ID: 1097019036

View in Genome Browser
Species Human (GRCh38)
Location 12:56007366-56007388
Sequence GGAGACTGCTGGGGGAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 294}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097019036_1097019053 29 Left 1097019036 12:56007366-56007388 CCCATTTTCCCCCAGCAGTCTCC 0: 1
1: 0
2: 2
3: 19
4: 294
Right 1097019053 12:56007418-56007440 CGCCGCCTGTCGCCTGGTAGTGG 0: 1
1: 0
2: 0
3: 2
4: 49
1097019036_1097019050 3 Left 1097019036 12:56007366-56007388 CCCATTTTCCCCCAGCAGTCTCC 0: 1
1: 0
2: 2
3: 19
4: 294
Right 1097019050 12:56007392-56007414 GCTTGGGGACGCTCGGTGTTCGG 0: 1
1: 0
2: 0
3: 2
4: 52
1097019036_1097019047 -4 Left 1097019036 12:56007366-56007388 CCCATTTTCCCCCAGCAGTCTCC 0: 1
1: 0
2: 2
3: 19
4: 294
Right 1097019047 12:56007385-56007407 CTCCCGGGCTTGGGGACGCTCGG 0: 1
1: 0
2: 1
3: 12
4: 147
1097019036_1097019051 23 Left 1097019036 12:56007366-56007388 CCCATTTTCCCCCAGCAGTCTCC 0: 1
1: 0
2: 2
3: 19
4: 294
Right 1097019051 12:56007412-56007434 CGGCCACGCCGCCTGTCGCCTGG 0: 1
1: 0
2: 0
3: 2
4: 92
1097019036_1097019054 30 Left 1097019036 12:56007366-56007388 CCCATTTTCCCCCAGCAGTCTCC 0: 1
1: 0
2: 2
3: 19
4: 294
Right 1097019054 12:56007419-56007441 GCCGCCTGTCGCCTGGTAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097019036 Original CRISPR GGAGACTGCTGGGGGAAAAT GGG (reversed) Intergenic
901221331 1:7585640-7585662 GGAGGCTGCAGGAGGACAATGGG + Intronic
902408386 1:16198960-16198982 GGAGAGTGATGGGGGAGAGTGGG - Intronic
903429798 1:23286631-23286653 GCATGCTGTTGGGGGAAAATGGG - Intergenic
905140957 1:35844015-35844037 AGAAATTGCTGGGGGAAAAGTGG + Intronic
905304858 1:37010582-37010604 GGAGACTGCTGGGGTAATCCTGG - Intronic
905573669 1:39026259-39026281 GGAGACGGCTGAGGGAAGGTCGG + Intergenic
906048163 1:42848512-42848534 GGAGATTGCTGAGGAAAAGTGGG + Intronic
907845597 1:58203441-58203463 GGAGACAGTTGGGTGAATATGGG - Intronic
908722719 1:67143467-67143489 GGTCACTGCTGTGGGAAACTGGG + Intronic
909635535 1:77813083-77813105 GGAGGCTGATGCGGGAGAATCGG - Intronic
910757744 1:90709739-90709761 GGGGACTGCTGGCAGCAAATGGG + Intergenic
911031003 1:93488344-93488366 GGAGACTGCTTGGGTATACTGGG - Intronic
911145836 1:94551785-94551807 GGAGACGGCTGGGTGAAAATGGG + Intergenic
912555762 1:110514830-110514852 GGACACTGAAGGGGAAAAATGGG + Intergenic
912732797 1:112124716-112124738 ACAGACTGCTTGGGGAAGATGGG - Intergenic
913014957 1:114723310-114723332 GGTGACTGTTGGGGGAACAGCGG + Intronic
915513784 1:156401172-156401194 GGAGGCTACTGGGGGAACTTGGG - Intergenic
915894713 1:159802825-159802847 GGAGGCTGCTGGGGGCAACAGGG + Intronic
917004760 1:170401807-170401829 GGAGACTACTGGGGGAGAAGGGG + Intergenic
918056687 1:181027390-181027412 AGAGATTGTTGGGGGAGAATGGG - Intergenic
919562900 1:199144940-199144962 AGAGACAACTGGGGGAAAACAGG + Intergenic
924491152 1:244539015-244539037 GGAGAATGCTGGGGCTAGATGGG - Intronic
924554207 1:245104599-245104621 GGAAACTGTTGAGGGAGAATAGG - Intronic
