ID: 1097019148

View in Genome Browser
Species Human (GRCh38)
Location 12:56007699-56007721
Sequence GCGCGCGCGCAGGCTGTGAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 109}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097019148_1097019169 29 Left 1097019148 12:56007699-56007721 CCCCTCACAGCCTGCGCGCGCGC 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1097019169 12:56007751-56007773 GCTTGGTGGGGGTAAAGCGGGGG 0: 1
1: 0
2: 2
3: 32
4: 183
1097019148_1097019158 6 Left 1097019148 12:56007699-56007721 CCCCTCACAGCCTGCGCGCGCGC 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1097019158 12:56007728-56007750 ACCTCAGGTGAGTGAGGGGCGGG 0: 1
1: 0
2: 6
3: 29
4: 274
1097019148_1097019157 5 Left 1097019148 12:56007699-56007721 CCCCTCACAGCCTGCGCGCGCGC 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1097019157 12:56007727-56007749 CACCTCAGGTGAGTGAGGGGCGG 0: 1
1: 0
2: 3
3: 23
4: 222
1097019148_1097019162 15 Left 1097019148 12:56007699-56007721 CCCCTCACAGCCTGCGCGCGCGC 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1097019162 12:56007737-56007759 GAGTGAGGGGCGGGGCTTGGTGG 0: 1
1: 0
2: 12
3: 143
4: 1175
1097019148_1097019155 1 Left 1097019148 12:56007699-56007721 CCCCTCACAGCCTGCGCGCGCGC 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1097019155 12:56007723-56007745 GAGACACCTCAGGTGAGTGAGGG 0: 1
1: 0
2: 3
3: 12
4: 165
1097019148_1097019156 2 Left 1097019148 12:56007699-56007721 CCCCTCACAGCCTGCGCGCGCGC 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1097019156 12:56007724-56007746 AGACACCTCAGGTGAGTGAGGGG 0: 1
1: 0
2: 1
3: 22
4: 183
1097019148_1097019154 0 Left 1097019148 12:56007699-56007721 CCCCTCACAGCCTGCGCGCGCGC 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1097019154 12:56007722-56007744 GGAGACACCTCAGGTGAGTGAGG 0: 1
1: 0
2: 3
3: 23
4: 212
1097019148_1097019168 28 Left 1097019148 12:56007699-56007721 CCCCTCACAGCCTGCGCGCGCGC 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1097019168 12:56007750-56007772 GGCTTGGTGGGGGTAAAGCGGGG 0: 1
1: 0
2: 0
3: 12
4: 138
1097019148_1097019153 -9 Left 1097019148 12:56007699-56007721 CCCCTCACAGCCTGCGCGCGCGC 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1097019153 12:56007713-56007735 CGCGCGCGCGGAGACACCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 23
1097019148_1097019161 12 Left 1097019148 12:56007699-56007721 CCCCTCACAGCCTGCGCGCGCGC 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1097019161 12:56007734-56007756 GGTGAGTGAGGGGCGGGGCTTGG 0: 1
1: 0
2: 11
3: 101
4: 1009
1097019148_1097019166 26 Left 1097019148 12:56007699-56007721 CCCCTCACAGCCTGCGCGCGCGC 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1097019166 12:56007748-56007770 GGGGCTTGGTGGGGGTAAAGCGG 0: 1
1: 0
2: 7
3: 34
4: 462
1097019148_1097019165 18 Left 1097019148 12:56007699-56007721 CCCCTCACAGCCTGCGCGCGCGC 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1097019165 12:56007740-56007762 TGAGGGGCGGGGCTTGGTGGGGG 0: 1
