ID: 1097020940

View in Genome Browser
Species Human (GRCh38)
Location 12:56020619-56020641
Sequence GGCCTTGTCCTGATAGAGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097020936_1097020940 0 Left 1097020936 12:56020596-56020618 CCTCTGAAAGGGAAGGGAGCAGA 0: 1
1: 0
2: 2
3: 21
4: 322
Right 1097020940 12:56020619-56020641 GGCCTTGTCCTGATAGAGGGCGG 0: 1
1: 0
2: 1
3: 7
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097020940 Original CRISPR GGCCTTGTCCTGATAGAGGG CGG Intronic
900982478 1:6054184-6054206 GGCCATGTGGTGATAGAGAGTGG + Intronic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
902792346 1:18777924-18777946 GGGCTTGTCTAGATAGAGGTAGG + Intergenic
903312877 1:22473818-22473840 GGCCTTGGCATTATAGAGGAAGG + Intronic
903383052 1:22909927-22909949 GGTGTGGGCCTGATAGAGGGAGG + Intronic
904944521 1:34189605-34189627 GGCCTTGGCCTGAGCCAGGGTGG + Intronic
912684900 1:111754826-111754848 GTTCTTGTCCTCATAGAGTGTGG + Intronic
913168174 1:116208700-116208722 GGCCTGTTCCTCATAGATGGTGG + Intergenic
916287289 1:163122320-163122342 GGCCTTAGTCTGATAGAGAGTGG + Intronic
921047773 1:211489806-211489828 GGCCTTCTCTTGAAACAGGGAGG - Intronic
921700220 1:218260833-218260855 GGCCTTGTACTGTGTGAGGGTGG - Intergenic
923521596 1:234739164-234739186 GGCCTTCTCCTGAAGTAGGGAGG - Intergenic
1063133611 10:3198454-3198476 GGCCTTTTCCTGGTTGAGAGAGG + Intergenic
1065954731 10:30683763-30683785 GGCCTCGTGCTGACACAGGGGGG - Intergenic
1067346636 10:45442902-45442924 GCCCTTGTCCTGTGAGATGGGGG - Intronic
1081591509 11:44426385-44426407 GGCCCTGCCCTGACCGAGGGTGG - Intergenic
1083197952 11:61102264-61102286 GGCCTTGTCCTGTGTGGGGGTGG + Intergenic
1088130473 11:106483137-106483159 GGCTTTGTCCTGCTACGGGGTGG - Intergenic
1089615162 11:119691026-119691048 GGCTGTGTCCTGAGAAAGGGTGG - Intronic
1096909081 12:54963815-54963837 GCCCTTGGCCTGAGAGGGGGTGG + Exonic
1097020940 12:56020619-56020641 GGCCTTGTCCTGATAGAGGGCGG + Intronic
1100007494 12:89911601-89911623 GGTCTTGTCATGATGGAAGGTGG + Intergenic
1100577283 12:95904902-95904924 GGCCTTGTCCAGAAAGAGTCTGG - Intronic
1103336964 12:120196926-120196948 GGCCTTGACCTGAAAGGAGGGGG + Exonic
1103859774 12:124003037-124003059 GGCCCTGTCCTGACAGAGGCAGG + Intronic
1106727365 13:32499736-32499758 GTCCTTGGTCAGATAGAGGGTGG - Intronic
1108519499 13:51233654-51233676 GGCCTTCTCCTGAAAGTAGGTGG - Intronic
1109116751 13:58398294-58398316 TGCCTGGTGCTGACAGAGGGTGG + Intergenic
1112240913 13:97680181-97680203 GGCTCTGTCATGATATAGGGGGG - Intergenic
