ID: 1097023236

View in Genome Browser
Species Human (GRCh38)
Location 12:56035242-56035264
Sequence CCTTTTGAGTGCAACATCTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097023233_1097023236 -7 Left 1097023233 12:56035226-56035248 CCATGGCTTCAGAGACCCTTTTG 0: 1
1: 0
2: 3
3: 25
4: 303
Right 1097023236 12:56035242-56035264 CCTTTTGAGTGCAACATCTGTGG 0: 1
1: 1
2: 1
3: 28
4: 155
1097023228_1097023236 23 Left 1097023228 12:56035196-56035218 CCACGTCATGTTCACTATCCACA 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1097023236 12:56035242-56035264 CCTTTTGAGTGCAACATCTGTGG 0: 1
1: 1
2: 1
3: 28
4: 155
1097023232_1097023236 5 Left 1097023232 12:56035214-56035236 CCACATGGGCTGCCATGGCTTCA 0: 1
1: 0
2: 3
3: 12
4: 155
Right 1097023236 12:56035242-56035264 CCTTTTGAGTGCAACATCTGTGG 0: 1
1: 1
2: 1
3: 28
4: 155
1097023227_1097023236 29 Left 1097023227 12:56035190-56035212 CCTGGACCACGTCATGTTCACTA 0: 1
1: 0
2: 0
3: 9
4: 66
Right 1097023236 12:56035242-56035264 CCTTTTGAGTGCAACATCTGTGG 0: 1
1: 1
2: 1
3: 28
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097023236 Original CRISPR CCTTTTGAGTGCAACATCTG TGG Exonic
900763989 1:4491673-4491695 GCTTTTGACTGGAGCATCTGGGG - Intergenic
905759904 1:40546879-40546901 CCTTTTGAATGCAATGACTGTGG + Exonic
906902007 1:49845407-49845429 CCCTATGAGTGCAACAAGTGTGG + Intronic
907071232 1:51536814-51536836 CCTTCTCAGTGCATCATATGGGG + Intergenic
909312885 1:74175602-74175624 CCAGTAGAGTGCAAAATCTGGGG - Intronic
909989959 1:82211435-82211457 CATTTTGATTGTCACATCTGTGG + Intergenic
910283337 1:85526050-85526072 CCTTCTGACTTCAAAATCTGTGG - Intronic
910864887 1:91779455-91779477 TCTTAGGAGTGCAAGATCTGGGG - Intronic
911172293 1:94782605-94782627 CCATCTGAGTGCAGCATCTAGGG - Intergenic
912200095 1:107447287-107447309 CTTTTTGCATTCAACATCTGTGG - Intronic
914206678 1:145536935-145536957 CCTTCTGACTTCAAAATCTGTGG + Intergenic
916172044 1:162008935-162008957 CCTGCTGAGAGCAACACCTGTGG + Intronic
921125540 1:212174479-212174501 CCTTATGAGTGCAATAAATGTGG + Intergenic
922492588 1:226030085-226030107 CCTTCTGAATCCACCATCTGAGG + Intergenic
924375652 1:243405264-243405286 ACTTTTCTGTGCAGCATCTGTGG + Intronic
1063096447 10:2913096-2913118 CCTTTTGGGTTGAACTTCTGGGG - Intergenic
1063352558 10:5368801-5368823 CCTATTGAATGCAACATTTAAGG + Intronic
1067139459 10:43644540-43644562 CCTTTTGAGTGCACCCACTGTGG - Exonic
1071280000 10:84092821-84092843 CCTTGAAAGTGCCACATCTGAGG + Intergenic
1075502865 10:122993847-122993869 CCTTTTCAGTGTAATATATGTGG - Exonic
1079328324 11:19513228-19513250 CCCTTTGAATGCAAAAACTGTGG - Intronic
1081909956 11:46694379-46694401 TCTTTGGACTGCAACCTCTGGGG - Intronic
1085554544 11:77408181-77408203 GCATTTGAGAGCAACAACTGAGG + Intronic