924792166 1:247261857-247261879 GAAAAATGCTGGGGGATAATTGG + Intergenic
1063077311 10:2730366-2730388 GGAGGCTGAGGCGGGAAAATGGG + Intergenic
1063751536 10:8954393-8954415 GGAGAGTGTTGTGGGGAAATGGG + Intergenic
1065434931 10:25696055-25696077 GCTGAGTTCTGGGGGAAAATAGG + Intergenic
1066321509 10:34307808-34307830 GGATACAGCAGGGGAAAAATGGG + Intronic
1068670766 10:59720754-59720776 GGGACCTGCTGAGGGAAAATGGG + Intronic
1071524305 10:86349242-86349264 GGAGGCTGCTGGGGGAAGAGGGG + Intronic
1071725369 10:88193182-88193204 CGAGTCTGCAGGTGGAAAATGGG + Intergenic
1072569544 10:96646625-96646647 GGAGACTGCTGAAGGAACAGGGG - Intronic
1076519849 10:131074720-131074742 AGAGGCTGCTGGGGGAAACGTGG + Intergenic
1077101723 11:825461-825483 GGAGGCTGCTGGGCAAAATTGGG - Exonic
1078427338 11:11262378-11262400 GGAGAGAGCTGAGGGAAGATCGG + Intergenic
1079062674 11:17263191-17263213 GCAAACTGCTGGGGGAACAGTGG + Intronic
1079503756 11:21131938-21131960 GGAGATTTCTGAGGGAAAACTGG + Intronic
1079933100 11:26589591-26589613 AGGGACTTTTGGGGGAAAATAGG - Intronic
1080122355 11:28692273-28692295 GGGGACTACAGGGGGAAATTTGG - Intergenic
1080573776 11:33579892-33579914 TGAAACTACTGGGAGAAAATGGG - Intronic
1081428243 11:42948966-42948988 GGAAAGTGCTGAGGGAATATAGG + Intergenic
1081735649 11:45401580-45401602 GGAGAATGCAGGGGGAGAGTGGG + Intergenic
1082183393 11:49147821-49147843 GGAGGCTGCTGCAGGAAGATTGG + Intronic
1082804764 11:57440806-57440828 AGAGGCTGATGGGGGAAAATCGG - Intergenic
1084209232 11:67613352-67613374 GGAAACTGATCGGGGAAGATTGG + Intergenic
1085177528 11:74503570-74503592 GGAGGCTGCAGTGGGAGAATTGG - Intronic
1085822827 11:79811235-79811257 GGAGACTGAGGTGGGAGAATTGG + Intergenic
1088173462 11:107022338-107022360 GGAGAAGGCTGGGGGAAAGGAGG + Intergenic
1088194210 11:107257662-107257684 GGATCATGCTGGGGGAAACTGGG + Intergenic
1088432219 11:109771093-109771115 GGCGACTCCGGGGGGAAAAGGGG + Intergenic
1088633963 11:111801334-111801356 AGAAACTGCTGTGGCAAAATTGG + Intronic
1089160728 11:116435089-116435111 GGAGGCTGCTGGAGGGAAAGTGG - Intergenic
1089428180 11:118398196-118398218 GGAGAAAACTGGAGGAAAATGGG + Exonic
1090494202 11:127193841-127193863 AGAGAGTGCTGGGGGCAAAGTGG + Intergenic
1091210698 11:133855619-133855641 AGAGAGGGTTGGGGGAAAATAGG - Intergenic
1091699936 12:2652657-2652679 GGAGGCTGCTGGGGGCAGAGCGG - Intronic
1092763205 12:11827987-11828009 CGAAACTGCTGGAGGAAAGTTGG - Intronic
1093310327 12:17574292-17574314 GGACACTACTGGGGAAAAAAAGG + Intergenic
1093957260 12:25235433-25235455 GGAGACTGATGTGGGTAGATGGG - Intronic
1097019036 12:56007366-56007388 GGAGACTGCTGGGGGAAAATGGG - Intergenic
1097807468 12:63981764-63981786 GGGGAGTCCTGGGGGAAAACAGG - Intronic
1099273614 12:80546997-80547019 TGAGACAGCTGGGGAAAAAGGGG + Intronic
1100240484 12:92706405-92706427 GGAGACTGCAGTGAGAAAAAAGG - Intronic
1100659302 12:96679320-96679342 GGAGGCTTCATGGGGAAAATTGG + Intronic