1112585548 13:100715844-100715866 GGCCTGGTCCTGGGAGATGGGGG - Intergenic
1112726122 13:102306792-102306814 GGCCTTTTTCTGATAGATGGTGG - Intronic
1113709441 13:112454036-112454058 GGCCTTGTGCTGTGGGAGGGAGG + Intergenic
1113794826 13:113050863-113050885 GGAGTTGTCCAGATGGAGGGGGG + Intronic
1118283222 14:64448100-64448122 CTCCTTGTCCTGATAGTGAGTGG + Intronic
1119133065 14:72192493-72192515 GACCTTCTCCTGAGAGAGTGAGG - Intronic
1123116854 14:105898823-105898845 GGGCTTGGCCTGAGAGGGGGCGG + Intergenic
1125151743 15:36540412-36540434 GGCATTGTCTTCTTAGAGGGTGG + Intergenic
1128403575 15:67311985-67312007 GGCCTAGTCCTGTTAGCAGGTGG - Intronic
1129114488 15:73357685-73357707 GGCCATGACCTAATGGAGGGAGG + Intronic
1129869115 15:78929525-78929547 GGGGCTGTCCTGATAGAGGCGGG + Intronic
1133867613 16:9658782-9658804 GTCCTTCACCTGATTGAGGGAGG - Intergenic
1134262895 16:12667040-12667062 GGCCTGGTCCTGAACGGGGGTGG + Intronic
1137310578 16:47253135-47253157 TGACTTGTCCTGATTTAGGGTGG + Intronic
1138554514 16:57763835-57763857 GCCCTGGTCCTGAGAGAGGTCGG + Intronic
1142179654 16:88662221-88662243 GGCCTTGGCTAGAGAGAGGGTGG + Intronic
1142582727 17:952119-952141 GGCCTTGTCCTGGCAGGAGGTGG - Intronic
1143058975 17:4184301-4184323 AGCCTTGTCCTTCTGGAGGGAGG - Intronic
1143924455 17:10357539-10357561 GGCTTGGTCCTGGCAGAGGGAGG - Intronic
1144557979 17:16298601-16298623 GTCCCAGTCCTGATGGAGGGAGG + Intronic
1144704660 17:17359798-17359820 GCTCTTGTCTTGATAGAGAGTGG + Intergenic
1147123693 17:38351913-38351935 GGCCTCTGCCTCATAGAGGGGGG - Intergenic
1147966860 17:44198822-44198844 GGGCTGGTCCTGAGGGAGGGCGG - Intronic
1148805909 17:50263973-50263995 GGCTTTGTCCAGGGAGAGGGAGG - Intergenic
1150225471 17:63522641-63522663 GGCCTGGTCCTGAGAGGAGGGGG - Intergenic
1152119401 17:78408937-78408959 AGCCTGGTCCTGATCGGGGGTGG + Intronic
1152502772 17:80724265-80724287 GGCCATGTCCTGAGAGGTGGGGG + Intronic
1154416430 18:14178144-14178166 GGACTGCTCATGATAGAGGGGGG + Intergenic
1157898600 18:51491880-51491902 GGCCTTGTAGTTAGAGAGGGAGG - Intergenic
1160193759 18:76736492-76736514 GGCCTCTTCCTCATAGAGGGTGG - Intergenic
1161318764 19:3631537-3631559 GGGCTTGTCCTGATGGATGCTGG + Exonic
1161412606 19:4124572-4124594 GGCCTTGTTCTGATGAAGGAGGG - Intergenic
1161768407 19:6218958-6218980 TGCCTCCTCCTGATGGAGGGAGG - Intronic
1163755587 19:19104591-19104613 GGCCTTGTTCTGAGAGAGCCAGG + Intronic
1165059210 19:33196601-33196623 GGCCTTGCCCTGTAAGAGGAAGG + Intronic
1165729178 19:38133557-38133579 GGCCTTGGCCTCATGGAGTGAGG + Intronic
1166182162 19:41116648-41116670 GGCCTTTTCCATATTGAGGGAGG + Intronic
