ID: 1097017384

View in Genome Browser
Species Human (GRCh38)
Location 12:55997188-55997210
Sequence AGCCACCCGCTTCCAGCCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 154}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097017375_1097017384 21 Left 1097017375 12:55997144-55997166 CCTGCCTGTCTCGGCTCCAGGAG 0: 1
1: 0
2: 3
3: 22
4: 250
Right 1097017384 12:55997188-55997210 AGCCACCCGCTTCCAGCCAATGG 0: 1
1: 0
2: 0
3: 12
4: 154
1097017380_1097017384 5 Left 1097017380 12:55997160-55997182 CCAGGAGGCGGGTTCCAGCCAAT 0: 1
1: 0
2: 1
3: 5
4: 96
Right 1097017384 12:55997188-55997210 AGCCACCCGCTTCCAGCCAATGG 0: 1
1: 0
2: 0
3: 12
4: 154
1097017382_1097017384 -9 Left 1097017382 12:55997174-55997196 CCAGCCAATGGTTGAGCCACCCG 0: 1
1: 0
2: 0
3: 4
4: 36
Right 1097017384 12:55997188-55997210 AGCCACCCGCTTCCAGCCAATGG 0: 1
1: 0
2: 0
3: 12
4: 154
1097017377_1097017384 17 Left 1097017377 12:55997148-55997170 CCTGTCTCGGCTCCAGGAGGCGG 0: 1
1: 0
2: 0
3: 10
4: 168
Right 1097017384 12:55997188-55997210 AGCCACCCGCTTCCAGCCAATGG 0: 1
1: 0
2: 0
3: 12
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097017384 Original CRISPR AGCCACCCGCTTCCAGCCAA TGG Intronic
900609204 1:3537312-3537334 AACCCCCCGCCACCAGCCAAGGG - Intronic
902751323 1:18513447-18513469 ATCCACCCGCCTCGAGCCCATGG - Intergenic
902809623 1:18880658-18880680 ACCCACCCACTTCCAGCCAGTGG + Intronic
903464073 1:23539951-23539973 CCCCACCAGCTTCCAGCCAAAGG - Intergenic
903577914 1:24350662-24350684 AGCCACTCCCTTCCTGCCTACGG - Intronic
906680750 1:47724121-47724143 CCTCACCCGCTTCCTGCCAAGGG + Intergenic
910827908 1:91428673-91428695 AGCCTCCCTCCACCAGCCAAGGG - Intergenic
911530639 1:99039457-99039479 AGCCTCCCTTTCCCAGCCAAGGG + Intergenic
912568675 1:110606660-110606682 AGCCCCCGGCGTCCAGCCGAGGG + Intronic
918581617 1:186137584-186137606 AACCAGCCCCTTCCAGCCAATGG + Exonic
919839011 1:201595704-201595726 GGCCACTGTCTTCCAGCCAAGGG + Intergenic
920647918 1:207816868-207816890 ATCCTCCCACTGCCAGCCAATGG + Intergenic
921003545 1:211069161-211069183 AGCCACCCTGTCCCTGCCAAGGG + Intronic
922991457 1:229916497-229916519 AGCTGCCAGGTTCCAGCCAACGG + Intergenic
923752394 1:236758242-236758264 AGTCACTCACTTCCAGCCACAGG - Intronic
1064543633 10:16429717-16429739 TGCCACCACATTCCAGCCAATGG - Intergenic
1067346193 10:45440717-45440739 TGCCACCCACTCCCAGCCACAGG - Intronic
1067784779 10:49237480-49237502 ATCCAGGCCCTTCCAGCCAATGG - Intergenic
1068303828 10:55178435-55178457 ATCCAGCAGCTTTCAGCCAATGG + Intronic
1071552692 10:86579220-86579242 AGCCACCCTCTCCCACCGAAGGG - Intergenic
