ID: 1097014758

View in Genome Browser
Species Human (GRCh38)
Location 12:55977774-55977796
Sequence AACTGAATAAGGAGCTACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097014756_1097014758 -2 Left 1097014756 12:55977753-55977775 CCATTGACTCAACAGTAACTGAA 0: 1
1: 0
2: 0
3: 17
4: 172
Right 1097014758 12:55977774-55977796 AACTGAATAAGGAGCTACCCAGG 0: 1
1: 0
2: 0
3: 5
4: 98
1097014753_1097014758 25 Left 1097014753 12:55977726-55977748 CCCACTTCCGTTTTGGGAAAGAT 0: 1
1: 0
2: 1
3: 13
4: 98
Right 1097014758 12:55977774-55977796 AACTGAATAAGGAGCTACCCAGG 0: 1
1: 0
2: 0
3: 5
4: 98
1097014755_1097014758 18 Left 1097014755 12:55977733-55977755 CCGTTTTGGGAAAGATTTAGCCA 0: 1
1: 0
2: 1
3: 15
4: 213
Right 1097014758 12:55977774-55977796 AACTGAATAAGGAGCTACCCAGG 0: 1
1: 0
2: 0
3: 5
4: 98
1097014754_1097014758 24 Left 1097014754 12:55977727-55977749 CCACTTCCGTTTTGGGAAAGATT 0: 1
1: 0
2: 0
3: 19
4: 184
Right 1097014758 12:55977774-55977796 AACTGAATAAGGAGCTACCCAGG 0: 1
1: 0
2: 0
3: 5
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097014758 Original CRISPR AACTGAATAAGGAGCTACCC AGG Intronic
905198364 1:36299110-36299132 AACTGAAGAATGACTTACCCAGG + Intronic
906958121 1:50393775-50393797 AACTCAAAATGGAGTTACCCCGG + Intergenic
907562570 1:55404113-55404135 AAATAAATAAGGAGCTCACCAGG - Intergenic
909191020 1:72552126-72552148 AACTGAAGCAGGAGATACACTGG + Intergenic
912070378 1:105801670-105801692 AACTGGATAAAAAGCTACTCTGG - Intergenic
914979455 1:152399843-152399865 AACTGAATCTGGAGATAACCAGG + Intergenic
916070158 1:161165416-161165438 AACTGATGCAGGAGCCACCCCGG + Exonic
917450605 1:175144580-175144602 AGCTGAATATGGACATACCCTGG - Intronic
919364374 1:196638336-196638358 AAATGATTAAGGAGCTGACCAGG + Intergenic
1062900788 10:1144183-1144205 AACTCAATAATAAGCTACTCGGG - Intergenic
1063194768 10:3730906-3730928 AACTCACTAATGAGCCACCCTGG - Intergenic
1064859013 10:19804900-19804922 AACTGAAGAATGAGATACCTAGG + Intergenic
1074057776 10:109938345-109938367 AACAGAAGAAAGAGCTGCCCTGG + Intergenic
1074567161 10:114590573-114590595 ATGTGAATAAGGAGAAACCCAGG + Intronic
1076559994 10:131356116-131356138 ATCTCAATAAGGGGCTGCCCTGG + Intergenic
1077692473 11:4358509-4358531 TACTGAAAAGGGAGCTACCATGG + Intergenic
1081258602 11:40929737-40929759 AATTGAATAACTAGCTACTCGGG - Intronic
1081435198 11:43020186-43020208 CACTAAATAAGGAGACACCCAGG + Intergenic
1084913857 11:72412830-72412852 AACTGAATAAAGTGCAACACTGG + Intronic
1086092626 11:83020065-83020087 AACTGGGGAGGGAGCTACCCAGG + Intronic
1086886281 11:92209596-92209618 AACTCAATAAGGAGTTAAACCGG + Intergenic
1094071237 12:26415822-26415844 AAGTGAATAAGTAGCTAAGCTGG - Intronic
1095706570 12:45243368-45243390 AACTTACTTAGGAGCTACCTTGG + Intronic
1097014758 12:55977774-55977796 AACTGAATAAGGAGCTACCCAGG + Intronic