1167537510 19:50064231-50064253 GTTCTTGTCCTCAGAGAGGGGGG + Intergenic
1167586337 19:50377719-50377741 GGCCATTTCCTGGAAGAGGGTGG - Exonic
925146169 2:1584709-1584731 GGAATTGTCCTGAAAGTGGGGGG - Intergenic
926633229 2:15156510-15156532 GGCCTGTTCCTCATAGATGGTGG + Intergenic
927135426 2:20093177-20093199 CGTCTTGTCCTGGTAGAAGGTGG + Intergenic
927146078 2:20167596-20167618 GGCCTTGTACTGACAGGGGCTGG - Intergenic
930043198 2:47145236-47145258 GGCCTATTCATGATAAAGGGAGG + Intronic
931600102 2:63994499-63994521 CGCCTTTTCCTGATTGAGCGGGG - Intronic
940800108 2:158123735-158123757 GGCCTTGGCCTGAAAGGGAGGGG - Exonic
941675393 2:168338477-168338499 GGCTTTGTCATGAGAGAGTGAGG - Intergenic
942315987 2:174696971-174696993 GGCCTTGTGGTGTTCGAGGGAGG - Intergenic
943428177 2:187762464-187762486 GGCTTAGTCCTCTTAGAGGGTGG + Intergenic
946077895 2:217090857-217090879 TGACTTGGCCTGAGAGAGGGTGG - Intergenic
947971537 2:234329078-234329100 GGCATTGTCCTGTTAAGGGGTGG + Intergenic
948771353 2:240252770-240252792 GGCTTAATCCTGACAGAGGGAGG + Intergenic
1168972712 20:1941719-1941741 GGCCTGGTCCTCATGGAGGAAGG - Intergenic
1175131598 20:56793743-56793765 GCCCTTGTCCTTAAAGAGGAGGG - Intergenic
1179613423 21:42566636-42566658 GACCTGGTCCGGAGAGAGGGTGG + Intronic
1180145719 21:45917502-45917524 GTCCTTGTCATGCTGGAGGGTGG + Intronic
1181002129 22:19992785-19992807 AGCCTGGTCCTGCTAGATGGGGG - Intronic
1182190897 22:28459542-28459564 GGCTTTGACCTGAAGGAGGGGGG - Intronic
1183408285 22:37640880-37640902 GGCTGTGTCCTGAGAGAGGGCGG - Intronic
1184449963 22:44576953-44576975 AGCCTGGTCCTCATAGAGGTGGG + Intergenic
1184598461 22:45528262-45528284 GGCCTTCTGCTGATTGAGTGAGG + Intronic
1184892753 22:47389718-47389740 GGCCTTGTCCTGGGTGGGGGAGG - Intergenic
952510394 3:34047784-34047806 GGCCTGTTCCTGATAAATGGTGG - Intergenic
952942746 3:38455833-38455855 GGCATTGGTCTGCTAGAGGGAGG + Intronic
954438587 3:50509185-50509207 GGCTTTGTCCTTAGAGAAGGAGG + Intergenic
954966090 3:54612287-54612309 GGCCTTCTCCTGATTGACTGAGG + Intronic
966911922 3:184564609-184564631 GCCCTTATCCTGCTGGAGGGAGG + Intronic
967980414 3:195061999-195062021 GGGCTTTTCCTGAGAGAAGGTGG + Intergenic
969707605 4:8820370-8820392 GGCGTTGTCCTGAGAGAGGCAGG - Intergenic
982500961 4:156153987-156154009 GGCCTAACACTGATAGAGGGTGG + Intergenic
985678951 5:1246119-1246141 GGGCTTGGCCTGATGGTGGGCGG + Exonic
985939566 5:3124331-3124353 GGCCTGGTTCTCAAAGAGGGTGG + Intergenic
986671456 5:10146579-10146601 GGCCTTGTCCTGAGCCAGGAGGG + Intergenic