1071875048 10:89836400-89836422 AGGCACCAGCCTCCAGCCACAGG + Intergenic
1073729720 10:106273494-106273516 ATCCACCAGCTACCAGCCAATGG + Intergenic
1075850203 10:125580713-125580735 AGCCTCCCGCTTCCAGTTACAGG + Intronic
1076608125 10:131702579-131702601 AACCACCACCTCCCAGCCAAGGG + Intergenic
1077938948 11:6819019-6819041 AGGCACCTGCATCCAGACAAGGG - Intergenic
1081717364 11:45259798-45259820 GGCCACCCGCTTCCTGTCCAGGG - Intronic
1083272448 11:61579285-61579307 GGCCGCCGGCTTCCAGCCCATGG - Intronic
1083307667 11:61769572-61769594 AGCCACCCACTTACCGCCGAAGG - Intronic
1086120983 11:83304232-83304254 ACCCTCTAGCTTCCAGCCAATGG - Intergenic
1087293184 11:96341410-96341432 AGCCGCCCGCTTCAACCCCAGGG - Exonic
1088689703 11:112315273-112315295 TGCCACCTGCTTTCAGCCGAAGG + Intergenic
1089366334 11:117923221-117923243 GGCCCCCCACTTCCAGCCCAGGG + Intronic
1095303555 12:40614574-40614596 AACCCCCCACTCCCAGCCAAGGG - Intergenic
1096479612 12:51929966-51929988 AGCCACCGGCGCCCGGCCAAGGG - Intergenic
1097017384 12:55997188-55997210 AGCCACCCGCTTCCAGCCAATGG + Intronic
1104919037 12:132281036-132281058 AGCCAGCCGCCTGCAGCCAGTGG + Intronic
1108933601 13:55861674-55861696 ACCTAACAGCTTCCAGCCAATGG - Intergenic
1109030346 13:57181743-57181765 ATTTACCAGCTTCCAGCCAATGG - Intergenic
1111200246 13:84927413-84927435 AGCCCCCACCCTCCAGCCAAGGG + Intergenic
1119107454 14:71938044-71938066 AGCCACCCGTCACCACCCAATGG - Intronic
1119406643 14:74403191-74403213 ACCCACCCCCTTCCAGCTTAGGG - Intergenic
1120442710 14:84560061-84560083 ATCTACCAGCTGCCAGCCAATGG - Intergenic
1121327789 14:93031591-93031613 GGCCCCCAGCTTCCAGACAAGGG - Intronic
1122323138 14:100867333-100867355 AGCTACCCGCTCCCAGGCCAGGG - Intergenic
1126179872 15:45774926-45774948 AACCTCCTGCTTCCAGCCATGGG - Intergenic
1126553074 15:49953907-49953929 AACCCCCTGCCTCCAGCCAAGGG - Intronic
1127757232 15:62104548-62104570 AGCCCCCAGCTGCCAGCCCAAGG + Intergenic
1129299825 15:74619137-74619159 AGCCAGCCACCTCCAGCCATGGG - Intronic
1132589872 16:721959-721981 GGCCACCCGCTGACAGCCCAAGG + Intronic
1138027536 16:53534296-53534318 AGCCACCCTCTCGCATCCAAAGG - Intergenic
1139012236 16:62647556-62647578 ATCTACCAGCTTCCAGCCAATGG + Intergenic
1143966024 17:10757052-10757074 ACCCACTCTCTTCCATCCAAAGG + Intergenic
1147651095 17:42062462-42062484 AGCCACAGGCTTTCAGACAAGGG - Intronic
1148774820 17:50089358-50089380 AGCCTGCTGCTACCAGCCAAAGG - Exonic
1149007788 17:51823346-51823368 AGCCCTCCAGTTCCAGCCAAGGG + Intronic
1152925283 17:83084803-83084825 ACCCACCCGCTGCCGGCCACAGG - Intronic
