergenic
1117981333 14:61344823-61344845 TTAAGGTTCTTCAAGCTTTAAGG - Intronic
1125282175 15:38054184-38054206 TTTAGGTTCTGCAGGCTGTGTGG + Intergenic
1125574341 15:40745075-40745097 TGGAGGTTCCTCAGGCTTGGAGG - Exonic
1128381524 15:67116669-67116691 TTTAGGTCCCACAGGCTTTGAGG - Intronic
1129537862 15:76329014-76329036 TTTAGGTTTTGCAGACTTTGTGG - Intergenic
1131288494 15:91083497-91083519 TTTAGGTTCTTCAGGCAAAGGGG - Intergenic
1131878404 15:96835839-96835861 TCTTGGTTCATCAGGTTTGGAGG - Intergenic
1139063026 16:63278412-63278434 TATAGGTTCTTTAGGCTCTGGGG + Intergenic
1139438994 16:66954696-66954718 TTTAAGTTCTCCAGCCATGGTGG - Intergenic
1140187480 16:72788001-72788023 TTTCTGTTCTTCTGGTTTGGGGG + Exonic
1141941998 16:87283200-87283222 TTTAAATTAGTCAGGCTTGGTGG + Intronic
1142439875 16:90090526-90090548 TATACATTTTTCAGGCTTGGTGG - Intronic
1152957681 18:53028-53050 TATACATTTTTCAGGCTTGGTGG + Intronic
1155714790 18:28927917-28927939 TTGAGGTTTTTCAGCCTGGGTGG - Intergenic
1156110782 18:33724300-33724322 TTGAGGTTGTTCAAGCTTGTAGG + Intronic
1156875743 18:42008714-42008736 CTTATGTCCTTCATGCTTGGAGG + Intronic
1158763650 18:60421746-60421768 TTTTTGTTCGTCAGGCTTGGGGG + Intergenic
1161453442 19:4359107-4359129 CTGAGGTACCTCAGGCTTGGAGG + Intronic
1161993952 19:7701158-7701180 TTGGGGTCCTTCAGGCCTGGAGG + Intronic
1165964488 19:39564038-39564060 TTTATGTCCTTGAGGCGTGGGGG + Intergenic
1167202415 19:48075120-48075142 CTTATTTTCTTCAGGGTTGGAGG + Intronic
1168557376 19:57354431-57354453 TTTAGTTTCTTGTGGCTTGTTGG + Intronic
925540805 2:4965553-4965575 TGTAGGTTTTTCAAACTTGGAGG - Intergenic
926261792 2:11270994-11271016 TTTAGGTTCTACAATCTTGTGGG + Intronic
926356468 2:12045229-12045251 TTTGGAATCTTCAGGTTTGGTGG + Intergenic
926878312 2:17510727-17510749 TATATGTTCTTCCAGCTTGGGGG - Exonic
927235403 2:20869291-20869313 TTAAGGTTATTCAGGGCTGGGGG - Intergenic
930737328 2:54792973-54792995 TTTTTGATCTTTAGGCTTGGTGG + Intronic
936410604 2:112254831-112254853 CTTAGTTTCTTCTGGATTGGAGG - Intronic
939162528 2:138607122-138607144 TTCAGCTTCTTCTGTCTTGGTGG + Intergenic
940019860 2:149145517-149145539 ATGTGGTTCTTCAGGCTTGCCGG - Intronic
940189696 2:151027577-151027599 TATAGGGTCTTCAGGTTTGTGGG - Intronic
940232034 2:151465663-151465685 TTCAGCTTCATCAGGCTTTGAGG - Exonic
940525031 2:154802164-154802186 TTTAGGTTTTTAAGGATTTGGGG + Intronic
940654601 2:156472830-156472852 TTTATGTTCTTGAGCCCTGGTGG - Intronic
940965357 2:159831139-159831161 ATTATGATCTTCAGTCTTGGAGG + Intronic
943118108 2:183698830-183698852 TTGTAGTTCTTCAGGCTTCGTGG - Intergenic
