ID: 1097014330

View in Genome Browser
Species Human (GRCh38)
Location 12:55974429-55974451
Sequence CTCTTCAGCGCTGCTTAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 83}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097014330_1097014342 14 Left 1097014330 12:55974429-55974451 CCTCATTAAGCAGCGCTGAAGAG 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1097014342 12:55974466-55974488 AAGGAACAGGGCAGCGGGTGAGG 0: 1
1: 0
2: 4
3: 31
4: 396
1097014330_1097014338 1 Left 1097014330 12:55974429-55974451 CCTCATTAAGCAGCGCTGAAGAG 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1097014338 12:55974453-55974475 GAGGAGCTGGGGAAAGGAACAGG 0: 1
1: 0
2: 6
3: 91
4: 802
1097014330_1097014337 -5 Left 1097014330 12:55974429-55974451 CCTCATTAAGCAGCGCTGAAGAG 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1097014337 12:55974447-55974469 AAGAGGGAGGAGCTGGGGAAAGG 0: 1
1: 1
2: 13
3: 174
4: 1495
1097014330_1097014339 2 Left 1097014330 12:55974429-55974451 CCTCATTAAGCAGCGCTGAAGAG 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1097014339 12:55974454-55974476 AGGAGCTGGGGAAAGGAACAGGG 0: 1
1: 0
2: 9
3: 93
4: 777
1097014330_1097014336 -10 Left 1097014330 12:55974429-55974451 CCTCATTAAGCAGCGCTGAAGAG 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1097014336 12:55974442-55974464 CGCTGAAGAGGGAGGAGCTGGGG 0: 1
1: 0
2: 5
3: 57
4: 497
1097014330_1097014343 30 Left 1097014330 12:55974429-55974451 CCTCATTAAGCAGCGCTGAAGAG 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1097014343 12:55974482-55974504 GGTGAGGTAAGCCCATTTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 81
1097014330_1097014340 8 Left 1097014330 12:55974429-55974451 CCTCATTAAGCAGCGCTGAAGAG 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1097014340 12:55974460-55974482 TGGGGAAAGGAACAGGGCAGCGG 0: 1
1: 1
2: 8
3: 82
4: 878
1097014330_1097014341 9 Left 1097014330 12:55974429-55974451 CCTCATTAAGCAGCGCTGAAGAG 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1097014341 12:55974461-55974483 GGGGAAAGGAACAGGGCAGCGGG 0: 1
1: 0
2: 6
3: 61
4: 642

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097014330 Original CRISPR CTCTTCAGCGCTGCTTAATG AGG (reversed) Intronic
902388401 1:16088907-16088929 CTCTTCACCTCTGATTTATGAGG + Intergenic
906093715 1:43205323-43205345 CTCTACAGCTCTGCTTGAGGGGG - Intronic
916247251 1:162700955-162700977 CTCCTGAGCACTGCTGAATGTGG - Intronic
918495597 1:185132184-185132206 CTCTTCAGCTCTGATAAATTTGG - Intronic
920723611 1:208413145-208413167 CTATGCAGGGCTGCTTGATGAGG - Intergenic
921460316 1:215417699-215417721 ATCTTTAGCTTTGCTTAATGAGG - Intergenic
922159005 1:223064446-223064468 CTGTTCTGCACTGCTCAATGTGG + Intergenic
1074998755 10:118779713-118779735 CTCTTCTCCCCTGCTCAATGAGG + Intergenic
1076085558 10:127627066-127627088 ATCTTCAGATCTGCTGAATGAGG - Intergenic