1098446812 12:70574550-70574572 AAGTCAATAAGGAGCTCTCCAGG + Intronic
1099909119 12:88808051-88808073 AACTGAAAAATGAGCCAGCCAGG - Intergenic
1100649799 12:96572971-96572993 CACTGAATCAGGAACTACCAAGG + Intronic
1111005612 13:82243786-82243808 AACTGAAAAAGGAGCAGTCCAGG - Intergenic
1112996281 13:105578273-105578295 AACTGAATCTGGGGCTACCAAGG + Intergenic
1116030432 14:39564717-39564739 AAATAAATAAGGAGTAACCCAGG - Intergenic
1117353313 14:54901890-54901912 ATCTCAATAAGGAACTACCCAGG + Intronic
1118065160 14:62182617-62182639 AGCTGATTAATGAGCTCCCCAGG + Intergenic
1119433561 14:74583823-74583845 CACTGGACCAGGAGCTACCCGGG - Intronic
1130223456 15:82040704-82040726 AACTGAATCAGGAGCTATGTAGG + Intergenic
1135690561 16:24533934-24533956 AAATAAATAAGGTGTTACCCTGG - Intergenic
1142944966 17:3418480-3418502 GACTGAATGAGAAGCCACCCAGG - Intergenic
1143338508 17:6191367-6191389 ACCTCACCAAGGAGCTACCCAGG - Intergenic
1143341044 17:6211148-6211170 ATCTGAATAATGAACTACCATGG + Intergenic
1146132080 17:30286720-30286742 AACTGTATACAGAGATACCCAGG + Intronic
1150846242 17:68661436-68661458 AACTGTTTCAGGAGCAACCCCGG - Intergenic
1153476156 18:5500838-5500860 AGCAGAACAAGGAGCTGCCCTGG + Intronic
1156264425 18:35473477-35473499 AACAGAAGAGGGAGCTGCCCTGG + Intronic
1158124479 18:54086285-54086307 ATCTGAATAAGGAGTTTCCAAGG - Intergenic
1159589301 18:70315321-70315343 AAGTGATCAAGGAGCTACCATGG - Intronic
1162963382 19:14142397-14142419 CACTGAGTAATGAGCTTCCCTGG + Intergenic
925053335 2:834324-834346 AACTGATTCAGGAGCTGCCTCGG + Intergenic
925548431 2:5042616-5042638 GACAGAATTAGGAGCTACACGGG - Intergenic
925814570 2:7735174-7735196 AACTGATTGAGGAGCAATCCTGG + Intergenic
929930654 2:46253191-46253213 CACTTAATAAAGAGCTGCCCTGG - Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
932537218 2:72611450-72611472 AACTAAATAATGTGCTACCCTGG + Intronic
937050789 2:118887069-118887091 AACTGTATCAGCAGCGACCCTGG + Intergenic
937498141 2:122447524-122447546 AACTCAAGAAGGAGCTTACCAGG - Intergenic
938819275 2:134938445-134938467 AATTGAATAAGGAGGTTCTCTGG + Intronic
941902473 2:170691610-170691632 ACCTGAGTAAGGAGCAAACCAGG + Intergenic
946634640 2:221711228-221711250 AAGTGAATAAGGATCTAACAGGG - Intergenic
947095893 2:226566498-226566520 AACAGAATAATGTGCTCCCCTGG + Intergenic
1173616057 20:44403637-44403659 TAATGAACAAGGAGCCACCCAGG - Intronic
1177158695 21:17524459-17524481 GGCTGAATCAGGAGCTACCCAGG + Intronic
1178744803 21:35238518-35238540 AACTGAATAGGTAGCAACTCAGG + Intronic
1184056217 22:42051792-42051814 ACCTGAATAAGTAGTTACTCAGG - Intronic
949599236 3:5580427-5580449 AAGTGAAAAGGGAGCTACACTGG + Intergenic
951374103 3:21891279-21891301 GAATGAACAAGGAGCTATCCAGG + Intronic
951912769 3:27768753-27768775 AACTGAAAAAGGGACTAGCCAGG + Intergenic
