ID: 1097014355

View in Genome Browser
Species Human (GRCh38)
Location 12:55974522-55974544
Sequence ACCTGTCGCCCGAGCCCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097014347_1097014355 6 Left 1097014347 12:55974493-55974515 CCCATTTGCCGGGAGGTGAGGAG 0: 1
1: 0
2: 1
3: 27
4: 350
Right 1097014355 12:55974522-55974544 ACCTGTCGCCCGAGCCCCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 85
1097014348_1097014355 5 Left 1097014348 12:55974494-55974516 CCATTTGCCGGGAGGTGAGGAGG 0: 1
1: 0
2: 3
3: 24
4: 228
Right 1097014355 12:55974522-55974544 ACCTGTCGCCCGAGCCCCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 85
1097014351_1097014355 -2 Left 1097014351 12:55974501-55974523 CCGGGAGGTGAGGAGGGTCAGAC 0: 1
1: 0
2: 3
3: 31
4: 383
Right 1097014355 12:55974522-55974544 ACCTGTCGCCCGAGCCCCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097014355 Original CRISPR ACCTGTCGCCCGAGCCCCGG GGG Intronic
901642541 1:10700170-10700192 GCCTGTGGCCCCAGCCCGGGCGG + Intronic
901643487 1:10704801-10704823 GCCTGGGGCCCGAGGCCCGGTGG + Intronic
903329332 1:22589150-22589172 ACCTGAGCCCCGAGCCCCGCCGG + Exonic
904181441 1:28669105-28669127 GTCTGGGGCCCGAGCCCCGGCGG - Intronic
906315855 1:44786119-44786141 ACCTGGCGGCCCAGGCCCGGAGG - Exonic
909616564 1:77616739-77616761 ACCTGTAGTCCCAGCCCAGGAGG + Intronic
921261634 1:213389603-213389625 ACCTGGAGCCCGGGCCTCGGGGG - Intergenic
923298854 1:232621852-232621874 ACCTGTCGACCTAGCCACTGGGG - Intergenic
1062883463 10:997715-997737 ACCTGCCACCGGAGCCCCGCTGG - Intronic
1069505201 10:68991191-68991213 GCCTGGCCCCAGAGCCCCGGTGG - Intronic
1069545042 10:69321542-69321564 GTCTGTCTCCAGAGCCCCGGAGG - Intronic
1069651502 10:70053102-70053124 GCCTCTCCCCCGAGCCCCTGCGG + Intronic
1075096480 10:119474812-119474834 ATCTGTCCCCTGAGCCCGGGAGG + Intergenic
1083901779 11:65646815-65646837 GCCGCTCGCCTGAGCCCCGGCGG - Exonic
1089338916 11:117744639-117744661 CCCAGTAGCCAGAGCCCCGGGGG + Intronic
1091794421 12:3289436-3289458 ACCTGTTCCCTGAGCCCCTGCGG - Intergenic
1097014355 12:55974522-55974544 ACCTGTCGCCCGAGCCCCGGGGG + Intronic
1098331650 12:69359870-69359892 TCCTGTCGCGCGGGCCCAGGCGG - Exonic
1098470201 12:70834048-70834070 AACTGTAGCCCAAGCCCAGGAGG - Intronic
1102027018 12:109719453-109719475 CCCTGTCGCCCGTGTCCCAGTGG + Intronic
1102787874 12:115619141-115619163 ACCTCTCAGCCCAGCCCCGGGGG - Intergenic
1103856043 12:123972337-123972359 ACGTGGCTCCCAAGCCCCGGAGG + Intronic
1111518205 13:89363153-89363175 ACCTGTCGCTCCAGCAGCGGCGG + Intergenic
1122112560 14:99512597-99512619 TCCTTTCGCCCCAGCCCAGGTGG - Exonic
1122317610 14:100835272-100835294 ACCTGTGGCCAAAGCCCGGGGGG - Intergenic
1122406843 14:101505787-101505809 ACGTGTGTCCCCAGCCCCGGGGG - Intergenic
1122854761 14:104554759-104554781 AGCTGTCACCCCAGCCCCCGCGG + Intronic
1124826033 15:33096687-33096709 ACTTGTCACCTGAGCCCGGGAGG - Intronic
1128721103 15:69948952-69948974 ACCTGTAGTCCTAGCCCAGGAGG - Intergenic
1129644734 15:77419827-77419849 ACCGGCCGCCAGAGCCCCGGCGG + Intronic
1129738792 15:77979932-77979954 CTCTGTGGCCCCAGCCCCGGGGG - Intergenic
1130254733 15:82320640-82320662 CTCTGTGGCCCCAGCCCCGGGGG - Intergenic
1130600240 15:85269366-85269388 CTCTGTGGCCCCAGCCCCGGGGG + Intergenic
1130649785 15:85756032-85756054 ACCTGGCGCTCGGGCCCCTGAGG - Intergenic
1132653513 16:1031945-1031967 ACGTGTCGCCCCAGCCCTGCCGG + Intergenic
1132675072 16:1118136-1118158 CCCTGTAGCCCCAGCCCCCGGGG - Intergenic
1135350927 16:21728329-21728351 AGCAGTCGCCCAAGCCCTGGGGG - Exonic
1136547681 16:30964977-30964999 ACCTGCCCCCCGAGCCCAGCCGG + Exonic
1138496100 16:57410307-57410329 ACCTGCCGCCCTTGCCCCAGGGG - Intronic
1139954334 16:70686074-70686096 ACGTGACGCCCGATCCTCGGCGG - Intergenic