1076677394 10:132154143-132154165 CTCTCCAGAGCTGCCTGATGGGG + Intronic
1082005261 11:47415650-47415672 CTCTTCCTCGCTGCTTACTCCGG - Exonic
1084377240 11:68785981-68786003 CTCTTAAGCACTGCTCAGTGGGG + Intronic
1092294683 12:7189099-7189121 CTCTCCACCTCTGCATAATGGGG - Intronic
1093149135 12:15601340-15601362 CTCTTTAGTATTGCTTAATGTGG - Intergenic
1093254266 12:16846062-16846084 CTCTTCAGCTGTGCTTCATCTGG - Intergenic
1094261874 12:28509732-28509754 CTCTTCAGCGCTGATGATTATGG + Intronic
1097014330 12:55974429-55974451 CTCTTCAGCGCTGCTTAATGAGG - Intronic
1103946185 12:124527991-124528013 CCCTTCAGCGCAGCCTGATGAGG + Intronic
1113232970 13:108236429-108236451 CTCTTCTGCTCTGCTTAAGAAGG - Intergenic
1116101766 14:40447183-40447205 CGATTCAGCGCTGCTCAATGTGG - Intergenic
1120514452 14:85453569-85453591 CTCTTCTGCTCAGCTAAATGAGG - Intergenic
1120696555 14:87651338-87651360 CTCTTGATTGCTTCTTAATGTGG - Intergenic
1121990465 14:98552122-98552144 CTCCTCTGTGCAGCTTAATGAGG - Intergenic
1127938699 15:63670657-63670679 CTTTTCAGCTCTGATTAGTGTGG - Intronic
1131743316 15:95417988-95418010 CTTTTGAGAGCTGCTTCATGGGG + Intergenic
1140515071 16:75535573-75535595 ATCTTCAGCGCTGCCTGGTGAGG + Intronic
1144416540 17:15052996-15053018 CTCCTCAGGAATGCTTAATGAGG - Intergenic
1155086032 18:22458914-22458936 CTGTGCAGCCCTGCTTAAGGCGG + Intergenic
1161747906 19:6072775-6072797 CTCTTCAGTGCTGCCTACGGAGG + Intronic
1163599520 19:18240392-18240414 CTCTTCAGCCCGGCTTACAGAGG + Intronic
1166590045 19:43989405-43989427 CTCCTCAGCGCAGCGGAATGAGG + Intronic
1167266946 19:48487939-48487961 CTCCTCTGCCCTGCTCAATGTGG - Intronic
932049724 2:68386569-68386591 TGCTTCATCGCTGCTCAATGAGG + Exonic
933854184 2:86397325-86397347 CTCTCCAGGTCTGCTAAATGGGG + Intergenic
936753572 2:115676735-115676757 TTCTTCTTCTCTGCTTAATGTGG - Intronic
937101025 2:119269204-119269226 CTTTTAAGAGCTGCTTAGTGTGG - Intergenic
939152618 2:138491050-138491072 TTATTCAGTGCTGCTTATTGTGG - Intergenic
947108617 2:226694867-226694889 TTTTTCATTGCTGCTTAATGTGG - Intergenic
947170013 2:227301379-227301401 CTCATCAGTGATGCGTAATGAGG + Intronic
948440359 2:237983268-237983290 CTCTTCAGCGGAGCTGAGTGTGG - Intronic
1173362004 20:42353091-42353113 CCCTTCAGCGCTTCTTCATTTGG + Intronic
1176428646 21:6563370-6563392 CTCTGCAGCCCTACCTAATGTGG - Intergenic
1178542271 21:33463349-33463371 CTCTTCAAAGCTGCTTTATTTGG + Intronic
1179704136 21:43171686-43171708 CTCTGCAGCCCTACCTAATGTGG - Intronic
1180705786 22:17808969-17808991 CTCTCCAGCCCTGCTTCAGGAGG + Intronic
1180708471 22:17824014-17824036 CCCTTCAGGGCTGCAAAATGAGG + Intronic
1181022987 22:20113220-20113242 CTCTTCAGAGTTGAGTAATGTGG - Exonic
1181152070 22:20891635-20891657 ATCTTCAGCTCTGATGAATGCGG + Intergenic
1182002615 22:26932977-26932999 ATATTCAGGGCTGCTTGATGAGG - Intergenic