958786351 3:98600464-98600486 TACTGAATAAATAGCTAACCAGG - Intergenic
964745326 3:160006942-160006964 TACTGAATAAGAAACTACCAGGG + Intergenic
967745011 3:193045575-193045597 AAATGAATAAGTAGCAACCTGGG + Intergenic
974696751 4:65385936-65385958 TACTAAATAAGCAGCTACACGGG - Intronic
975812057 4:78179787-78179809 CACTGACATAGGAGCTACCCAGG + Intronic
976750135 4:88445021-88445043 AATTGAATAAGGTGTTCCCCTGG - Intergenic
977246255 4:94635347-94635369 AACTGAATAATGAGCAAGTCAGG - Intronic
977913428 4:102563755-102563777 AACTGAGTACTCAGCTACCCAGG - Intronic
979464235 4:121017909-121017931 AAAGGAAGAAGGAGGTACCCAGG - Intergenic
981472722 4:145154935-145154957 ATTTGAATAAGCAGCTGCCCTGG - Intronic
983062118 4:163172468-163172490 AGCTGATTAAGGAGCCACCAGGG + Intergenic
983099859 4:163612025-163612047 AACTGAATAATGATTTATCCTGG - Intronic
988019857 5:25608586-25608608 AACTGAATCAGGAGATAGCGAGG + Intergenic
999634502 5:153606841-153606863 AACTGAATAAGGAGATATTATGG - Intronic
1004423135 6:15489088-15489110 AACAGAATTAGAAGCAACCCAGG + Intronic
1007557080 6:42775233-42775255 ATCTGAAGAAGGAACTACTCTGG - Intronic
1009327698 6:62374197-62374219 AGATAAATAAGGAACTACCCTGG + Intergenic
1013782947 6:113748864-113748886 AACTGAATCAGGAGCTCCGGGGG - Intergenic
1014778275 6:125534743-125534765 AACTGAAAAAGTAGCTGGCCTGG + Intergenic
1016914792 6:149234617-149234639 AAATGAATAAGCAGCTCCCTGGG - Intronic
1018340673 6:162847767-162847789 ACCTGAACAAGGAGCTACTAGGG + Intronic
1022602432 7:31773946-31773968 AAGAGAATAAGGAGCATCCCAGG + Intronic
1023066899 7:36387490-36387512 AACTGAAGAATGAACTACCGGGG + Intronic
1029066397 7:97853438-97853460 AACTGAATCAGAACCTAACCTGG - Intronic
1032643638 7:133796848-133796870 GACTGAATAATTAGCTTCCCAGG - Intronic
1033022009 7:137735004-137735026 AAATGAGAAAGGAGCCACCCAGG - Intronic
1033298179 7:140160421-140160443 GACTGAATCAGCAGCTGCCCTGG + Intronic
1033897513 7:146092384-146092406 CACTGAATAAGGAGTTACAAAGG - Intergenic
1034835072 7:154344520-154344542 AACTGAAAATTGAGCTACCAGGG + Intronic
1034848728 7:154473368-154473390 GACTGTATATGGAGCTATCCCGG - Intronic
1035886486 8:3296637-3296659 AGCTGAATATGGAGGTACCCAGG + Intronic
1043730905 8:83679707-83679729 AACTCAGTAAGGGGCTACCTGGG - Intergenic
1048273608 8:133048759-133048781 AACTGAAGCAGGAGCTGCCGTGG - Intronic
1050855006 9:10343178-10343200 AAGTGAATAAGGAGATCACCTGG - Intronic
1051687221 9:19670262-19670284 AACTTAATAAGGAATAACCCAGG - Intronic
1055375618 9:75646260-75646282 AACTGAATCAGGAGATACAGAGG + Intergenic
1058533542 9:105931292-105931314 AAGTGAATAAGGAGGAACTCTGG + Intergenic
1191955747 X:66640712-66640734 AACAGAATTAGGAGGTACCCAGG - Intergenic
1194698344 X:97082897-97082919 AAATGAATAGGGAGCTAGCTGGG - Intronic
1197678840 X:129360647-129360669 AACTGGATAATGAGATAACCAGG + Intergenic