ID: 1097016666

View in Genome Browser
Species Human (GRCh38)
Location 12:55992198-55992220
Sequence TGTTGTAGCAACTGAGGGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 163}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097016656_1097016666 29 Left 1097016656 12:55992146-55992168 CCGAAGCCGGGGTGTGGATCTCC 0: 1
1: 0
2: 0
3: 10
4: 106
Right 1097016666 12:55992198-55992220 TGTTGTAGCAACTGAGGGGGTGG 0: 1
1: 0
2: 1
3: 14
4: 163
1097016658_1097016666 8 Left 1097016658 12:55992167-55992189 CCATGAACAGTCCCAGCAGAACA 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1097016666 12:55992198-55992220 TGTTGTAGCAACTGAGGGGGTGG 0: 1
1: 0
2: 1
3: 14
4: 163
1097016659_1097016666 -3 Left 1097016659 12:55992178-55992200 CCCAGCAGAACAAGAGCCAGTGT 0: 1
1: 0
2: 1
3: 16
4: 162
Right 1097016666 12:55992198-55992220 TGTTGTAGCAACTGAGGGGGTGG 0: 1
1: 0
2: 1
3: 14
4: 163
1097016660_1097016666 -4 Left 1097016660 12:55992179-55992201 CCAGCAGAACAAGAGCCAGTGTT 0: 1
1: 0
2: 1
3: 25
4: 162
Right 1097016666 12:55992198-55992220 TGTTGTAGCAACTGAGGGGGTGG 0: 1
1: 0
2: 1
3: 14
4: 163
1097016657_1097016666 23 Left 1097016657 12:55992152-55992174 CCGGGGTGTGGATCTCCATGAAC 0: 1
1: 0
2: 0
3: 18
4: 110
Right 1097016666 12:55992198-55992220 TGTTGTAGCAACTGAGGGGGTGG 0: 1
1: 0
2: 1
3: 14
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097016666 Original CRISPR TGTTGTAGCAACTGAGGGGG TGG Exonic
900889794 1:5441613-5441635 TCTTTTAGCAACTGAAGGGCTGG - Intergenic
902003022 1:13209259-13209281 AATTGTAGGAACTGAGAGGGTGG - Intergenic
902951635 1:19888113-19888135 GGTTGTCACAACTGATGGGGAGG + Intronic
904953875 1:34266823-34266845 TGTAGTAGCAGCTGGGGAGGGGG + Intergenic
906380272 1:45327946-45327968 TGTGGAGGCCACTGAGGGGGTGG + Exonic
906599014 1:47107532-47107554 TGTTGGAGCAACTAGGTGGGCGG - Intronic
910817722 1:91310617-91310639 TGTGGAAGGGACTGAGGGGGAGG + Intronic
911682077 1:100728488-100728510 TGTTGTAGCAACTGAAAAGCTGG + Intronic
913116847 1:115705149-115705171 TGTGACAGCAACTGAGGGTGGGG + Intronic
913271392 1:117096994-117097016 TATTGTAGCAATGGAGGGGTAGG + Intronic
914778960 1:150766116-150766138 TGTAGTCCCAGCTGAGGGGGAGG + Intergenic
920688692 1:208129393-208129415 TGTTGTAGCAGCTGGGGCTGGGG + Intronic
922175725 1:223195583-223195605 TGATGGAGCAACTGTGGGAGTGG + Intergenic
1063654147 10:7970432-7970454 TGCTGTAGCCAGTGAGGGGAGGG + Intronic
1064628217 10:17282984-17283006 TGTGGAAGCAGCTGAGGTGGGGG + Intergenic
1068400180 10:56518370-56518392 TGTGGGAGGGACTGAGGGGGAGG - Intergenic
1068886740 10:62105407-62105429 TGTTGTAGGAACTGAGAGAGAGG + Intergenic
1069821906 10:71233627-71233649 TGCTGTGGCAGCTGAGGGGCTGG - Intronic
1073129977 10:101181900-101181922 TGCTGCAGGAGCTGAGGGGGTGG + Intergenic
1077805177 11:5583700-5583722 TGTAGTACCAACTGCTGGGGAGG - Intronic