1185006886 22:48283987-48284009 CTTTTTAGAGCTTCTTAATGTGG - Intergenic
950445162 3:13032936-13032958 CCCTGCAGAGCTGCTTTATGAGG - Intronic
950908146 3:16557310-16557332 CTCCTCAGAGCTGCTACATGGGG + Intergenic
950925615 3:16738191-16738213 CTCTTCAGCTCATCTTAATGTGG + Intergenic
951833752 3:26959223-26959245 CTCTTCAGAGCTGCCAGATGGGG + Intergenic
960950525 3:122995969-122995991 ATCTTAAGAGCTGCTGAATGAGG - Intronic
961102421 3:124211687-124211709 GTCTTCATCGCTGCATGATGAGG + Intronic
961125797 3:124416464-124416486 CTCTTCAGTGCCTCTTACTGAGG + Intronic
964433299 3:156626987-156627009 CTATTCTGGGCTTCTTAATGGGG - Intergenic
966910572 3:184557400-184557422 CTCTTCAGCACTGCCTTCTGGGG + Intronic
969203902 4:5627479-5627501 CTCTCCTGCTCTGTTTAATGAGG - Intronic
971017332 4:22501935-22501957 CTTTTCAGAGCTCCTTGATGGGG - Intronic
977176451 4:93826168-93826190 TTCCTCAGCTCTGCCTAATGGGG + Intergenic
980549437 4:134314989-134315011 CACTTCACAGCTGCTTAAAGAGG + Intergenic
985832992 5:2249729-2249751 CTCTTCATTGCTGCCCAATGGGG - Intergenic
997237141 5:132279266-132279288 CACTTAAGGGCTGGTTAATGCGG - Intronic
997855238 5:137367342-137367364 CTCAACAGCGCTGCTTCTTGCGG - Intronic
1001377012 5:171269577-171269599 CTCTTCAGGGCTGATTTATAAGG - Intronic
1002136758 5:177112531-177112553 CTCATCCTCCCTGCTTAATGTGG - Intergenic
1004399017 6:15271293-15271315 CACTTCAGTCCTGCTGAATGAGG - Intronic
1006687216 6:35845892-35845914 CACTTCAGCCTTTCTTAATGTGG - Intronic
1007238891 6:40411125-40411147 CTCTCCAGCACTGTTTATTGAGG + Intronic
1013342079 6:109224721-109224743 CTGTTCAGCACTGCTTGATGTGG - Intergenic
1017030139 6:150213957-150213979 CTCTTCAGCTCTGCCTAACGTGG + Intronic
1017241943 6:152180280-152180302 CTTTTCAGCTCTCCTTAAGGCGG - Exonic
1018662918 6:166105079-166105101 CCCTTCAGCGCACCTTTATGTGG + Intergenic
1024816173 7:53274691-53274713 CTCTTCAATGCTGCTCATTGTGG - Intergenic
1026798546 7:73381916-73381938 CTCTTCAGCTATGGTCAATGTGG - Intergenic
1033181545 7:139184201-139184223 CTTTTCAGATCTGCTTAATAGGG + Intronic
1035659377 8:1335266-1335288 CTCTTTAGGGCGGCCTAATGAGG + Intergenic
1036176314 8:6541387-6541409 CTCTCCAGCGCTGCTGACTGGGG - Intronic
1037848469 8:22305917-22305939 CTCTTCAAAGCTGCTAAAAGGGG + Exonic
1043123083 8:76355535-76355557 TTTTTCAGTTCTGCTTAATGTGG - Intergenic
1046777482 8:118179475-118179497 GTCTTCAGGGATGCTTAATGTGG + Intergenic
1050472281 9:6006957-6006979 CTCTTCAGCGCTGCAGACTCGGG + Intronic
1056779102 9:89535977-89535999 CTCGTCAGGCCTGCTTCATGGGG - Intergenic
1061998826 9:134205504-134205526 CTCTGCAGGGATGCTTGATGGGG + Intergenic
1187244280 X:17539789-17539811 CTCCTCAGTGCTCTTTAATGGGG + Intronic
1187900517 X:24023683-24023705 CTCTTCATTGCTGATTAATTTGG - Intronic
1197569244 X:128128675-128128697 CTCTGCTGAGCTGCTTATTGTGG + Intergenic
1199668187 X:150118862-150118884 CACTTCAGGGCTGCTCACTGCGG + Intergenic