1087243024 11:95801771-95801793 CTGCTTGAGTGCAACATCAGTGG + Intronic
1088554170 11:111044883-111044905 CCTTTTCATTGTATCATCTGTGG + Intergenic
1089913733 11:122130519-122130541 CCTTTTCAGTGCATCTTCTCAGG - Intergenic
1096108389 12:49012827-49012849 CCACTTGAGAGAAACATCTGAGG - Intronic
1097023236 12:56035242-56035264 CCTTTTGAGTGCAACATCTGTGG + Exonic
1098001596 12:65949671-65949693 TCTTTTGAGTGAAACATCCGAGG - Intronic
1102542382 12:113631236-113631258 CCTCTTGAGTTTAACATCTTGGG + Intergenic
1102738796 12:115187632-115187654 CCTCCTGAGTGCAAGATGTGGGG + Intergenic
1102888030 12:116536266-116536288 CCATTCTAGGGCAACATCTGTGG + Intergenic
1105569434 13:21587434-21587456 CCTTTTCAGTGCATCATATTAGG - Intronic
1106785251 13:33101045-33101067 GCACTTTAGTGCAACATCTGGGG - Intergenic
1107173323 13:37369827-37369849 CCTTCTGAGTGCATCATGTCAGG + Intergenic
1108438294 13:50422881-50422903 CCTTATGAGTGCAAATTGTGTGG + Intronic
1108504070 13:51094305-51094327 CCTTTTCAGTGCAATAAATGAGG + Intergenic
1109220030 13:59632090-59632112 CATTTTGGGTGCAACTTCTAAGG - Intergenic
1110670429 13:78170563-78170585 ACTTTTCAGTGCCACACCTGAGG + Intergenic
1112469129 13:99671975-99671997 CCTTTTGGGTGTCACCTCTGAGG + Intronic
1113168925 13:107476142-107476164 CCTTTTGAGGACAGCATCTTTGG + Intronic
1114364812 14:22014496-22014518 CCTTTTGTATGCAACATTTGTGG + Intergenic
1117896625 14:60494325-60494347 CCTTTTGTGTGCAACATATATGG - Intronic
1120128537 14:80777099-80777121 CCTTTTGAGTGACAAAACTGAGG - Intronic
1126251516 15:46573113-46573135 CCTTTGCAGAGCAACACCTGAGG + Intergenic
1129888813 15:79057494-79057516 CCTCCTCAGTGCAAAATCTGTGG + Intronic
1130220549 15:82015939-82015961 CCTTTTCTGTGCATCCTCTGAGG - Intergenic
1130376516 15:83334123-83334145 ACTACTGAGTGGAACATCTGAGG + Intergenic
1131196678 15:90360951-90360973 CCTTTTAAGTGCGAAAACTGTGG + Exonic
1131780052 15:95846241-95846263 CCTTTTGAGAGAAACAACTGTGG + Intergenic
1133077336 16:3289887-3289909 CCCTATCAGTGCAACATTTGCGG + Exonic
1134861447 16:17564041-17564063 CATTTTGAGTGAAACACATGAGG - Intergenic
1135168091 16:20158091-20158113 CCTTTTGCATGCAACATTTGTGG + Intergenic
1137740335 16:50764741-50764763 ATTTTTGATTGCCACATCTGAGG + Intronic
1137786231 16:51140003-51140025 CCCTTTAAGTGTAAGATCTGTGG - Exonic
1137786379 16:51140774-51140796 CCATTCAAGTGCAACATCTGCGG - Exonic
1139681104 16:68563964-68563986 CCTTTTGAATGTAGCATATGTGG + Exonic
1140024577 16:71273935-71273957 CCTTTTCAGTGCATCATGTCAGG - Intergenic
1140794553 16:78424947-78424969 CCTTTCAAGTGAATCATCTGGGG + Exonic
1145852847 17:28119827-28119849 CCTTCTCAGTGCATCATCTCAGG - Intronic
1146055523 17:29578886-29578908 CATTTGGTGTGCAGCATCTGGGG - Intronic
1146258579 17:31406130-31406152 CCTCTGGAGGGCATCATCTGGGG - Intronic
