ID: 1097011400

View in Genome Browser
Species Human (GRCh38)
Location 12:55955884-55955906
Sequence CAAATTAGGATTCCTCTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097011397_1097011400 1 Left 1097011397 12:55955860-55955882 CCCTCTGCAGAGTTGCAAGCTTA 0: 1
1: 0
2: 0
3: 15
4: 145
Right 1097011400 12:55955884-55955906 CAAATTAGGATTCCTCTACCTGG 0: 1
1: 0
2: 0
3: 20
4: 99
1097011396_1097011400 27 Left 1097011396 12:55955834-55955856 CCTGCAGGATCTCGGCACTTTCA 0: 1
1: 0
2: 0
3: 8
4: 69
Right 1097011400 12:55955884-55955906 CAAATTAGGATTCCTCTACCTGG 0: 1
1: 0
2: 0
3: 20
4: 99
1097011398_1097011400 0 Left 1097011398 12:55955861-55955883 CCTCTGCAGAGTTGCAAGCTTAT 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1097011400 12:55955884-55955906 CAAATTAGGATTCCTCTACCTGG 0: 1
1: 0
2: 0
3: 20
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097011400 Original CRISPR CAAATTAGGATTCCTCTACC TGG Intronic
906228733 1:44142161-44142183 CAAATTAAGAGTCTTCCACCTGG - Intergenic
908848557 1:68350198-68350220 CAAAATGGGATTCCTCTAATGGG + Intergenic
915394480 1:155572314-155572336 TAAATTAGTAGTTCTCTACCAGG - Intergenic
916187530 1:162147514-162147536 CACATTATGATTCGTGTACCAGG + Intronic
918899073 1:190389304-190389326 CAAATTAGGATTCTACTAAGAGG - Intronic
919645417 1:200089873-200089895 AAAATTAGAATTCCTCAACCAGG + Intronic
922362955 1:224839798-224839820 CAAAGTATATTTCCTCTACCAGG + Intergenic
922819978 1:228477654-228477676 CAAATTTGGTTTTCTCTCCCAGG - Intergenic
1064897438 10:20254066-20254088 CAAACTAGAATTCCTCACCCCGG + Intronic
1070979089 10:80630204-80630226 CAAAGCAAGATTCCTCTAGCAGG - Intronic
1071360293 10:84839698-84839720 CAAATAAGGTTTGCTGTACCAGG + Intergenic
1072495567 10:95954705-95954727 AAAATTGGGTTTCCTCTTCCAGG + Intronic
1073910570 10:108338309-108338331 CAAGTTAGAACTCCTCTCCCAGG - Intergenic
1074112068 10:110429764-110429786 CAAAGTTGAATTCCTCCACCAGG + Intergenic
1078409783 11:11105005-11105027 CAAATTCTGTTTCTTCTACCAGG - Intergenic
1079524945 11:21374840-21374862 CAAACTGGGATTCAGCTACCAGG + Intronic
1080976155 11:37342797-37342819 GAAATTAGATTTCATCTACCTGG - Intergenic
1082203918 11:49407597-49407619 CATTTAAAGATTCCTCTACCAGG + Intergenic
1086221898 11:84455768-84455790 CAAATTAGGACTCCACATCCAGG + Intronic
1088291233 11:108239809-108239831 AAAATGAGGATTCCTCTTCTAGG + Intronic
1089096384 11:115923254-115923276 CACATTAAGATTCCTCTCCAAGG - Intergenic
1090415487 11:126537443-126537465 CATATTATGATTCCTCCTCCAGG - Intronic
1095382612 12:41614022-41614044 CAAAGTAGCATCCCCCTACCAGG - Intergenic
1097011400 12:55955884-55955906 CAAATTAGGATTCCTCTACCTGG + Intronic
1098651791 12:72979767-72979789 CAAACTAGGAATCTTCTGCCAGG + Intergenic
1109791379 13:67252861-67252883 TAAATTAGGATTCTTCAACCTGG + Intergenic
1110570961 13:77002945-77002967 CAAATGAGGATATCTGTACCTGG + Intronic
1112169684 13:96958018-96958040 CAAATTAGGATTCCTAAAACAGG + Intergenic
1118626298 14:67662440-67662462 CAAATTTTGTTTCTTCTACCTGG - Intronic
1125846171 15:42856460-42856482 CAAATTAGGATTTATATACAAGG - Intronic
1126502631 15:49363026-49363048 CAAATTCAGATTCCACTACAAGG - Intronic