1081673567 11:44955301-44955323 TGGTGTAGCAACAGAGGTGGTGG - Intergenic
1081686967 11:45049586-45049608 TCTTGTAGAAAAGGAGGGGGAGG + Intergenic
1085218672 11:74853975-74853997 TGATGTAGATACTGGGGGGGCGG + Intronic
1085804099 11:79618854-79618876 TTTTGTAGGAACTGAGGGGAAGG - Intergenic
1086169737 11:83822526-83822548 TGTTGTAGCTGCTGAGGGGTGGG - Intronic
1087745659 11:101943218-101943240 TGATGTAGCACCAGAGGTGGGGG - Intronic
1087866138 11:103228903-103228925 TGTTGTGGCTGCTGTGGGGGAGG + Intronic
1088136631 11:106563264-106563286 GGTTGTTGCAACTGGGGGTGGGG + Intergenic
1088435374 11:109806020-109806042 TGCTGTAGAGACTGAGGGGGAGG - Intergenic
1088979905 11:114852900-114852922 AGTTGTTGCAACTGGGAGGGAGG - Intergenic
1091535261 12:1401348-1401370 TGCTGTAGCAAATAAAGGGGAGG + Intronic
1092762289 12:11820972-11820994 TGTAGTAGCAGCAGAGGTGGCGG + Intronic
1092799628 12:12151600-12151622 TCTTGTAGCAACTCAGTGAGAGG - Intronic
1094481410 12:30885345-30885367 TGTAGCAGCAACTGGGAGGGTGG - Intergenic
1096358888 12:50966514-50966536 GGTTGTCACAACTGAGGGTGTGG - Intronic
1097016666 12:55992198-55992220 TGTTGTAGCAACTGAGGGGGTGG + Exonic
1097188415 12:57208198-57208220 TGGTGGACCCACTGAGGGGGTGG + Exonic
1097879361 12:64672979-64673001 TGCTGCAGCAACCGAGGAGGAGG - Intronic
1098854818 12:75640648-75640670 TGTTGTGGCAATTGAGGGAAAGG + Intergenic
1099833613 12:87878083-87878105 TGTTGTATTAACAGAGGAGGAGG - Intergenic
1101151056 12:101882810-101882832 TGTTGCATCAAATGATGGGGGGG - Intronic
1102053223 12:109878433-109878455 TTTTGTTGCAACTGAGTTGGGGG - Intronic
1102896600 12:116603322-116603344 TGTTGTTACAGCTTAGGGGGAGG - Intergenic
1104385941 12:128351695-128351717 TCTTGTGGGAACTAAGGGGGAGG + Intronic
1111100961 13:83585368-83585390 TGTTTTATCAACTGATGGGAGGG + Intergenic
1115147365 14:30240846-30240868 TGTGGGAGGGACTGAGGGGGTGG + Intergenic
1116824785 14:49662176-49662198 TGTTGAAGTAACTGAGGGAAAGG - Intronic
1117793374 14:59364604-59364626 TGTTGTGGCAACTGAGAGATGGG - Intronic
1119077759 14:71661018-71661040 TGTTATAGAAACTGAGGGTTTGG + Intronic
1120324195 14:83004935-83004957 TGTTGTGGCAAATGGGGGTGGGG - Intergenic
1121417961 14:93791975-93791997 TGTGGTAGCAACTGAATGGAGGG + Intergenic
1121882930 14:97516493-97516515 GGGTGTAGGAACTGAGGAGGGGG - Intergenic
1122011882 14:98757126-98757148 TGTTGTAGAAACTGAGGCTCAGG + Intergenic
1122122008 14:99559739-99559761 TGATGTAGCCACTGACAGGGTGG + Intronic
1130421676 15:83754150-83754172 GGTTGTTGCAACTGAGGAGAGGG - Intronic
1133850992 16:9503278-9503300 TCCTGTAGAGACTGAGGGGGAGG + Intergenic
1134806901 16:17133764-17133786 TGTTCTAGAAGATGAGGGGGAGG - Intronic
1136267996 16:29132069-29132091 GGTTGTTGCAACTGGGGAGGGGG + Intergenic
1138132385 16:54491837-54491859 TGTAGTCGCAACTGCTGGGGAGG + Intergenic