1147342934 17:39765863-39765885 CCTTTCGAGTGTAACATGTGTGG - Exonic
1147904954 17:43816616-43816638 CCTTTTCCGTGGAACGTCTGGGG - Intronic
1153272847 18:3340575-3340597 CCTTGTTTGTGAAACATCTGGGG + Intergenic
1155573644 18:27222141-27222163 TCTTTTAAGTGGAACATTTGGGG + Intergenic
1156291289 18:35750625-35750647 ACATTTGAGTGCAACAGGTGTGG + Intergenic
1156760230 18:40580361-40580383 ACTTGTGAGTGAAACATTTGAGG + Intergenic
1159330592 18:66989985-66990007 ACTTTTGAGATCAACATTTGAGG + Intergenic
1159967408 18:74608813-74608835 CCTTCTCAGTGCATCATATGAGG + Intronic
1160454920 18:78993330-78993352 CCCTTCAAGTGCAACATCTGCGG + Exonic
1160455097 18:78994107-78994129 CCGTTCAAGTGCAAGATCTGCGG + Exonic
1162239884 19:9342421-9342443 CCGTATGAGTGCAACAAATGTGG + Exonic
1162777194 19:12986944-12986966 CTTTTTGTGTGCTACATCTGTGG + Intergenic
1165543611 19:36514226-36514248 CCTTATGAGTGTAAGGTCTGTGG - Exonic
1165673333 19:37698515-37698537 CCCTTTGAATGCAACAAATGCGG - Exonic
1165911137 19:39228683-39228705 CATTTTGAGCGTAAGATCTGAGG - Intergenic
1167779344 19:51587751-51587773 CCTTATCAGTGCCACAACTGTGG + Exonic
1167819669 19:51915736-51915758 CCTTATGAGTGCAATAAATGTGG - Intronic
1168344793 19:55644911-55644933 CCCTTCGAGTGTGACATCTGTGG + Exonic
1168468361 19:56621756-56621778 CCGTTTGAGTGTGACACCTGTGG + Exonic
1168550803 19:57291712-57291734 CCTTTTGAGTGCAAAGAATGTGG + Exonic
1168557690 19:57356953-57356975 CCTTATAAGTGCAACAAATGTGG + Exonic
1168563028 19:57399125-57399147 CCTTATGAGTGCAACACATGTGG + Exonic
1168565719 19:57420813-57420835 CCTTATGAATGCAACAAATGTGG + Exonic
1168565729 19:57420981-57421003 CCTTTTGAATGCAGCATTTGTGG + Exonic
1168568528 19:57444289-57444311 CCTTTTGAATGCAGCATATGTGG + Exonic
1168568606 19:57445147-57445169 CCTTATGAATGCAGCAACTGTGG + Exonic
1168579015 19:57537824-57537846 CCTTATGTGTGCAATATATGTGG + Exonic
1168579069 19:57538334-57538356 CCTTATGTGTGCATCATATGTGG + Exonic
1168585860 19:57591195-57591217 CCTTATGAGTGCAACAAATGTGG + Exonic
1168601280 19:57720632-57720654 CCTTATGAGTGCAGCAAGTGCGG - Exonic
1168673831 19:58262161-58262183 CCCTATGAGTGCAACCTGTGTGG + Exonic
926954760 2:18282295-18282317 CCTTCTGAGTGGAGCACCTGAGG + Intronic
931344528 2:61433825-61433847 CCTCTGGAGTGCACCCTCTGGGG + Intronic
933944913 2:87277916-87277938 CATTTAGAGTGAAACATATGGGG - Intergenic
935388972 2:102530602-102530624 CCTGTTGAGTGCTCCATCAGTGG - Intronic
936335295 2:111583674-111583696 CATTTAGAGTGAAACATATGGGG + Intergenic
938572293 2:132571674-132571696 CCTACTGGGTGCACCATCTGGGG + Intronic
941413859 2:165194368-165194390 CCTTCTGAGAGAAACTTCTGAGG + Intronic
942252950 2:174063321-174063343 CCTCTTGAGAGCAAGAACTGAGG + Intergenic
943757182 2:191569012-191569034 CCTTTAAAGTGGACCATCTGTGG + Intergenic