1: 0
2: 11
3: 100
4: 829
1097019148_1097019167 27 Left 1097019148 12:56007699-56007721 CCCCTCACAGCCTGCGCGCGCGC 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1097019167 12:56007749-56007771 GGGCTTGGTGGGGGTAAAGCGGG 0: 1
1: 0
2: 1
3: 22
4: 267
1097019148_1097019164 17 Left 1097019148 12:56007699-56007721 CCCCTCACAGCCTGCGCGCGCGC 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1097019164 12:56007739-56007761 GTGAGGGGCGGGGCTTGGTGGGG 0: 1
1: 0
2: 17
3: 79
4: 841
1097019148_1097019163 16 Left 1097019148 12:56007699-56007721 CCCCTCACAGCCTGCGCGCGCGC 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1097019163 12:56007738-56007760 AGTGAGGGGCGGGGCTTGGTGGG 0: 1
1: 0
2: 5
3: 61
4: 539
1097019148_1097019160 7 Left 1097019148 12:56007699-56007721 CCCCTCACAGCCTGCGCGCGCGC 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1097019160 12:56007729-56007751 CCTCAGGTGAGTGAGGGGCGGGG 0: 1
1: 0
2: 2
3: 30
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097019148 Original CRISPR GCGCGCGCGCAGGCTGTGAG GGG (reversed) Exonic
900313125 1:2043960-2043982 GCGCGCGCACATACTGTCAGAGG - Intergenic
901206036 1:7496450-7496472 GTGCACACGCAGGCTGTGACAGG - Intronic
901641435 1:10694903-10694925 GCGCGCTCGCATGCTGCCAGCGG + Intronic
902348430 1:15835920-15835942 GCGCGCGCGCTCGCCGTGCGGGG + Intergenic
902350028 1:15847647-15847669 GCGCGCGCGCCCGCGGCGAGGGG + Intergenic
903641154 1:24861424-24861446 ACGAGCGCACAGGCTCTGAGAGG + Intergenic
905375139 1:37514815-37514837 CCGCGCGCGCAGGCGCAGAGCGG - Intergenic
911043253 1:93608459-93608481 CCTCTCGCGCAGGCTGTGCGGGG + Intronic
920278844 1:204828609-204828631 GCGCGCACGCAGGGTGTCGGGGG + Intergenic
1069892606 10:71661708-71661730 GAGGGCGCGCAGGGTGGGAGGGG - Intronic
1069892634 10:71661778-71661800 GGGGGCGCGCAGGGTGGGAGGGG - Intronic
1070147673 10:73786354-73786376 GCGCGTGCGCGCGCTGTGACAGG + Intronic
1070198012 10:74176730-74176752 GCCCGCGCGCGGGGTGTGTGAGG + Intronic
1070963680 10:80516548-80516570 GGGCGGGGGCAGGCTGGGAGGGG + Intronic
1083668018 11:64285816-64285838 GCGCCCGCGCAGGCGCGGAGGGG + Intronic
1084786946 11:71448152-71448174 GCGTGCGCGCAGGTGGGGAGAGG - Intronic
1090408411 11:126491317-126491339 GGGCGCGTGCTGGCTCTGAGCGG + Intronic
1091386809 12:101168-101190 GCGAGCTTGCAGGCTGAGAGTGG - Intronic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1092462376 12:8697954-8697976 TCGCGCGCGCTGTGTGTGAGCGG + Exonic
1097019148 12:56007699-56007721 GCGCGCGCGCAGGCTGTGAGGGG - Exonic
1097863835 12:64543241-64543263 CCGCCCGCCCAGGCAGTGAGGGG + Intergenic
1103884236 12:124188901-124188923 GCGGGGGCGCAGGCTGTGTTTGG + Intronic
1104877883 12:132049142-132049164 GAGCCCCCGCAGGCTTTGAGAGG - Intronic
1105926916 13:25017333-25017355 GCGCGGGCGCAGGCGCGGAGAGG + Intergenic
1107027183 13:35814244-35814266 GCGCGCGTGCAGGCTTTAAATGG - Intronic
1113809499 13:113129719-113129741 GCGTGCGCGAAGGCTTTCAGGGG + Intronic