1138616588 16:58172440-58172462 TGTAGAAGCAACTGAGGCTGAGG - Intronic
1140100566 16:71912906-71912928 TGTTGTAGCATGTGATGGGTAGG + Intronic
1140525427 16:75618938-75618960 AGTTGTCACAACTGAGGGAGGGG - Intronic
1140834472 16:78780580-78780602 TGTGGAAGCAACTTCGGGGGAGG + Intronic
1141151904 16:81570216-81570238 TGGTGTAGCCACAGAGGGGGTGG + Intronic
1141243248 16:82282771-82282793 TTGTGTAGCAACTGAGAGGGAGG - Intergenic
1142071303 16:88092407-88092429 GGTTGTTGCAACTGGGGAGGGGG + Intronic
1142395647 16:89829714-89829736 TGTGGAGGCAGCTGAGGGGGGGG - Intronic
1142944719 17:3414843-3414865 AGTCGTAGCCACTGAGAGGGTGG + Intergenic
1144305159 17:13963260-13963282 TGTTGGAGCAGGGGAGGGGGTGG - Intergenic
1144533517 17:16063898-16063920 TGCTGTAGCAGCTGAGATGGTGG - Intronic
1146356962 17:32142553-32142575 CGGGGAAGCAACTGAGGGGGCGG + Exonic
1146572452 17:33964662-33964684 GGGTGTAGCAGCAGAGGGGGTGG - Intronic
1147524837 17:41212792-41212814 TGTTGCAGCAACTGGGGGGGTGG - Intronic
1148254111 17:46113106-46113128 TGTTGTCACAACTGGGGGTGGGG + Intronic
1148873166 17:50670403-50670425 AGTTTTAACAACTGAGGAGGAGG + Intronic
1150158113 17:62871019-62871041 GGTTGTCACAACTGATGGGGAGG + Intergenic
1150467194 17:65403439-65403461 TGTTGAAGCAGCTGGGGGGCGGG + Intergenic
1151821723 17:76500574-76500596 GGTTGGAGCTACTGAGAGGGTGG - Intronic
1156137767 18:34064402-34064424 TGTTGTAGTAAATGTGGAGGAGG - Intronic
1159235298 18:65663685-65663707 TGCTGTACCAACAGAGGGTGAGG + Intergenic
1160269864 18:77373594-77373616 AGTTGCAGCATCTGAGGGGAGGG + Intergenic
1161366628 19:3883633-3883655 TTTTGTCACAACTGAGGGGAAGG - Intronic
1164677609 19:30112208-30112230 TGTTGAACCCACTGAGGGGAGGG + Intergenic
1166945263 19:46392236-46392258 CGTTGTTGAAGCTGAGGGGGTGG - Intronic
1167221135 19:48198958-48198980 TGTTGTCGCAACTGATGAAGGGG + Intronic
1168057057 19:53869742-53869764 TGTAAGAGCACCTGAGGGGGAGG - Exonic
1168275670 19:55277021-55277043 TGGTGTAGCAATTGAGGGTGTGG - Intronic
927248361 2:20976425-20976447 TGTTTTTCCAACTGAGGAGGTGG - Intergenic
932378824 2:71263105-71263127 TTTTGTAGAAACTGAGGGAAAGG - Intergenic
932702112 2:73999231-73999253 TGCTGCTGCAAGTGAGGGGGTGG + Intronic
932702942 2:74003284-74003306 TGTAGCAGCAGCTGAGGGGGAGG + Intronic
935466193 2:103400947-103400969 TGTTGTACCTACTGAAGCGGGGG + Intergenic
937224159 2:120358638-120358660 TGCTGGAGCAACTGAGGCTGAGG + Intergenic
938611962 2:132957247-132957269 GGTTTTAGCAACTGAGTGTGAGG - Intronic
939218499 2:139271917-139271939 TGTTCTAGCAACTGAGTGTTGGG - Intergenic
939423943 2:142010129-142010151 ATTTGTCACAACTGAGGGGGAGG + Intronic
946017294 2:216614235-216614257 TGTGGGAGGAACTCAGGGGGAGG - Intergenic
947059781 2:226150619-226150641 GGTTGTCGCAACTGGGGAGGGGG + Intergenic
947328868 2:229007311-229007333 AGCTGTAGCAAATGTGGGGGAGG + Intronic