1126964996 15:54042002-54042024 CAGATTAGGAATGCTCAACCTGG - Intronic
1130876967 15:88022946-88022968 CAGATTAGCATTCATCTCCCTGG - Intronic
1131063574 15:89418930-89418952 CTCATCAGGATTCCTCTTCCAGG - Intergenic
1131662670 15:94535265-94535287 AATATTTGGATTACTCTACCAGG - Intergenic
1132482155 16:172172-172194 CAGATTCAGACTCCTCTACCCGG - Intergenic
1132483003 16:175976-175998 CAGATTCAGACTCCTCTACCCGG - Intergenic
1138087752 16:54149163-54149185 CAAATTAGGACTCCCCTCTCTGG + Intergenic
1138740494 16:59303569-59303591 GAAATCATGTTTCCTCTACCTGG - Intergenic
1140939572 16:79708734-79708756 TAAATAAGGCTTTCTCTACCAGG + Intergenic
1141248106 16:82329684-82329706 CCAATAAACATTCCTCTACCTGG - Intergenic
1152847069 17:82607708-82607730 CAGATTAGGAATACTCAACCTGG - Intronic
1155243733 18:23887364-23887386 GAAATTAGGACGCCTCTCCCAGG - Intronic
1155806764 18:30179690-30179712 CAAATTTGGTTTCCTCTTTCCGG - Intergenic
1156780867 18:40849025-40849047 CAAATCAGAATTCCTGTTCCAGG + Intergenic
1159746610 18:72243475-72243497 CAAATTTGGGTCACTCTACCTGG - Intergenic
1160914472 19:1490163-1490185 CAAATTCGGCTTCGTCAACCTGG - Exonic
1166251382 19:41573250-41573272 CAACTGAGGATTCCTCTCCTGGG - Intronic
928444611 2:31322040-31322062 CAATTTAGGAATTCTCTATCAGG - Intergenic
934540701 2:95171997-95172019 TATATACGGATTCCTCTACCCGG - Intronic
936174606 2:110208814-110208836 CTCATTAGGTTTCCTTTACCAGG - Intergenic
936578167 2:113672484-113672506 CAAAATAGGGAACCTCTACCAGG - Intergenic
939636850 2:144592451-144592473 CACATTAAGATTCCTCTCCCAGG - Intergenic
940512324 2:154632490-154632512 CAAAATAGAATTCCTTGACCTGG - Intergenic
941583113 2:167324969-167324991 GATATTTGCATTCCTCTACCTGG + Intergenic
1169180720 20:3564403-3564425 CAAACTGGGTTTCCTCTGCCTGG - Intronic
1175497639 20:59425812-59425834 CAAATTAAGTTTCCTCTGTCTGG - Intergenic
1176661465 21:9638712-9638734 AAAATTATCATACCTCTACCAGG - Intergenic
1177219627 21:18175200-18175222 TAAATGAGGATTCCTTTACTGGG - Intronic
1179243109 21:39609166-39609188 CTAATTAGAATGCCTCTGCCTGG - Intronic
1180571163 22:16721504-16721526 CAAATTATAATGCCTCTCCCAGG - Intergenic
1183739230 22:39660973-39660995 CTAAGGAGGCTTCCTCTACCAGG - Intronic
951017658 3:17747432-17747454 CAAAGGAGGATTCCTCTAACAGG + Intronic
951049677 3:18080168-18080190 CAAATTATGATTTTTCTCCCTGG + Intronic
951178296 3:19627989-19628011 TAAATAATGATTCCTCTACCAGG + Intergenic
955835564 3:63050869-63050891 AAAATTAAGATGCCACTACCAGG - Intergenic
955986424 3:64578179-64578201 CAATTTAGCATTGCTCTATCGGG + Intronic
958475345 3:94573818-94573840 CAAATTATAATTACTCTTCCAGG - Intergenic
960164493 3:114386188-114386210 CAATTTATCATTTCTCTACCTGG + Intronic
961577656 3:127850955-127850977 CAAATTAGGATTGCTCTGGCTGG - Intergenic
962482648 3:135810987-135811009 CCAATGTGGATTCCTCTAACAGG - Intergenic
964092966 3:152897636-152897658 GAAAATAGGATTCCTCTATTTGG - Intergenic
965790984 3:172387719-172387741 TAAACCAGGAGTCCTCTACCTGG - Intronic
967108365 3:186271794-186271816 CACATGAGGCTTCCTCTGCCTGG + Intronic
967456412 3:189691404-189691426 CAACTCAGGATTTCTCAACCTGG + Intronic
968878627 4:3287385-3287407 CAAATTGGTATTCCTCCAGCTGG + Intergenic