1104876307 12:132037402-132037424 TGAGACTGGTGGGAGAAAAACGG + Intronic
1105710376 13:23002398-23002420 GGAGACTGAGGGAGGAGAATCGG - Intergenic
1106282072 13:28283475-28283497 ATAGACTGATGGGGGAAACTGGG - Intronic
1106392914 13:29353271-29353293 GGAGACTGATGTGGGAGGATCGG - Intronic
1106727149 13:32497635-32497657 GCAGAGTGCTGGAGGAAAAATGG + Intronic
1108145565 13:47472892-47472914 GGAGAATGTTGGGGGAAGGTTGG - Intergenic
1109168868 13:59071460-59071482 GGACACTGCTGGGGGAATTAGGG - Intergenic
1109283480 13:60384517-60384539 AGAGACTGATTGGGGGAAATAGG + Intergenic
1109854086 13:68106486-68106508 GGAGATGGCTTGGGGAAAAAAGG + Intergenic
1110294464 13:73846369-73846391 GGAGACTGTGGGGAGAAAAATGG + Exonic
1114481210 14:23036001-23036023 AGAGTCTGCTGGGGGAAAGATGG - Intergenic
1114835426 14:26197905-26197927 GGGGACTGGTGGGGGGACATTGG + Intergenic
1115214285 14:30999145-30999167 GGAGGCTGATGTGGGAGAATTGG - Intronic
1116654940 14:47640414-47640436 GAAGACTAGTGGGGTAAAATTGG - Intronic
1119041821 14:71281322-71281344 GGAGACTGGTGAGGAAAAATGGG + Intergenic
1119193551 14:72701139-72701161 GGAGACTGGAGTGGGAAGATGGG - Intronic
1119423805 14:74523329-74523351 GAAAACTGCCAGGGGAAAATGGG + Intronic
1121316624 14:92964692-92964714 GGAGGCTGCTGGGGTCAAACAGG + Intronic
1121495570 14:94389555-94389577 GGAGACTGCTGGGGGTGGAGGGG + Intronic
1121560155 14:94868558-94868580 GGAGGCAGATGGGGCAAAATGGG - Intergenic
1121828379 14:97029083-97029105 TGAGACTCCTGAGGGGAAATGGG + Intergenic
1122289869 14:100674805-100674827 GGAGAATTCAGGAGGAAAATGGG - Intergenic
1124390335 15:29250035-29250057 GGAGACTGCTGGGAGGTGATTGG - Intronic
1127535519 15:59886576-59886598 GGAGGGTGTTGGGGAAAAATTGG - Intergenic
1127851732 15:62919165-62919187 GGAGTCGGGTGGGAGAAAATGGG + Intergenic
1127912685 15:63431066-63431088 GGAGACAGCTGGGAGCAGATGGG + Intergenic
1128671388 15:69576937-69576959 GGAGACAGGTGGGGGAAGCTTGG + Intergenic
1130221267 15:82021520-82021542 GGAGATTGCTGGGAAGAAATGGG + Intergenic
1132730672 16:1360003-1360025 GGAGACTGAGGCGGGAAAATCGG + Intronic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1136579633 16:31143511-31143533 GGAGACTGCTGGGAGTGATTGGG - Intronic
1138676483 16:58655116-58655138 GGAGAGAGCTGGGGGAATAGAGG + Intergenic
1139725544 16:68894600-68894622 GGGGACAGCTGGGATAAAATTGG + Intronic
1142608762 17:1096664-1096686 GGAGAGAGCTGGGGGAAGGTGGG + Intronic
1143161282 17:4873100-4873122 GGAGGCTGCAGGGGGATAAGGGG - Intronic
1143655708 17:8292382-8292404 GTAGACTCCAGGGGCAAAATGGG + Intronic
1144044121 17:11439486-11439508 TTAGACTTCTGGGGGAAAAATGG + Intronic
1145738927 17:27255787-27255809 TGTGACTACTGGGGGAAACTGGG + Intergenic
1148494615 17:48045837-48045859 GGAGAGTGTTGGGGGAAAGGAGG + Intergenic
1149399802 17:56284243-56284265 GGAAATTTCTGTGGGAAAATTGG + Intronic
1150170406 17:62987715-62987737 GGAGAGTGCTGGGGTACAGTAGG - Intergenic
1152199658 17:78938019-78938041 GGTGCCTGCTGGTGGAAAAGGGG - Intergenic