1155499636 18:26473772-26473794 AGCCCGCTGCTCCCAGCCAAGGG - Intronic
1155839330 18:30627618-30627640 ATCTACCAGCTGCCAGCCAATGG - Intergenic
1156494448 18:37516765-37516787 AGCCACCCTCTCCAAGCCCAAGG - Intronic
1157742985 18:50109765-50109787 AGGCACCCTCATCCGGCCAACGG + Intronic
1159686590 18:71429006-71429028 TGTCACCTGCTTCCATCCAACGG - Intergenic
1162182414 19:8879378-8879400 AACCCCCTCCTTCCAGCCAAGGG + Intronic
1162746177 19:12800058-12800080 AACCACCCGCTGCTAGCCACAGG + Intronic
1164561944 19:29298650-29298672 AGCCATCCTCTTGCACCCAAGGG + Intergenic
1166388711 19:42396983-42397005 AGTCACTATCTTCCAGCCAATGG + Intergenic
1166569432 19:43784555-43784577 AGCCAGCTGCCTCCAGCCCAGGG + Intergenic
925205591 2:2003237-2003259 AGCCTCACACTTCCTGCCAAAGG + Intronic
925318363 2:2941960-2941982 AGCCACCTGTTTACGGCCAAGGG + Intergenic
927704924 2:25291065-25291087 AGACACCCACTGCCAGCCACAGG + Intronic
932144333 2:69305410-69305432 AGCGTCCCTCTTCCAGCCCAGGG + Intergenic
935602327 2:104935257-104935279 TGCCAGCCTTTTCCAGCCAAAGG + Intergenic
935841635 2:107118502-107118524 AGCCACCTTCTTTCAGGCAAAGG + Intergenic
938369455 2:130760262-130760284 CTCCACCCGCTCCCACCCAAGGG - Intronic
938590240 2:132728844-132728866 AGCCAGCCGCTTCCAGACTGGGG - Exonic
939003490 2:136761226-136761248 TGCCAACCTCTTCCAGCCATAGG + Intergenic
942147087 2:173037611-173037633 ATCCACCAGGTTGCAGCCAAAGG - Intronic
942182565 2:173394358-173394380 AGCCATAAGCTTCCAGCCACTGG - Intergenic
943587998 2:189763059-189763081 AGCAACCAAATTCCAGCCAAGGG - Intronic
945482274 2:210357928-210357950 GACCACCCTCCTCCAGCCAAGGG - Intergenic
1169198851 20:3697864-3697886 AGCCCTCCTCTTCCAGCAAAGGG + Exonic
1171012086 20:21514319-21514341 AGCTCCGCGCTCCCAGCCAACGG + Intergenic
1171349142 20:24489771-24489793 AGCCAGGGGCCTCCAGCCAAAGG + Intronic
1172034879 20:32003496-32003518 TCCCACCCTCTCCCAGCCAAAGG - Intergenic
1172732018 20:37096173-37096195 GGCCCCCCGCGACCAGCCAAGGG - Intergenic
1172782809 20:37447340-37447362 TGCCTCCCACTTCCAGCCCAGGG + Intergenic
1173659739 20:44724971-44724993 ACCCAGCCCCTTCCAGCCCAAGG + Exonic
1175961095 20:62636709-62636731 AGCCACCCCCTTCCTGCAGATGG + Intergenic
1181519624 22:23437615-23437637 AGCCATCCCCTCCCAGCCATCGG + Intergenic
1181539213 22:23564445-23564467 AGACACAGGCTTCCAGCCGAGGG + Intergenic
1183353565 22:37346642-37346664 GGCCCCTAGCTTCCAGCCAAGGG - Intergenic
1183422375 22:37719364-37719386 AGCCACCTGCTCTCAGCAAAGGG - Intronic
1183473052 22:38019640-38019662 TGCCACCTTCTTCCAGACAACGG - Intronic
1183478608 22:38050656-38050678 AGTCAGCTGCCTCCAGCCAAAGG - Intergenic