972361958 4:38334509-38334531 CAAATCAGGATTTCACTACCTGG - Intergenic
973007641 4:45032420-45032442 CAAATTAGGAATCCGTTACCTGG - Intergenic
980971882 4:139574626-139574648 CTAATTATGATTCCTCTACTCGG + Intronic
981263770 4:142756024-142756046 CAAATTATGATTCCCCTCCAGGG - Intronic
981488755 4:145317611-145317633 CCAATCAGGATTCCTCTCACAGG + Intergenic
982860925 4:160447919-160447941 GAAATTAGGTTTCCACTACACGG + Intergenic
984016728 4:174435506-174435528 CAATTTAGGATTTGTCTGCCAGG - Intergenic
993845114 5:92932002-92932024 CAAATTAGGACTCCTCTTCATGG + Intergenic
994135329 5:96279999-96280021 CAAATAAACATGCCTCTACCTGG - Intergenic
994371773 5:98975786-98975808 GCAATGAGGATTCCTGTACCAGG - Intergenic
999674178 5:153982471-153982493 CAAATGAGGATTCCTTAACTAGG + Intergenic
1000889778 5:166788575-166788597 CAGATGAGGATTTCTCTTCCAGG - Intergenic
1011940933 6:92842300-92842322 CACATTATACTTCCTCTACCCGG + Intergenic
1018946893 6:168353962-168353984 CAGATCAGGTTTCCTCTTCCAGG - Intergenic
1019113700 6:169739162-169739184 CAAATTGGGACTCTTCTAGCAGG - Intergenic
1019675280 7:2307906-2307928 CAAAACAGAATTCCCCTACCCGG + Intronic
1024217496 7:47259736-47259758 CAAAATAGGAAACATCTACCTGG - Intergenic
1024446393 7:49484478-49484500 CTAACTAGCTTTCCTCTACCTGG + Intergenic
1030238807 7:107296257-107296279 AAAATTAGGATTCCACCTCCTGG + Intronic
1033733086 7:144196975-144196997 CAAAGTAGGAATCCTTTACCTGG + Intergenic
1033743938 7:144295541-144295563 CAAAGTAGGAATCCTTTACCTGG + Intergenic
1033749963 7:144354013-144354035 CAAAGTAGGAATCCTTTACCTGG - Intergenic
1038163432 8:25062082-25062104 AAAATCAGCATTCCTCTCCCAGG + Intergenic
1042008244 8:64207491-64207513 ATAATTAGGACTCCTCTACAAGG - Intergenic
1043246667 8:78011952-78011974 CTAATTAGGAGTGCTCTAACAGG + Intergenic
1043758987 8:84041540-84041562 CAATTTAGGATTGCTTTATCAGG + Intergenic
1045660131 8:104428642-104428664 CAAAGCAGGATTCCTGTCCCTGG - Intronic
1049261781 8:141642884-141642906 CAAATAAGGATTTCCCTGCCAGG + Intergenic
1053650255 9:40161479-40161501 CAAATTAGGAATCCATTACCTGG + Intergenic
1053755483 9:41302447-41302469 CAAATTAGGAATCCATTACCTGG - Intergenic
1054330760 9:63753253-63753275 CAAATTAGGAATCCATTACCTGG + Intergenic
1054534326 9:66214724-66214746 CAAATTAGGAATCCATTACCTGG - Intergenic
1054745547 9:68850659-68850681 CAAATAACAAGTCCTCTACCAGG + Intronic
1055297672 9:74850931-74850953 CAAATAATGATTCATCTGCCTGG + Intronic
1058395255 9:104545074-104545096 CAAAGTTGGATTTCTTTACCAGG - Intergenic
1061759669 9:132841751-132841773 CAAACTGGGATTCATCCACCAGG + Intronic
1202798145 9_KI270719v1_random:146166-146188 CAAATTAGGAATCCATTACCTGG + Intergenic
1203639030 Un_KI270750v1:140555-140577 AAAATTATCATACCTCTACCAGG - Intergenic
1194150393 X:90318252-90318274 CAAAATAGAATTCCACTAACTGG + Intergenic
1194379555 X:93176697-93176719 AAAATTAGGATTCCTAGGCCGGG - Intergenic
1194455011 X:94092939-94092961 TAAATAAAGATTTCTCTACCTGG + Intergenic
1194571296 X:95557610-95557632 AAAATTAGGAATCATCTACCTGG + Intergenic
1198381554 X:136088573-136088595 CAATTTAGGATTTTTCTATCAGG - Intergenic
1200496758 Y:3895009-3895031 CAAAATAGAATTCCACTAACTGG + Intergenic