1153606851 18:6842709-6842731 GGAGAGTTCTGGGAGAAAAGAGG - Intronic
1155162293 18:23205898-23205920 GGAGAATGCTGTGTGAAGATTGG + Intronic
1156794049 18:41019037-41019059 TGAGACTGCTGGAAGAAAACAGG + Intergenic
1156852732 18:41746794-41746816 TGAGAGAGCTGGGGGAAAAGGGG + Intergenic
1157442477 18:47721399-47721421 GGAGAGTGATGAGGGAGAATAGG + Intergenic
1157516483 18:48315233-48315255 GGAGTTTGCTGGGGGTAAATTGG + Intronic
1158946553 18:62452006-62452028 GGAGACTGAGGCGGGAAGATTGG - Intergenic
1160088590 18:75803976-75803998 TGAGCCTGCTGGTGAAAAATAGG + Intergenic
1160877730 19:1304978-1305000 GGAGGCTGCTAGGGGAAAGGAGG + Intergenic
1160958981 19:1709105-1709127 GGAGACTGGTAGGGGAACAAGGG - Intergenic
1162433405 19:10642860-10642882 GGAACCGGCAGGGGGAAAATGGG - Intronic
1163110734 19:15159882-15159904 GGGGGCTGCTGGTGGGAAATGGG - Exonic
1163667300 19:18609308-18609330 GGAGAGTGCTGGGGGAAGGGTGG - Intronic
1164793775 19:31009808-31009830 GGTCACTTCTGGGGGAAAAGAGG + Intergenic
1164843672 19:31413593-31413615 GCAGACTGCTGGGAAAAACTGGG + Intergenic
1165147791 19:33742904-33742926 CGAGACTGATGGGGGACAATAGG - Intronic
1166975568 19:46603232-46603254 AGGTTCTGCTGGGGGAAAATGGG - Intronic
1167524930 19:49977679-49977701 GGAGGCTGCTGGGGGAGCAAGGG + Intronic
925046018 2:773694-773716 GGTGCCTGCTGGGGGGAAACAGG - Intergenic
925162329 2:1694587-1694609 GGAGACTGTTGGTGGACAGTGGG - Intronic
925673177 2:6333544-6333566 GGAGACTGCCCTGAGAAAATTGG + Intergenic
925729722 2:6910594-6910616 GGAAAGTTCTGGGGGATAATGGG - Intergenic
926655997 2:15406999-15407021 GGAGACTGCTGGGTTTAAAAAGG - Intronic
926721942 2:15967412-15967434 GGAGAGAGTTGGGGGAAAAGGGG - Intergenic
927245828 2:20956509-20956531 GGAGCCTGCAGGGGCAGAATGGG + Intergenic
930000440 2:46857754-46857776 GGAGACTGAGGTGGGAGAATTGG + Intronic
930799056 2:55423381-55423403 GGGGAAAGTTGGGGGAAAATAGG + Intergenic
931297518 2:60943097-60943119 TGAGACTTCTGAGGGAAAATTGG - Intronic
932003619 2:67906734-67906756 GGAGAAGGCTGGAGGAAAATGGG + Intergenic
932158708 2:69440898-69440920 GGAGAGTGCTCTGGGAAAAAAGG - Intergenic
937445834 2:121957115-121957137 GAAGGTGGCTGGGGGAAAATGGG - Intergenic
938661321 2:133489993-133490015 GGAGAGGGCTGAGGGGAAATAGG + Intronic
939751523 2:146053245-146053267 GGAGAATGCTGTGGGTATATTGG - Intergenic
939864859 2:147461303-147461325 GGAGACCACTGGGAGAAATTTGG - Intergenic
939931899 2:148245491-148245513 GGAGGCTGCAGTGGGAAGATGGG + Intronic
939969364 2:148643236-148643258 GGAGACTGCAGAGAGAAAAGGGG + Intergenic
940599764 2:155844469-155844491 GAAGACTGTTTGGAGAAAATAGG - Intergenic
940924217 2:159345688-159345710 GGAAAAAGCTGGAGGAAAATAGG + Intronic
946236206 2:218326001-218326023 GGAAACTGTAGGGGGGAAATGGG + Intronic
946877554 2:224145177-224145199 GAGGAATGCTGAGGGAAAATGGG + Intergenic
1169106119 20:2996046-2996068 AGAGACTGCTAGGGGAAACGTGG - Intronic
1169345927 20:4828051-4828073 GGTTACTGCTGGGGGCAACTGGG + Intergenic