1113847448 13:113400813-113400835 GCGGGCGCAGAGTCTGTGAGCGG - Intergenic
1122975052 14:105167627-105167649 GCGCGCGCCCAGGCGGGGCGGGG - Intronic
1124505242 15:30266972-30266994 GGGCGCCCTCAGCCTGTGAGAGG + Intergenic
1124629469 15:31328236-31328258 GCGCGCGCTCAGGAGGGGAGGGG + Intronic
1124738310 15:32271663-32271685 GGGCGCCCTCAGCCTGTGAGAGG - Intergenic
1125522926 15:40358202-40358224 GCGCATGCGTAGGCTCTGAGCGG - Intergenic
1130965592 15:88695376-88695398 GTGCGCGCGCATGGTGTTAGAGG - Intergenic
1131259304 15:90880314-90880336 GCAAGCACGCGGGCTGTGAGAGG - Intronic
1132578664 16:675392-675414 GAGCCCGGGAAGGCTGTGAGAGG + Intronic
1132609408 16:807732-807754 GGGCGGGCGAAGGCTGCGAGCGG - Intronic
1134285999 16:12862568-12862590 GCGGGCGAGCAGGCGGTGAGCGG - Intergenic
1136845265 16:33571722-33571744 GCGCGGGCGCAGGCGCAGAGAGG + Intergenic
1141160364 16:81625547-81625569 GAGCGTGTTCAGGCTGTGAGGGG + Intronic
1142350429 16:89576918-89576940 GGGTGGGCTCAGGCTGTGAGGGG - Intronic
1203106973 16_KI270728v1_random:1420375-1420397 GCGCGGGCGCAGGCGCAGAGAGG + Intergenic
1203155433 16_KI270728v1_random:1872020-1872042 GCGCGGGCGCAGGCGCAGAGAGG + Intergenic
1143240408 17:5438912-5438934 GCGTGCGCGCAGGTTCCGAGCGG - Exonic
1147028308 17:37609022-37609044 GCGCGCGCCCAGTGTGGGAGGGG - Intronic
1147150421 17:38510783-38510805 GCGCGCCCGCAGGCTCCGGGGGG - Exonic
1147740424 17:42668178-42668200 GCCCGGGCGCTGGCTGGGAGGGG + Exonic
1147971233 17:44219915-44219937 CCGCCCGGGCAGGCTGTGGGAGG - Intronic
1148033834 17:44642729-44642751 GTGCGCGCGCACGCTAAGAGAGG + Intergenic
1148555960 17:48578647-48578669 GAGCGCGCGCAGGTTGCGACTGG + Exonic
1152628851 17:81400579-81400601 GCGCGGGCGCGGGCTGGGGGTGG + Intronic
1152689666 17:81712278-81712300 GCGCGCGCATTGGCTGTGCGGGG + Intronic
1154954684 18:21242416-21242438 GGGCGCGGGCAGGAGGTGAGAGG + Intronic
1161643072 19:5436364-5436386 GCGCGCGCGCGTGCGGGGAGGGG + Intergenic
1161802581 19:6424396-6424418 GCGCGCGCGCAGGCGGGGGAGGG - Intronic
1165325086 19:35109829-35109851 GCGCTGGCGCAGGCTGAGTGCGG + Intergenic
1165591553 19:36973517-36973539 GGCCGCGCGCAGGCAGGGAGTGG + Intronic
1166281892 19:41799693-41799715 GCGCTGGTGCAGGGTGTGAGTGG - Intronic
1168314070 19:55476507-55476529 GCTCGGGCGCAGGCGGTGCGCGG - Exonic
924958319 2:10851-10873 GCGCCCGCGCAGGCGCAGAGAGG + Intergenic
924958324 2:10880-10902 GCGCCCGCGCAGGCGCAGAGAGG + Intergenic
924958329 2:10909-10931 GCGCCCGCGCAGGCGCAGAGAGG + Intergenic
924958334 2:10938-10960 GCGCCCGCGCAGGCGCAGAGAGG + Intergenic
924958339 2:10967-10989 GCGCCCGCGCAGGCGCAGAGAGG + Intergenic
924958344 2:10996-11018 GCGCCCGCGCAGGCGCAGAGAGG + Intergenic
924958349 2:11025-11047 GCGCCCGCGCAGGCGCAGAGAGG + Intergenic
924958354 2:11054-11076 GCGCCCGCGCAGGCGCAGAGAGG + Intergenic
924958359 2:11083-11105 GCGCCCGCGCAGGCGCAGAGAGG + Intergenic
924958364 2:11112-11134 GCGCCCGCGCAGGCGCAGAGAGG + Intergenic
925730706 2:6917886-6917908 GCGCGGGCGCCGCCTGCGAGAGG - Intronic
926020186 2:9487838-9487860 GCGCGCGCGCGCGCTGTGGGGGG + Intronic