945468613 2:210200992-210201014 TTTAGGCTGTTTAGGCTTGAAGG - Intronic
1169502356 20:6173159-6173181 TTTAGCTACTTCAAGTTTGGGGG - Intergenic
1169804197 20:9542590-9542612 TGTAGGTCCTTCACTCTTGGAGG + Exonic
1170912671 20:20589813-20589835 TTTAGTGTTTTCAGGCTTTGTGG - Intronic
1171776774 20:29375683-29375705 TATACATTTTTCAGGCTTGGTGG + Intergenic
1171818151 20:29807094-29807116 TATACATTTTTCAGGCTTGGTGG + Intergenic
1171900092 20:30848183-30848205 TATACATTTTTCAGGCTTGGTGG - Intergenic
1172315560 20:33951488-33951510 TTTATGATCTTCAGTGTTGGAGG + Intergenic
1172502820 20:35439050-35439072 TGCATATTCTTCAGGCTTGGGGG + Intronic
1174042338 20:47708913-47708935 TTTGGGTTTTTAAGGGTTGGGGG - Intronic
1175289337 20:57863688-57863710 TTTAAGTTCTTCAATCTGGGTGG + Intergenic
1175952575 20:62591227-62591249 TCTAGGTTCTGCAGGACTGGTGG + Intergenic
1178263001 21:31117021-31117043 TTTCAGTTCTTAAGGTTTGGGGG - Intergenic
1178562402 21:33651127-33651149 TTGAGGTCCTTCAAGCCTGGAGG + Intronic
1181677885 22:24469118-24469140 TTTATATTATCCAGGCTTGGTGG - Intergenic
1182172916 22:28251413-28251435 TTTAGGTTTTTCAGGCCCAGTGG - Intronic
1182188639 22:28435323-28435345 TTTAGGTTCTTCTAGCTAAGAGG - Intronic
1184974202 22:48049426-48049448 TGCAGTTTCTTCAGGATTGGAGG + Intergenic
949669706 3:6385098-6385120 TTGACGTTCTTCACTCTTGGTGG - Intergenic
950474931 3:13209200-13209222 TTTAGTTTCTTGGGGCTTTGTGG - Intergenic
952056133 3:29449020-29449042 CTTGGGTACTTCAGTCTTGGTGG + Intronic
954801830 3:53191613-53191635 TTTAGGCTTTTCAGGCTTGATGG + Intronic
956275668 3:67498347-67498369 ATTAAGTTCTTCAGGCTGGTAGG + Intronic
956729938 3:72187224-72187246 AGTAGGTACTTCAGGCTTTGAGG + Intergenic
957088312 3:75703967-75703989 TATACATTTTTCAGGCTTGGTGG - Intergenic
962217552 3:133535700-133535722 TTTAAATTAGTCAGGCTTGGCGG + Intergenic
962913140 3:139873304-139873326 TCTAGTTTCTTCTGGCATGGTGG + Intergenic
963263057 3:143212193-143212215 TTTAGGTTTTTGAGGCTTTTAGG + Intergenic
964580011 3:158223364-158223386 TTTAGGCTTTTCAGGCTGAGAGG + Intronic
965277532 3:166704761-166704783 TTTGGATTCTGCAGGGTTGGAGG - Intergenic
966075755 3:175935332-175935354 TCAAGGTTCTTCAGGCTTTTTGG - Intergenic
966665159 3:182463841-182463863 TTTTGATTCTACAGGCTTGTAGG + Intergenic
967826379 3:193880950-193880972 TTCAGCTTATTCAGCCTTGGTGG - Intergenic
970587512 4:17528664-17528686 TCCAGGATCTTGAGGCTTGGTGG - Intergenic
971126648 4:23761849-23761871 ATTAGGTTCTGCAGGCCTAGAGG + Intronic
972015360 4:34236511-34236533 TTGAGTTTCTGGAGGCTTGGGGG + Intergenic