1170201477 20:13749167-13749189 GGAGACTGAGGTGGGAGAATCGG - Intronic
1170327376 20:15171441-15171463 GGAGAGTGATGGGGGAAGGTAGG - Intronic
1170481766 20:16773056-16773078 GGAGCCTGGTGGGAGATAATTGG + Intergenic
1170586355 20:17737223-17737245 GGTGACCGCTGTGGGAAACTAGG - Intergenic
1170971004 20:21116534-21116556 GGAGTCTGCTGGGAGATGATTGG - Intergenic
1174071713 20:47904469-47904491 GGGGACGGCTGTGGGAAAAGGGG - Intergenic
1174816083 20:53688404-53688426 GGAGGCTGAGGTGGGAAAATTGG + Intergenic
1175242059 20:57556971-57556993 GTAGGCTGCTGGGAGAAATTGGG + Intergenic
1177964467 21:27710936-27710958 GGAGAATACTGGGGGATTATAGG - Intergenic
1180837156 22:18935623-18935645 GAACACTGTTGGGGAAAAATGGG - Intronic
1180937416 22:19634755-19634777 GGGGAGTGCTGGGGGAGACTGGG + Intergenic
1181064801 22:20300400-20300422 GAACACTGTTGGGGAAAAATGGG + Intergenic
1183480888 22:38064965-38064987 GGAGAGTGGTGGGGGAAGAAAGG - Intronic
1184751033 22:46486916-46486938 GGAGAGAGGTGGGGGAATATGGG - Intronic
1203287249 22_KI270734v1_random:160922-160944 GAACACTGTTGGGGAAAAATGGG - Intergenic
949156798 3:837509-837531 GGAGACTGGTGGGAGGAGATTGG - Intergenic
949177023 3:1076504-1076526 GGACACTTTTGGGGGAAAAATGG - Intergenic
949599045 3:5578917-5578939 GGAGAGTGTGGGGTGAAAATGGG + Intergenic
950341614 3:12251118-12251140 GGAGACTGCTAGGGGGAGAGAGG + Intergenic
950637795 3:14327633-14327655 GGAGACTGAGGTGGGAGAATTGG + Intergenic
951486746 3:23221447-23221469 TGAAAGAGCTGGGGGAAAATGGG - Intronic
952014998 3:28945885-28945907 GGAGGCGGCGGGGGGGAAATAGG - Intergenic
952951725 3:38531101-38531123 GGAGGCTGCTGGGGAAACTTGGG + Intronic
953393748 3:42549961-42549983 GGAGACAGCTGGGGCATATTCGG - Intronic
953784110 3:45897543-45897565 GGAGACTGCAGGAGCAGAATGGG - Intronic
954578650 3:51691107-51691129 GGAGACTGCTGGGGGAGCCGAGG + Intronic
954643090 3:52113999-52114021 GCAGAATGCTGGGGAGAAATCGG + Intronic
954933715 3:54307396-54307418 GTGGGCTGCTGTGGGAAAATGGG + Intronic
956539793 3:70323796-70323818 GCAGACTCCAGGAGGAAAATGGG - Intergenic
956831144 3:73049393-73049415 GGAGACTGAGGCAGGAAAATGGG + Intronic
957015752 3:75062989-75063011 GGGGACTTCTGGGGAAGAATGGG - Intergenic
957617833 3:82554299-82554321 GTACACTGCTGGGGGGCAATGGG + Intergenic
957625554 3:82649085-82649107 GGAGACTGCCAGGGGAAGACTGG + Intergenic
957857881 3:85901788-85901810 GGAGACAGTTGGGGGAAAGTCGG - Intronic
958006784 3:87822332-87822354 GGAGCCTATTGGAGGAAAATAGG + Intergenic
958784461 3:98582593-98582615 GGAGACTGAGGCAGGAAAATGGG - Intronic
959651856 3:108757998-108758020 TGAGAATGGTGGGGGAAAAAGGG - Intergenic
959956675 3:112246968-112246990 GGAGAAAACTGGAGGAAAATGGG - Intronic
960503497 3:118465611-118465633 GTAGAGTGCTGGGGGAAGGTAGG - Intergenic
961034447 3:123632602-123632624 GAAGAATGCTGGGGGAACTTGGG - Intronic
961321798 3:126082223-126082245 GGAGGCTCCTGTGGGAAAGTGGG + Intronic
961323800 3:126097764-126097786 GGAGAAAGCACGGGGAAAATGGG + Intronic