994380628 5:99066766-99066788 GGCCTTAACCTGATAGAGGGAGG - Intergenic
998682103 5:144479864-144479886 GGGCTTGTCCTGGAGGAGGGTGG + Exonic
1001032186 5:168271105-168271127 GGTCTTCTGTTGATAGAGGGAGG - Intergenic
1011821563 6:91258740-91258762 GGGCTTGTCATCATAGATGGAGG - Intergenic
1012333989 6:98030851-98030873 TTCATTGTCCTGATGGAGGGAGG + Intergenic
1014295457 6:119611886-119611908 GGCCTTGGAATGATGGAGGGAGG + Intergenic
1017818726 6:158033556-158033578 GGCCTTGGCCTGCTTGTGGGAGG - Exonic
1017959704 6:159210938-159210960 GGCCTGGTCCTGATGGAGGTGGG + Intronic
1018215067 6:161518612-161518634 GGGCTTGTGCTGCTAGGGGGAGG - Intronic
1018640660 6:165901153-165901175 GGCCAGGTCCTGATAGATGAGGG - Intronic
1019331560 7:463063-463085 GGCCTGGCCCTGATACAGCGGGG + Intergenic
1023727689 7:43161392-43161414 GGCCTTGTCCTGAGAGCAGAGGG + Intronic
1023908625 7:44538957-44538979 GGTATTGTCCGGATTGAGGGGGG + Exonic
1029196135 7:98806785-98806807 GGCCTTCTCCAGGAAGAGGGGGG - Intergenic
1033982287 7:147180073-147180095 GGAGTAGTCCTGAAAGAGGGAGG + Intronic
1037470217 8:19201349-19201371 TGCCTTGTCCTAATAAAGGAAGG - Intergenic
1039278430 8:35956550-35956572 GACTTTCTCCAGATAGAGGGAGG + Intergenic
1039567408 8:38561135-38561157 GGCCTTCTCCTGGTGGATGGTGG + Intergenic
1039567426 8:38561209-38561231 GGCCTTCTACTGATGGATGGTGG + Intergenic
1042009215 8:64221138-64221160 GGCCTAGTCCTGAAATAGTGAGG - Intergenic
1047290443 8:123524934-123524956 GGCCTTCCTCTGATGGAGGGTGG - Intronic
1049067977 8:140334201-140334223 GGCTTCTTCCTTATAGAGGGTGG - Intronic
1049315478 8:141964708-141964730 GGCATTGTCCTGAAAGTGGTGGG + Intergenic
1054987084 9:71274267-71274289 GTACTTGTCCTGACATAGGGAGG - Intronic
1056467317 9:86870386-86870408 GGCCTTTTCCTGCTAGATGCTGG + Intergenic
1057547982 9:96032198-96032220 GGCCTTTCCCTGATGAAGGGAGG - Intergenic
1061834241 9:133318302-133318324 GGCCTGAGCCTGATAGAGAGGGG + Intergenic
1061887289 9:133598194-133598216 GGGCTTGTCTTGTTAGAGGCAGG + Intergenic
1062191208 9:135248792-135248814 GGCCTTGTCCTGAGCGAGCAAGG - Intergenic
1062238048 9:135522014-135522036 GGCCTGAGCCTGATAGAGAGGGG + Intronic
1062347209 9:136120472-136120494 GCCCGTGGCCAGATAGAGGGTGG + Intergenic
1062570030 9:137180716-137180738 GGCCCTGTCCCGAGAGAGGCTGG + Intronic
1195876025 X:109541482-109541504 GGCCTTGTCCAGATACAGCCTGG - Exonic
1198959922 X:142173386-142173408 GGCCTTTCCCTGATAGAAGTGGG - Intergenic
1198963102 X:142203386-142203408 GGCCTTGCCCTGATAGAAGTGGG - Exonic
1200396047 X:155988614-155988636 GGCCCTCTCCTGAGAGAGAGAGG + Intergenic