1141720090 16:85751140-85751162 TCCTGGCGCCCGCGGCCCGGCGG - Intergenic
1143464980 17:7130757-7130779 ACCTGGCACCTGAGCCCCAGAGG + Intergenic
1143879594 17:10019802-10019824 ACCTGTCGCCTCAGGGCCGGCGG - Exonic
1144759666 17:17700319-17700341 TCCTGTCGCCCGGCCCCAGGCGG + Intronic
1146208158 17:30922260-30922282 ACCTCTCACCCGAGCCCCGAGGG + Intronic
1147015541 17:37489318-37489340 CCGTGGCGCCCGAGACCCGGAGG - Intergenic
1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG + Exonic
1147994158 17:44352198-44352220 ACCTGCTGCCCGAGCCTGGGTGG + Exonic
1149585506 17:57783448-57783470 CCCTGCTGCCCGAGCCCGGGTGG + Intergenic
1151724949 17:75878290-75878312 ACCCGGGGCCCGAGCCCTGGCGG + Exonic
1162445075 19:10718035-10718057 ACCTCCCGCCCCGGCCCCGGGGG - Intergenic
1162957611 19:14107815-14107837 ACCTGCTACCCGAGCCCCCGAGG - Intronic
1163851806 19:19668699-19668721 TCCTGTCGCTCAAGCCCCAGGGG + Intergenic
1164693542 19:30227582-30227604 ACCGGGTGCCCGAGCCCCGCAGG - Intergenic
1165423253 19:35732597-35732619 AGCTGTCCCCCGGGCCCCCGTGG - Exonic
927809358 2:26173081-26173103 ACGTGACGCCCGCGGCCCGGCGG + Exonic
944615183 2:201452056-201452078 ACCTCCAGCCCGAGCACCGGCGG + Intronic
1171959841 20:31485692-31485714 CCCAGACGCCCCAGCCCCGGGGG + Intergenic
1174410309 20:50330846-50330868 ACCTGTCAAGCGAGCCCCGGAGG + Intergenic
1175861072 20:62150740-62150762 ACCTGTCCCTTGAGCCCAGGAGG - Intronic
1179971089 21:44836932-44836954 AGCTGTCGCCAGAGCCACGTGGG + Intergenic
1181172775 22:21019218-21019240 AGCTGTCCCCTGAGCCCTGGTGG + Intronic
1183831142 22:40418897-40418919 TCCTGTTGCCTGAGCCCTGGGGG - Exonic
1184121982 22:42457560-42457582 AGCTTAAGCCCGAGCCCCGGAGG - Intergenic
1184789601 22:46691687-46691709 GCTTGTCGCCGGAGCCCCAGGGG - Exonic
952316728 3:32238564-32238586 ACCTGTTGCCCGACTCCCAGCGG - Intergenic
959530738 3:107431549-107431571 CGCTTCCGCCCGAGCCCCGGCGG - Intergenic
964851873 3:161104618-161104640 TCCTGTAGCCCTAGCCCCGTGGG + Intronic
966892465 3:184417344-184417366 CCCTGTCGCCCAAGGCCCAGAGG + Intronic
969051932 4:4379379-4379401 ATCTGTCACCCAAGCCTCGGTGG + Intronic
975584740 4:75939219-75939241 CCCTGTCGCCCCAGCCCTGGTGG + Intronic
976732963 4:88283234-88283256 GCCTGTGGTCCCAGCCCCGGAGG - Intronic
981061095 4:140426883-140426905 CCCTTTCGCCCGCCCCCCGGCGG + Intronic
983499200 4:168480205-168480227 AGCTGCCGCCCGAGCCCAGTGGG + Intronic
993716282 5:91278604-91278626 ACCTGTAGCCCCAGCCCCTGGGG + Intergenic
1002029337 5:176416443-176416465 CGCTGTCACCCGAGCCGCGGGGG + Exonic
1002189956 5:177473091-177473113 ACCTGTCCCCCGGGCCCGGGGGG + Exonic
1016447781 6:144150596-144150618 ACCTGTTGCGCGACTCCCGGCGG - Exonic
1019198485 6:170296073-170296095 ACCTGCGGCCGGAGCACCGGCGG + Intronic
1019273072 7:161396-161418 ACCTGTCCCCCCAGGCCTGGAGG - Intergenic
1019614134 7:1951245-1951267 ACCTGCTGCCTGAGCCCCTGAGG - Intronic
1024561065 7:50645805-50645827 AACTGTCACCAGAGCCCCAGTGG + Intronic
1029110011 7:98208966-98208988 GCCTGTCCCCAGGGCCCCGGTGG + Exonic
1035312849 7:157980968-157980990 ACCTGTCCCCAGAGCCCGTGTGG - Intronic
1038632938 8:29262935-29262957 ACCTGCCGCCTCCGCCCCGGCGG + Intronic
1042253067 8:66775401-66775423 ACCTGCCTCCCGCGCCCCCGGGG - Intronic
1048294233 8:133202795-133202817 ACCTGTATCCCGGGCCCTGGTGG - Intronic
1049198122 8:141326474-141326496 CCCTGCCGCCCCACCCCCGGTGG - Intergenic
1049694033 8:143974988-143975010 ACCTGCCGGCCGCGCCCAGGCGG - Intronic
1050094307 9:2047528-2047550 ACCTGCCGCCCAAGCCGAGGGGG + Intronic
1057463029 9:95283204-95283226 ACCTGTAGTCCCAGCCCCTGGGG - Intronic
1061925159 9:133802607-133802629 ACCCGTGGCCCGAGCTCCGTGGG + Intronic
1201191657 Y:11448664-11448686 AACTGTTGCCTGAGCCCTGGGGG + Intergenic