961329272 3:126129193-126129215 GGAGGCTCCTGTGGGAAAGTGGG - Intronic
961556327 3:127698721-127698743 TGTCACTGCTGGGGGAAACTGGG + Intronic
963735683 3:149015689-149015711 GGAGACTGAAGGAGGAGAATTGG + Intronic
963970962 3:151429186-151429208 AGAGACTCATGGAGGAAAATTGG + Intronic
964772242 3:160236519-160236541 GGAGACTGCTGGGGATGACTGGG - Intronic
965379130 3:167966720-167966742 GGTGTCTGCTGCTGGAAAATGGG - Intergenic
965414637 3:168377697-168377719 GGGGACTGGTGGGGGAAGGTGGG - Intergenic
967525976 3:190493125-190493147 GGAAACTGCTGGAGGAATTTGGG - Intergenic
967533751 3:190578613-190578635 GTAGACTGATGGAGGAAAGTGGG - Intronic
968546836 4:1203244-1203266 GGGCACAGCTGGGGGAAAATGGG - Intronic
968605366 4:1532709-1532731 GGAGGCTGCTGGGGACACATCGG - Intergenic
969156609 4:5216616-5216638 GGACACTGCAGAGGGAAGATGGG + Intronic
970139066 4:12960342-12960364 GGAGAGTGATGGCAGAAAATAGG - Intergenic
970226684 4:13866084-13866106 GGAGACTGATGAGGCACAATAGG - Intergenic
970441548 4:16084193-16084215 GGACTCTGCGGGGGGAAAAGAGG - Intronic
972609072 4:40640548-40640570 GGAGCCTGCTGGAGGGACATGGG + Intergenic
973724796 4:53764388-53764410 TGAGGCTGCTGGGGGAGTATGGG + Intronic
973782402 4:54300752-54300774 TGAGGCTGCTGGGGGGAAATGGG - Intergenic
975351846 4:73356094-73356116 GGAGATTTCTAGGAGAAAATTGG - Intergenic
976508796 4:85883069-85883091 GGATACTTCTGGGGAACAATGGG + Intronic
976642590 4:87354538-87354560 GGAGGCTGATGTGGGAGAATAGG + Intronic
977059202 4:92235882-92235904 GGAAAGTGCTGAGGGAAAAAAGG + Intergenic
980153381 4:129076405-129076427 ATAGTCTGCTGGGGGAAAAAAGG - Intronic
981026095 4:140078346-140078368 GGAGAATGCTAGAGAAAAATAGG + Intronic
981649675 4:147041838-147041860 GAATACTGGTGGGGGAAACTGGG - Intergenic
983630877 4:169848192-169848214 GGAAACAGGAGGGGGAAAATGGG - Intergenic
983662536 4:170144315-170144337 GGAGACTGCGGGGGGAATGCTGG - Intergenic
984558594 4:181241831-181241853 GGAGACTGGTGGGGAGAAGTAGG + Intergenic
985156920 4:186998958-186998980 GGAGGAAGCTGGGGGAAAGTGGG - Intergenic
985894512 5:2740477-2740499 GGAGACTGCAGGGCAGAAATGGG + Intergenic
987467488 5:18289727-18289749 GGAGACAGATGTGGGGAAATAGG - Intergenic
990719126 5:58673389-58673411 GGAAACTGTAGGGGGAAAGTGGG + Intronic
991001614 5:61789130-61789152 GTAGACTAATTGGGGAAAATAGG + Intergenic
991256700 5:64622149-64622171 GGTCACTGATGAGGGAAAATAGG - Intergenic
991694497 5:69257637-69257659 GGAGACTGCAGTGTGATAATGGG + Intronic
992209026 5:74459546-74459568 GGAGACCGGAGGGGGAGAATTGG - Intergenic
993768463 5:91893348-91893370 GGAGTCTGCTGGAGGAAATATGG + Intergenic
994617538 5:102124439-102124461 GGTGACTGATGGGGGAAGGTTGG + Intergenic
997386394 5:133476114-133476136 AGAGGCTGCTGGGGCAAAAACGG + Intronic
997631477 5:135372368-135372390 GGAGACTGATGGGTGAAAGTGGG - Intronic
1001151151 5:169228254-169228276 GGAAACTGCTGGAAGAATATTGG + Intronic
1001643036 5:173258701-173258723 GGTGACTGCTGGCAGAAAGTTGG - Intergenic
1001826424 5:174749217-174749239 GGAGACTTCTGGAGAAAAAGAGG + Intergenic