973043806 4:45509864-45509886 TTTAGGTTCTCCAGTGTTGAAGG + Intergenic
975399270 4:73915924-73915946 TTTGGGTTCCTCATGCTTGTGGG + Intergenic
975473995 4:74801086-74801108 GTTAGGTTTTTCTGGTTTGGTGG + Intergenic
975506914 4:75148234-75148256 TTTTGATTTTTCAGGCTTGTAGG - Intergenic
976839359 4:89413268-89413290 TCTAAATTCTTCAGGCCTGGAGG - Intergenic
977807298 4:101316143-101316165 TGTAGGTTTTTCTGGCTGGGTGG + Intronic
981505356 4:145493466-145493488 TTTAGTTTATTCAAGCTTGAGGG + Intronic
985442612 4:189994437-189994459 TATACGTTTTTCAGGCTTGGTGG + Intergenic
985919290 5:2957017-2957039 GTTAGTTTCCTCAGTCTTGGGGG + Intergenic
987806687 5:22778233-22778255 TTTAGGTGTTTCAGCCTTGTGGG + Intronic
991431504 5:66552576-66552598 TGTAGTTTCTTCAGGCTGGAAGG + Intergenic
994313470 5:98304350-98304372 TTCAGGGTCTTCTGGCTTGTTGG + Intergenic
994670756 5:102758813-102758835 TTTAGTTTCTCCAGGGTAGGGGG + Intronic
995830794 5:116353309-116353331 TTTATGCTCTCCAGGCTTAGAGG + Intronic
997065823 5:130557134-130557156 TTTTGTTTCCTCAAGCTTGGGGG - Intergenic
998512939 5:142728806-142728828 TCTAGGCTCTGCAGGGTTGGAGG - Intergenic
1000282617 5:159795065-159795087 TTTTGGTTATTCAGGCTGGATGG + Intergenic
1001068710 5:168564057-168564079 TTTATTTTCTTTAGCCTTGGAGG - Exonic
1003515871 6:6818419-6818441 TTGAGGTTATTAAGCCTTGGTGG - Intergenic
1003834984 6:10061192-10061214 TTTAAGAACTTCAGGTTTGGGGG - Intronic
1004064248 6:12227471-12227493 GAAAGGTTCTTCAGGCCTGGGGG + Intergenic
1004295252 6:14404218-14404240 TCTAGGTTCTCCTGCCTTGGAGG + Intergenic
1006046340 6:31301915-31301937 TTTGGGTTCCTCATGCTAGGAGG + Intronic
1008224326 6:48894628-48894650 TTTAGGTTCTTTAGGGTTTTAGG + Intergenic
1008442203 6:51544554-51544576 TTTAGGACTTTCAGCCTTGGAGG + Intergenic
1010357929 6:74956976-74956998 ATCAGGTTATTCAGGCTTAGCGG - Intergenic
1011746480 6:90412222-90412244 TTAAGGGTTCTCAGGCTTGGTGG + Intergenic
1015527465 6:134187327-134187349 TTTATGATCTGCAGGCCTGGAGG - Intronic
1021577799 7:22120289-22120311 TGTAGCTTCATCTGGCTTGGTGG + Exonic
1024642184 7:51339146-51339168 TGTAGGTCCTTGAGGCTTGGTGG + Intergenic
1026513943 7:71050539-71050561 TTGAGGTTCTTTGGGCTTTGTGG - Intergenic
1026576085 7:71572799-71572821 GTGAGGCTCTGCAGGCTTGGTGG + Intronic
1028879751 7:95866800-95866822 TTGTGGTTCTTCTGGCTTGAGGG - Intronic
1029091938 7:98055349-98055371 TTTAAGTTATCCAGGCATGGTGG + Intergenic
1031803208 7:126275256-126275278 TTTTGGTTTTACAGGCTTGTAGG - Intergenic
1033301830 7:140193161-140193183 TTTAGGTTCCTCAGACTTTATGG - Intergenic