1184601654 22:45547341-45547363 AACCACCCGCTTGCCTCCAAGGG - Intronic
1184756226 22:46517369-46517391 AGCCACCGGTTTCCTGCCTACGG + Intronic
950070603 3:10149059-10149081 AGCCCCCAGCTGCCAGCAAAAGG - Intronic
951509566 3:23486292-23486314 AGGCACCCACATCCAGACAAGGG + Intronic
952684780 3:36135043-36135065 ATCTACCAGCTTCCAGCCAATGG + Intergenic
953024004 3:39134492-39134514 AGCCTACCGCTTCCGGCTAAAGG - Intronic
953669112 3:44947859-44947881 ATCCAGCAGCTTCCAGCAAAGGG + Intronic
954197480 3:49005209-49005231 AGCCACCCCTTTCCAGCCATTGG - Intronic
957625523 3:82648876-82648898 ATCTACCAGCTTCTAGCCAATGG + Intergenic
963267931 3:143257695-143257717 AGCCAGCAGCTTCCAGATAATGG + Intergenic
963642748 3:147879384-147879406 ATCTACCAGCTTCCAGTCAATGG - Intergenic
963912882 3:150829829-150829851 AGCAACCCCCTTCCTGCCATTGG + Intergenic
964927590 3:161977134-161977156 ATCTACCAGCTTTCAGCCAATGG - Intergenic
967892834 3:194375224-194375246 AACCATCCGCTTCCAGCGTAAGG + Intergenic
968129876 3:196186845-196186867 AGCATCCCGCTTCCTGCCCAGGG + Intergenic
969118809 4:4891719-4891741 AGTCCCCCGCTACCAGCCCAGGG - Intergenic
970214593 4:13745606-13745628 AGCCTCCCTTTACCAGCCAAGGG - Intergenic
970494201 4:16609153-16609175 AACCACCTCCTCCCAGCCAAGGG + Intronic
971061593 4:22978097-22978119 AGCCACCTGGTTCTGGCCAAGGG - Intergenic
973629034 4:52801856-52801878 AGCCTCCCTTTCCCAGCCAAGGG + Intergenic
974565465 4:63574713-63574735 ATCTAACAGCTTCCAGCCAATGG - Intergenic
974885143 4:67809305-67809327 AGCCCCCACCCTCCAGCCAAAGG + Intergenic
978491882 4:109318588-109318610 ATCTACCAGCTTCTAGCCAATGG + Intergenic
981631769 4:146827145-146827167 AGCCCCCTCCCTCCAGCCAAGGG - Intronic
982063187 4:151625030-151625052 ATCCACCCACCTGCAGCCAAGGG - Intronic
982181562 4:152752418-152752440 AGGCACCCGCTTCTGGACAAGGG - Intronic
982788061 4:159559129-159559151 AGCCAACTGCTTCCAGATAATGG + Intergenic
985651315 5:1109067-1109089 ACCCACCCTCTCCCAGCCCAGGG + Intronic
989676776 5:43981952-43981974 AGTCCCCCACTCCCAGCCAAGGG - Intergenic
989821466 5:45799180-45799202 ATCTACCAGCTTCCAGCCAATGG + Intergenic
993822420 5:92635106-92635128 AGCCACTGTCTGCCAGCCAAAGG - Intergenic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
997794463 5:136794881-136794903 AGCCACTCTCTTTCAGCCCATGG - Intergenic
998159799 5:139806949-139806971 AGGCTCCCGCTCCCAGCTAAAGG + Intronic
998430116 5:142063345-142063367 AGCTCCCCACTTCCAGCCAGAGG - Intergenic
1000236322 5:159364689-159364711 AACCACACACTTACAGCCAACGG - Intergenic
1000820263 5:165973895-165973917 AGCCTCCCTCTCCCAGCCAAGGG - Intergenic