945688817 2:213007427-213007449 CCACTGGAATGCAACATCTGTGG - Exonic
946173959 2:217911457-217911479 CCTCTAGGGTGCAAGATCTGAGG - Intronic
1171510174 20:25675891-25675913 CCTTTTGTGTGCAAGGACTGTGG - Exonic
1173810153 20:45950459-45950481 CCTTTTGCATGCCACCTCTGCGG - Exonic
1174609689 20:51788892-51788914 CCTTTTGTGTGCAACATTTGTGG - Exonic
1181543443 22:23587142-23587164 CCTTTTCTGTGCAGTATCTGGGG + Intergenic
1185226314 22:49655464-49655486 GCTTGTGAGTGCAACACCTGGGG + Intronic
952718355 3:36506037-36506059 CCTTAGGAATGCAACTTCTGAGG - Intronic
956210076 3:66793417-66793439 CATTTTCAGTGCAACTTCAGGGG - Intergenic
957944147 3:87040765-87040787 TCTTTTGAGTGGAACAGCTTTGG - Intergenic
958662552 3:97089512-97089534 CATTTTGAGGGCAACATCAAGGG - Intronic
960702050 3:120449008-120449030 CCTTTTGAGGGCCACAGCAGGGG + Intronic
961057113 3:123798566-123798588 CCTTTTGATGAGAACATCTGGGG - Intronic
961945856 3:130686971-130686993 CCTTCTCAGTGCATCATGTGAGG + Intronic
961972789 3:130988332-130988354 CCTTTTCAGTGTCACATTTGTGG - Intronic
963255592 3:143141641-143141663 CCTTCTTTGTGCAACATATGAGG + Intergenic
967747056 3:193068306-193068328 CCTTCTGAGTGCAACAGTTTAGG + Intergenic
969041988 4:4306146-4306168 CCTTTTGAATGTAACATTTGTGG + Exonic
971735814 4:30450321-30450343 CCTTTAGAGTGAAATATCAGGGG + Intergenic
972718995 4:41676928-41676950 CGATGTGAGTGCATCATCTGAGG + Intronic
974162850 4:58162433-58162455 TCTTTTTAGTGCTACATCTAAGG + Intergenic
978492720 4:109326020-109326042 CTTTTTGAAAGAAACATCTGAGG + Intergenic
978778107 4:112522520-112522542 CCTTTTGAATGTAAGCTCTGTGG - Intergenic
981079130 4:140621617-140621639 CCTTTGAAGGGGAACATCTGTGG + Exonic
981949739 4:150391809-150391831 CCTCTTGAGTGCCACTTCTTTGG + Intronic
984481894 4:180315015-180315037 TCTTTTGAGAGCAGCATCTCGGG + Intergenic
984978422 4:185253351-185253373 TTTTTTGTGTGCAACGTCTGGGG - Intronic
986481524 5:8193558-8193580 CATTTTTAGTGCCACATATGAGG - Intergenic
988339513 5:29951784-29951806 CCATTTGAATGCAACATCATGGG + Intergenic
989997598 5:50854309-50854331 CCTTTTGTCTGCAACTCCTGAGG - Intergenic
990770494 5:59238679-59238701 CCTTTTGAGTACCACATCAAAGG + Intronic
991136549 5:63188805-63188827 CATTTTGAATGAAATATCTGAGG + Intergenic
991730796 5:69585676-69585698 CCTGTTGAATGTAAAATCTGTGG + Exonic
991807232 5:70440838-70440860 CCTGTTGAATGTAAAATCTGTGG + Intergenic
991864154 5:71042180-71042202 CCTGTTGAGTGTAAAATCTGTGG - Exonic
992461558 5:76965492-76965514 CCTTTTGGGTGCATGATCTGAGG + Intronic
993432563 5:87849751-87849773 CCTTTTGGATACAACATGTGTGG + Intergenic
999229803 5:150055071-150055093 CCTTTTGAGTTCAAGCTATGGGG - Intronic
1002351786 5:178589033-178589055 CCTTTTGTGTGCGGCATGTGCGG - Intronic
1002396974 5:178965215-178965237 CCTTTTGAATGCAACTTATGTGG + Exonic