1034336495 7:150326978-150327000 CTGAGGTTCTTCTGGCTGGGAGG + Intronic
1036558705 8:9883678-9883700 TCTGGGTTCTGCAGGGTTGGAGG + Intergenic
1036965266 8:13290351-13290373 TTTTGGTTCAGCAGGCCTGGAGG + Intronic
1036976114 8:13414804-13414826 TTGAGGTTTTTGAGGCTGGGGGG + Intronic
1037165043 8:15817248-15817270 TTTAGGTTCTTCATGGTATGTGG + Intergenic
1042342617 8:67695913-67695935 TTTATGCTCTTCTGGCTTAGAGG + Intronic
1044409357 8:91867430-91867452 TTTGGGGGCATCAGGCTTGGTGG - Intergenic
1046197768 8:110885743-110885765 ATTATGTTCTGCTGGCTTGGAGG + Intergenic
1046285567 8:112088964-112088986 ATTAACTTCTTCAGGCTTTGGGG - Intergenic
1047886284 8:129253595-129253617 TTTAACTTCTTCAGGCTTAAAGG + Intergenic
1048363655 8:133719468-133719490 TTTTGTTTCTTCAGGATTAGAGG + Intergenic
1049121091 8:140738615-140738637 TTTAGATACTTCCGGGTTGGAGG + Intronic
1049821066 8:144633826-144633848 TATAGGTTCACCAGGCATGGTGG - Intergenic
1050118825 9:2287857-2287879 CCAAGGTTCTTCAGGCTTGAGGG - Intergenic
1052062077 9:23972826-23972848 TCTAATTTCTTCAGCCTTGGGGG - Intergenic
1053478733 9:38400660-38400682 CGTGGGTTCTCCAGGCTTGGAGG - Intergenic
1053700889 9:40689099-40689121 TTTAGTTTTATCAGGCCTGGAGG + Intergenic
1054312182 9:63488497-63488519 TTTAGTTTTATCAGGCCTGGAGG + Intergenic
1054410956 9:64812555-64812577 TTTAGTTTTATCAGGCCTGGAGG + Intergenic
1057547817 9:96031286-96031308 TTTTGTTTCTTTGGGCTTGGGGG + Intergenic
1058221322 9:102307170-102307192 TTTATTTTCTTCTGGCTTTGGGG + Intergenic
1059063038 9:111053416-111053438 TTTAAGCTCTTCAGGGTTAGAGG + Intergenic
1059704191 9:116804912-116804934 TTATGGTTCTTCAAGCTTTGAGG + Intronic
1059954271 9:119499710-119499732 TTTAGTCTCTTCAAGCTTGATGG + Intronic
1060100606 9:120837310-120837332 ATTCGGTTCTTCAGGCTAGGTGG - Intronic
1060101705 9:120846337-120846359 TTTAGGTTAGCCAGGCATGGTGG + Intergenic
1060720396 9:125972678-125972700 CTCAGGTTCTTCATGCTTGGAGG - Intergenic
1061107488 9:128542905-128542927 TTTAAATTTTTCAGGCATGGTGG + Intergenic
1062073164 9:134570018-134570040 TTTCCGTTTTTGAGGCTTGGGGG + Intergenic
1062740466 9:138171566-138171588 TATACATTTTTCAGGCTTGGTGG - Intergenic
1188662254 X:32774929-32774951 TTTTGGTTTTACAGGCTTGTAGG - Intronic
1189379633 X:40493115-40493137 TCTAGTTTCTAGAGGCTTGGGGG + Intergenic
1190381903 X:49847278-49847300 TGTAGGTTAGACAGGCTTGGTGG + Intergenic
1201068491 Y:10122700-10122722 TATACATTTTTCAGGCTTGGTGG - Intergenic
1201759958 Y:17525936-17525958 TATACATTTTTCAGGCTTGGTGG + Intergenic
1201841596 Y:18380054-18380076 TATACATTTTTCAGGCTTGGTGG - Intergenic