1002196652 5:177504856-177504878 CGCCACCCGCTGCCAGCTGAAGG - Exonic
1002568755 5:180128473-180128495 AGCCACCAGCCTCCATCCACAGG - Exonic
1010331199 6:74626232-74626254 AGCCCCCTCCTCCCAGCCAAGGG + Intergenic
1010498175 6:76561629-76561651 AGCCATCTGCTTCCATTCAAAGG - Intergenic
1010730424 6:79385028-79385050 AGTCCCCAGCTGCCAGCCAAGGG + Intergenic
1011264548 6:85501511-85501533 AGGCACCCGCTACCACCCATGGG - Intergenic
1013024968 6:106262762-106262784 AGCCTCCCTCCCCCAGCCAAGGG + Intronic
1016119386 6:140328368-140328390 ATCCACCAACTTCCAGCCAATGG - Intergenic
1017992735 6:159505136-159505158 ACCCTGCAGCTTCCAGCCAAGGG - Intergenic
1021088433 7:16451861-16451883 ATTCACCAGCTCCCAGCCAAGGG + Intergenic
1029672046 7:102040056-102040078 AGCCTCCTGCTTCCAGCTATGGG + Intronic
1034493300 7:151405789-151405811 TGCCACCGGCTCCCAGCAAATGG + Intronic
1035491607 7:159284448-159284470 AGCCCCCACCTGCCAGCCAAGGG + Intergenic
1035686497 8:1527292-1527314 ATCCACCCGGCTCCAGCCAGAGG + Intronic
1035846817 8:2874439-2874461 GGCCTCCAGCATCCAGCCAAGGG - Intergenic
1037867837 8:22461570-22461592 AGCCACCAGTTTCCTGCCATGGG + Intronic
1040974734 8:53177482-53177504 TGCCATCCGGCTCCAGCCAATGG + Intergenic
1049212314 8:141392350-141392372 GGTCACCCCCTTCCAGCCAGGGG - Intronic
1049882519 8:145075899-145075921 AGCCCCCCACTCGCAGCCAAGGG - Intergenic
1052575098 9:30281481-30281503 ATCTACCAGCTTCCAGCCAATGG - Intergenic
1057127943 9:92633990-92634012 AGCCGCCCGCATACAGCCAGGGG + Intronic
1058281537 9:103122083-103122105 AGCCAACCTGCTCCAGCCAAGGG + Intergenic
1060403622 9:123362136-123362158 ACCCACCCCCTGCCAGCCACTGG - Intronic
1060662189 9:125411000-125411022 AGCCCCCTGCCTCCAGCCAGGGG + Intergenic
1060733369 9:126051534-126051556 AGCCCCCAGCTCCCAGCCCAGGG + Intergenic
1061984870 9:134124833-134124855 AGCCACCATTTCCCAGCCAAAGG - Intergenic
1186156276 X:6729899-6729921 TGCCACCCGACCCCAGCCAATGG + Intergenic
1190452631 X:50596490-50596512 AGCCACAAGCTTCTACCCAAGGG - Exonic
1192712915 X:73610304-73610326 AACCTCCCTCTCCCAGCCAAGGG - Intronic
1192759262 X:74078287-74078309 AGCCTCCCCTTCCCAGCCAAGGG - Intergenic
1193071819 X:77314589-77314611 AGCCTCCCTTTCCCAGCCAAGGG + Intergenic
1193553837 X:82930483-82930505 ATCTACCAGCTTCCAGCCAATGG + Intergenic
1194523062 X:94942515-94942537 AGCCCCCACCTCCCAGCCAAGGG + Intergenic
1194631549 X:96291605-96291627 AGCCTCCCTTTCCCAGCCAAGGG + Intergenic
1195140030 X:101950075-101950097 AGCCTCCCTTTCCCAGCCAAGGG + Intergenic
1196117302 X:112011553-112011575 AGCCTCCCAGTTCCAGGCAAAGG - Intronic
1201437486 Y:13975198-13975220 AACCCCCTGCTTACAGCCAAAGG + Intergenic