1168947591 20:1774499-1774521 TGTTGCAGCAGGTGAGGGGAAGG - Intergenic
1174199244 20:48795461-48795483 GGTTGTCACAACTGAGGAGGAGG + Intronic
1174411890 20:50341658-50341680 TGTTGTAGCCATTGTGGGAGGGG - Intergenic
1174743980 20:53043338-53043360 TGTTGTCACAACTCAGGGAGTGG + Intronic
1175134578 20:56813404-56813426 TGTTGTCACAACTGAAGGTGGGG - Intergenic
1175135025 20:56816687-56816709 GGTTGTCGCAACTGAAGGTGGGG - Intergenic
1177775866 21:25565191-25565213 AGTTGTAGCTACTGAGAGGTGGG - Intergenic
1177782636 21:25637566-25637588 GGTGGTAGAAACTGAAGGGGAGG - Intergenic
1178380598 21:32104379-32104401 TTTTGTATCAGCTGAGGGGAGGG + Intergenic
1178857372 21:36261601-36261623 TGTTGCAGAAAATGAGGGTGAGG + Intronic
1179347197 21:40569577-40569599 TGCTGTAGCAACTATGGGGCGGG - Intronic
1181342863 22:22196627-22196649 TGTTGTCACAAATGAGGGGAGGG - Intergenic
1183428025 22:37750116-37750138 TGATGTGGCAAATGACGGGGCGG - Intronic
1183567756 22:38628384-38628406 TGCTGAAACAACTGAGGGGCTGG + Intronic
1185375091 22:50478968-50478990 TGTGGCAGCTGCTGAGGGGGTGG - Intergenic
951403428 3:22263781-22263803 TATTGTGACAACTGAGGGAGGGG + Intronic
952816793 3:37453121-37453143 TCTTGTAGGAGCTGGGGGGGGGG - Intronic
954410087 3:50366739-50366761 TGTTGGAGCCACTGAGTGGAGGG + Intronic
955607602 3:60722612-60722634 TGTTGTCACAACTGGGGGTGGGG - Intronic
956916238 3:73874520-73874542 TATTGTCACAACTGAGTGGGAGG + Intergenic
957497911 3:81014432-81014454 TGCTCTAGATACTGAGGGGGAGG + Intergenic
957497977 3:81015254-81015276 TGCTGTAGATACTGATGGGGAGG + Intergenic
963267115 3:143250490-143250512 TGTTGGAGGGACTCAGGGGGAGG + Intergenic
963739710 3:149064985-149065007 TTCTGGAGCAACTGAAGGGGAGG + Intronic
963902587 3:150746606-150746628 GGTTGTCACAACTGAGGGGCAGG - Intronic
964800507 3:160551927-160551949 GGTTGTCACAACTGGGGGGGGGG + Intronic
965945020 3:174230671-174230693 AGTTCCAGCTACTGAGGGGGTGG + Intronic
966436136 3:179885893-179885915 TGTTGAATCAACTCAGTGGGTGG + Intronic
968230196 3:197001324-197001346 TGTGGTATCTACTGAGGTGGGGG - Intronic
971077264 4:23164525-23164547 GGGTGTAGCAACTGGAGGGGTGG - Intergenic
977348752 4:95852893-95852915 TGATGTAGGAACTGAGGGCTTGG + Intergenic
979470329 4:121088642-121088664 TGTTGTTGCAAATGATGGGATGG - Intergenic
979571908 4:122237291-122237313 TGTTATATAAACTGAGGGGCTGG - Intronic
985151892 4:186955607-186955629 GGTTGTCACAACTGAGGAGGGGG + Intergenic
989537232 5:42578164-42578186 GGTTGTTGCAACTGAGAAGGGGG - Intronic
1001082557 5:168677857-168677879 TGTGGCAGCAACTGGGGTGGGGG + Intronic
1002877031 6:1219864-1219886 TGTTGCCACAACTGAGGAGGGGG + Intergenic
1003004508 6:2368661-2368683 GGTTGTCCCAACTGAGGAGGGGG + Intergenic
1003215218 6:4103344-4103366 TGTGGTAGCAACTGAAGACGGGG + Intronic
1003373148 6:5548184-5548206 TGTGGGAGCAACTCAGGTGGAGG - Intronic