1002692895 5:181062960-181062982 GGAGATTATTGGGGGAAAAAAGG + Intergenic
1003946932 6:11084541-11084563 GGAAACTGCAGGGGCAAACTAGG - Intergenic
1005864674 6:29928444-29928466 GAAGACTGCTCTGGGAAAAAAGG - Intergenic
1005984113 6:30859872-30859894 GGGCACTGCGGGAGGAAAATGGG - Intergenic
1006725934 6:36198844-36198866 AGAGAATGATGGGGGAAACTAGG + Intronic
1007215373 6:40233285-40233307 GGAGACTACTGTGGGAAACTGGG - Intergenic
1007370930 6:41426818-41426840 GGAGAAAGCTGGGGGAGAAGGGG + Intergenic
1007731622 6:43951043-43951065 GGAGAATGCAGGGGGTGAATTGG + Intergenic
1012105493 6:95152338-95152360 GGAAACAGTTGGGGGAAAGTGGG - Intergenic
1012183836 6:96189098-96189120 GGAGACTGTTCGGGGAAGGTTGG + Intronic
1012687496 6:102270477-102270499 GGAAACTGGTGGGAGATAATTGG - Intergenic
1012997329 6:105986452-105986474 TCAGATTTCTGGGGGAAAATGGG + Intergenic
1013504385 6:110785206-110785228 GGAGACTGATGAAGGCAAATTGG - Intronic
1013667028 6:112359487-112359509 GGGGACTGACGGGGGAAGATCGG + Intergenic
1014588575 6:123232381-123232403 GGAGACTGTTGGGGCAGAAATGG + Intronic
1015010839 6:128344991-128345013 GGAGAATGGGGGGGGAAAGTAGG + Intronic
1016351832 6:143176994-143177016 GGAGAATGCGGGGGAAAAAATGG - Intronic
1018945691 6:168345804-168345826 GGGGACAGCTGGGGGAAGCTGGG + Intergenic
1018945746 6:168345920-168345942 GGGGACAGCTGGGGGAAGCTGGG + Intergenic
1018945799 6:168346034-168346056 GGGGACAGCTGGGGGAAGCTGGG + Intergenic
1022122303 7:27321162-27321184 GAAGACTGTTGGGGCAAAACTGG - Intergenic
1023071606 7:36440269-36440291 GGAGACTGCAGGGAGAGAAACGG + Intronic
1023152076 7:37211683-37211705 GGAGACTGACGGGGGAAGAGTGG - Intronic
1023499176 7:40829944-40829966 GGAGAATACTGGGGGAGAAATGG - Intronic
1024189528 7:46992036-46992058 GGAGACTGACGGGGCAAAGTCGG + Intergenic
1024233948 7:47384082-47384104 GGAGACAGTGGGGGGAGAATGGG - Intronic
1026046361 7:66908185-66908207 GGGCACTGCTGCTGGAAAATGGG + Intergenic
1026056842 7:66992308-66992330 GGGGCCTGTGGGGGGAAAATGGG + Intronic
1026678456 7:72447548-72447570 GGACACTGCCTGGGGAAAGTGGG + Intergenic
1029014728 7:97304031-97304053 GTAAACTGTTGTGGGAAAATAGG - Intergenic
1029407475 7:100384333-100384355 CTAGAGTGCAGGGGGAAAATTGG + Intronic
1032120232 7:129150077-129150099 GGAGACAGCTGAGGGTAAAGTGG - Intronic
1032170155 7:129577869-129577891 GGAGAATGCTGGGAGAACAGAGG + Intergenic
1032229305 7:130060389-130060411 GGAGGCTGAGGTGGGAAAATGGG - Intergenic
1033385909 7:140874802-140874824 GGGGCCTGATGGGAGAAAATTGG + Intronic
1034392033 7:150794345-150794367 GGAGAATGGGGGGGGAAAAGTGG - Intronic
1034419521 7:150981749-150981771 AGACACTGCTGGGGGACAAGAGG + Intergenic
1034436159 7:151063605-151063627 GCAGACTGCTGGGGGGACACTGG + Intronic
1034449256 7:151128700-151128722 GGAGCCTCCTGGGGGAGTATGGG + Intronic
1034877652 7:154739441-154739463 GGACACTGCTGTGGGGGAATGGG + Intronic
1037017456 8:13926028-13926050 GGAGACTGATAGGGGGACATGGG - Intergenic