929061124 2:37925426-37925448 GTGCGTGCGCAGTCTGGGAGGGG + Intronic
929296584 2:40255274-40255296 GCACACTTGCAGGCTGTGAGTGG + Intronic
931614570 2:64143773-64143795 CCGCGCGCTCCGGCTGCGAGAGG - Intronic
934177135 2:89585597-89585619 GCGCGGGCGCAGGCGCCGAGAGG - Intergenic
934287442 2:91659956-91659978 GCGCGGGCGCAGGCGCCGAGAGG - Intergenic
938397766 2:130963640-130963662 GCGCGCACGCAGGCCTGGAGCGG - Intronic
943692385 2:190881514-190881536 GCCCGGGCTCAGGCTGTGTGGGG + Intronic
946329838 2:219002790-219002812 ACGCGCGCGCGAGCTCTGAGAGG - Intergenic
948115820 2:235493972-235493994 GCGCGCGGGCAGGCGGGGCGCGG + Intergenic
1169405084 20:5315894-5315916 GCGCGCGCCCGGGCTGGGACAGG + Intergenic
1170578677 20:17682198-17682220 GCGCGCACGCAGCCAGCGAGCGG - Exonic
1172277307 20:33686574-33686596 GGGCGCGCGCAGGCTTTGTCCGG + Intergenic
1179529705 21:42010288-42010310 GCGCGCGAGCCGAGTGTGAGCGG - Exonic
1179904914 21:44417848-44417870 GTGGGCACGCAGGCGGTGAGAGG + Intronic
950345319 3:12287838-12287860 GCGCGGGCGCCGGCTGGGGGTGG - Intronic
952942706 3:38455632-38455654 GCGCGCGCGCAGCCTGAGTCCGG + Intronic
954304619 3:49718989-49719011 GAGCGCGCGCAGGCCGTGGAAGG + Exonic
955384930 3:58471792-58471814 GAGGGCGCGCAGGCAGTGACTGG - Intergenic
962222221 3:133573657-133573679 GCGCGCGCGCAGGCCTGGAGAGG - Intergenic
974069457 4:57110500-57110522 GCGCGCGCGCAGGCCCCGCGGGG - Intergenic
982564552 4:156971521-156971543 GCCCGGGCGCAGGCGGAGAGAGG + Intergenic
993901162 5:93584945-93584967 GCGCGCGGGCGCGCTGGGAGGGG - Exonic
994107271 5:95961507-95961529 GGGCGCGGCCAGGCCGTGAGGGG + Intronic
1002444261 5:179279579-179279601 GTGCCCGAGCAGGCTCTGAGAGG - Intronic
1002559479 5:180071794-180071816 GCGCGCGCGCGGCCTGCGCGGGG + Exonic
1006620920 6:35363392-35363414 GCGGTGGCGCAGGCTTTGAGGGG - Intronic
1007451311 6:41941772-41941794 GCGCGCGCGCGGGCGGCGGGCGG - Exonic
1007693601 6:43718122-43718144 GGGCGCGCCCTGGCTGGGAGAGG + Intergenic
1029537690 7:101165718-101165740 GCGCAGGCGCAGGCCGGGAGAGG - Intergenic
1037900480 8:22685431-22685453 GCGCGCGCGCGCGCGGGGAGGGG + Intergenic
1039936524 8:42051459-42051481 GCGCGCGTGCCGGCTGTGCCGGG - Intronic
1045583117 8:103500435-103500457 GCGCGCGCGCCGCCTCGGAGGGG - Intergenic
1047319799 8:123768618-123768640 GCCCGCCCGCAGCCTGTCAGCGG - Exonic
1049181901 8:141227209-141227231 GCTCGGCCGCAGGCTGTGTGAGG + Intronic
1049724320 8:144138441-144138463 GCGCCCGCGCGGGCGGGGAGGGG + Intronic
1061009847 9:127948448-127948470 GCGCCTGGGCAGGCTGTGGGTGG - Intronic
1061108719 9:128552308-128552330 GGGCGCGCGCAAGGGGTGAGGGG - Intergenic
1061874965 9:133539099-133539121 GCGCACGTGCAGGGAGTGAGGGG + Intronic
1062540947 9:137041338-137041360 GCGCGGGCGCTTCCTGTGAGGGG + Intronic
1203445041 Un_GL000219v1:46091-46113 CCAGGCGCGCAGGCTGTGTGGGG + Intergenic
1186475975 X:9857980-9858002 GCGCTCGCAGAGGCTGGGAGGGG - Intronic
1187048630 X:15674867-15674889 GCGCATGCGCAGGATGCGAGTGG + Intergenic
1199760114 X:150898696-150898718 GCGCGCGCGCGGGCTTTGGGCGG - Exonic