1003620347 6:7693878-7693900 TTTTGTAGAAACGGAGGGGGGGG + Intergenic
1004443084 6:15672201-15672223 TGCTGTGGAGACTGAGGGGGAGG + Intergenic
1006575205 6:35040162-35040184 TGATTTTGCAACTGAGGAGGTGG - Intronic
1008403957 6:51098432-51098454 TGCTGTCCCAACTGAGGGAGCGG - Intergenic
1014084358 6:117325971-117325993 TGTGGTAGGAATTAAGGGGGTGG + Intronic
1015402152 6:132798731-132798753 TGATATAGCAGCTGAGGTGGTGG - Intergenic
1017119280 6:151008645-151008667 CTTTCTAGCAACTGAGGGGGTGG + Intronic
1018866764 6:167752528-167752550 TGTGGGAGCAACTCAGGGGGAGG - Intergenic
1020050982 7:5081484-5081506 TTTTGTAGCGACAGAGGCGGGGG - Intergenic
1020678508 7:11208116-11208138 TATAGAAGCAACTTAGGGGGAGG + Intergenic
1022023420 7:26423369-26423391 CTGTGTAGGAACTGAGGGGGGGG - Intergenic
1022192692 7:28032555-28032577 TGATCTAGCAAATGAGGGAGTGG - Intronic
1022225718 7:28360943-28360965 AGTTGTAACCACTGAGGGGCAGG + Intronic
1029764633 7:102618346-102618368 TTTTGTAGCAAAGGTGGGGGGGG - Intronic
1034011099 7:147530622-147530644 TGTAGGAGGGACTGAGGGGGAGG - Intronic
1034011426 7:147532865-147532887 TGTGGGAGGAACTCAGGGGGAGG - Intronic
1036221238 8:6923139-6923161 TGGCCTAGCAAGTGAGGGGGTGG - Intergenic
1038480795 8:27900686-27900708 TGTTTTTGCAACTAAGGGGTGGG - Intronic
1038559372 8:28558096-28558118 TGTTTTGGCAACTGAAGGAGAGG + Intronic
1044794752 8:95885544-95885566 AGTTGTAACAACTGAGGGAGGGG - Intergenic
1045601800 8:103725136-103725158 TGGTGTAACAAATGTGGGGGTGG - Intronic
1047497283 8:125417429-125417451 TTTTGTAGCAACGGGGGAGGGGG + Intergenic
1048236088 8:132692184-132692206 TGTTGTATAAACTGGGGTGGGGG + Intronic
1048874817 8:138828347-138828369 TGTTGTCACAACTGAGTGAGGGG - Intronic
1050002967 9:1098262-1098284 TATTGTAACAGCTGAGGGGTGGG + Intergenic
1056226570 9:84501309-84501331 TGTGGTAGCAGCAGAGGGAGTGG - Intergenic
1057733909 9:97635100-97635122 TGTTGTGGCAGTTGAGGTGGAGG + Intronic
1058684020 9:107465215-107465237 TCTTGTAGCAACTCTGTGGGTGG + Intergenic
1060424599 9:123493841-123493863 TGGTGAAGCAATGGAGGGGGCGG - Intronic
1061785138 9:133023319-133023341 TGCTGGGGCAACTGAGGGCGGGG + Intergenic
1185466143 X:355461-355483 TGTCGTAGCAACGGAGGGACCGG + Intronic
1185466426 X:357760-357782 TGTGGGGGCAGCTGAGGGGGTGG + Intronic
1186628813 X:11325839-11325861 GGTTGTCTCAACTGAGGGGAAGG + Intronic
1186651794 X:11569184-11569206 GGTTGTAGCAACTTGGGGAGGGG + Intronic
1186873196 X:13792459-13792481 GGTTGTTACAACTGAGGGTGGGG + Intronic
1186990299 X:15060022-15060044 TGCTGTAGCAAATGAGTGTGAGG + Intergenic
1187864889 X:23715053-23715075 TGTTCCTGCAATTGAGGGGGAGG - Intronic
1188416178 X:29937673-29937695 TATTGTAATAACTGAGGGGCAGG + Intronic
1193810020 X:86040222-86040244 TGTGGTAGCATCTCCGGGGGTGG - Intronic
1200762930 Y:7056511-7056533 GGTTGTAACAACTGAGGAGGAGG - Intronic