1037311363 8:17560111-17560133 GGTGACTACTGGGGGAAATTGGG + Intronic
1037605219 8:20432756-20432778 GGAGTCCGCTGGGTGAAAATTGG + Intergenic
1038294767 8:26280998-26281020 GCAGACTTCTGGGGGAAATATGG + Intergenic
1038863460 8:31413021-31413043 GGAGAGTGATGGGGAAAAAACGG - Intergenic
1039499519 8:38005506-38005528 GGAGCCTGGTGGGAGAAGATTGG + Intergenic
1041868954 8:62611433-62611455 GGAGTCTGATGGGGGGAAGTGGG - Intronic
1041957206 8:63569368-63569390 GGAAACTGGTGGAAGAAAATGGG - Intergenic
1042567663 8:70128892-70128914 GCATACTGCTGTGGGAAAACGGG + Exonic
1042759323 8:72253448-72253470 GGGGAATGCTGGGAGAAAAGTGG + Intergenic
1045210696 8:100096005-100096027 AGAAACTGCAGTGGGAAAATAGG - Intronic
1045380787 8:101622839-101622861 GGGGACTTCTGGGGAAAAGTGGG - Intronic
1045587814 8:103559129-103559151 TGAGGCTGCTGGGGGCAAATGGG - Intronic
1046747545 8:117892463-117892485 GGAGACTGCTGAGGAAGAAGAGG + Intronic
1048348387 8:133595588-133595610 GGGGACTCCTGGGGGAAGAGGGG + Intergenic
1048432446 8:134382721-134382743 GGAGGCTGCTGGGAGAAGAGTGG - Intergenic
1051198771 9:14593952-14593974 GGAGACAGCTTGGGGAAACAGGG + Intergenic
1051979247 9:22994086-22994108 GGAGACAGCAGGCAGAAAATTGG + Intergenic
1052105510 9:24510108-24510130 AGAGACTTATTGGGGAAAATTGG + Intergenic
1052237150 9:26225123-26225145 GGAGACCTGTGTGGGAAAATTGG - Intergenic
1053288570 9:36865296-36865318 AGAGACTACTGGGGGACAAGAGG - Intronic
1055096655 9:72421294-72421316 AGAGACTGAAGGGGGAAAAAGGG + Intergenic
1055713069 9:79086699-79086721 GGAGGCTGAGGCGGGAAAATCGG + Intergenic
1056134318 9:83616572-83616594 GGTGGCTGTTGGGAGAAAATGGG - Intergenic
1058156143 9:101518036-101518058 GAAGACTGCTGGAGGAGAAAGGG - Intronic
1059948861 9:119441182-119441204 GGAAAGTGGTGGGGGAGAATAGG - Intergenic
1062113346 9:134794828-134794850 TCAGACTGCAGGAGGAAAATTGG + Intronic
1062525574 9:136976823-136976845 GGGGATTGCTGGGGGAAGTTGGG + Intergenic
1186641217 X:11457830-11457852 GGTTACTGCTGTGGGAAAGTGGG - Intronic
1186996829 X:15132410-15132432 GGTTACTGCTGGGGGCAATTGGG - Intergenic
1188055170 X:25532107-25532129 GGAGACTCCTGAGGGAAAAAAGG - Intergenic
1189566522 X:42247226-42247248 AGAGATTATTGGGGGAAAATAGG - Intergenic
1190069026 X:47264042-47264064 GGAGACTGTTGGAGGAAAAGTGG - Intergenic
1190131315 X:47751389-47751411 GCAGACTGCTGGGAGAAAATGGG + Intergenic
1190878403 X:54475629-54475651 GGAGGCCACTGAGGGAAAATAGG - Intronic
1191234483 X:58123140-58123162 AGAGACTCCTGGCGAAAAATAGG + Intergenic
1195342159 X:103916896-103916918 GGAGATGGCTGGGGGAAATATGG - Intergenic
1195597976 X:106714462-106714484 TGATACTACTGGGGGAAACTGGG - Intronic
1195677378 X:107517382-107517404 TGAGATTTCTTGGGGAAAATGGG + Intergenic
1196150709 X:112370281-112370303 GGAGGCTGCTGGGGGCAGGTTGG - Intergenic
1199926236 X:152467562-152467584 GGATACGGGTGAGGGAAAATGGG + Intergenic
1200120107 X:153786154-153786176 GGAGGCTGCAGGGGGAGACTGGG + Intronic
1201013957 Y:9579229-9579251 GGAGACTGATGCAGGAGAATTGG - Intergenic