1002669075 5:180850635-180850657 CCCTATGAATGCGACATCTGTGG - Exonic
1005529719 6:26690699-26690721 CCTTGTGGCTGCAACATCTGTGG - Intergenic
1005533106 6:26728368-26728390 CCTTTTGGGTACAAAATATGAGG + Intergenic
1005537688 6:26773296-26773318 CCTTTTGGGTACAAAATATGAGG - Intergenic
1005541077 6:26810948-26810970 CCTTGTGGCTGCAACATCTGTGG + Intergenic
1005598332 6:27400776-27400798 CCTTTTGAATGCAACAAATGTGG + Exonic
1005680871 6:28207196-28207218 CAATTTGAGAGAAACATCTGTGG + Intergenic
1005697949 6:28368745-28368767 CCTTATGAGTGTGACAACTGTGG + Exonic
1005764299 6:28995740-28995762 CCTTATGAGTGCAGCAAGTGTGG - Exonic
1009011890 6:57853036-57853058 CATTGTGGCTGCAACATCTGTGG + Intergenic
1010775125 6:79876781-79876803 CCTTTTGAGAGTAAGCTCTGAGG + Intergenic
1012983010 6:105849825-105849847 CCTTTTGCATTCAACATGTGAGG + Intergenic
1016337046 6:143018260-143018282 CCTTTTGAGTGCAGCATATCGGG + Intergenic
1017224013 6:151998935-151998957 CCCTTTTTGTACAACATCTGTGG - Intronic
1024531917 7:50400532-50400554 CCTTTTGAGTGCAACATGTGCGG + Exonic
1028804345 7:95007424-95007446 CCTCTGGAGGGCAAAATCTGCGG + Intronic
1028993963 7:97078960-97078982 CCTTTTGAGCGAATTATCTGAGG - Intergenic
1029210054 7:98900256-98900278 TCATTTGAGGGCAGCATCTGAGG + Intronic
1029288928 7:99486892-99486914 CCTTTTGAGTGTAAGGTCTGTGG + Exonic
1031699622 7:124907043-124907065 CCAATTGAGTTAAACATCTGTGG - Intronic
1031752592 7:125595863-125595885 CCTATTGAGGGCAAGATGTGAGG - Intergenic
1039290015 8:36084434-36084456 TCTTTTGGGTGCTACAGCTGAGG + Intergenic
1039337446 8:36607558-36607580 CATTTTGCCTGCAACATCTCAGG + Intergenic
1039846914 8:41331992-41332014 GCTCCTGAGGGCAACATCTGGGG - Intergenic
1040604652 8:48919949-48919971 CCTTGTGTTTGCAAGATCTGCGG - Exonic
1041709828 8:60884313-60884335 CCTTTTGACTGAAATATCTGGGG + Intergenic
1044274222 8:90281540-90281562 CCTCTTGAGAGCAAGATCTGAGG + Intergenic
1045453938 8:102357140-102357162 CCTTTTCAGTGCATCATATCAGG - Intronic
1046590321 8:116198467-116198489 CCTTTTGGGTCCCCCATCTGGGG - Intergenic
1049858615 8:144881660-144881682 CCATATGAGTGCAATAGCTGCGG - Exonic
1051281697 9:15447860-15447882 CCTTTTGAGAGCAACACATTGGG - Intronic
1060093344 9:120764490-120764512 GGTTTTGGGTGCAACCTCTGCGG - Exonic
1060357045 9:122918940-122918962 CCTTTCCAGTGTAAAATCTGTGG - Exonic
1060851518 9:126880606-126880628 CCCTTTGTGTGCAAGTTCTGTGG + Exonic
1061387769 9:130300617-130300639 CATTCTGAGTGCAGCCTCTGAGG - Intronic
1062284379 9:135766522-135766544 CCTCTTGGGTGGACCATCTGGGG + Intronic
1203444259 Un_GL000219v1:40462-40484 CCTTTTGGCTGCTACTTCTGTGG - Intergenic
1186888038 X:13934418-13934440 CTTTCTGAGTGCAGCCTCTGAGG + Intronic
1189238190 X:39505124-39505146 CCTTTTGATTGCAACCTCTCAGG + Intergenic
1189560373 X:42185816-42185838 TCTTTTGGGTGCAAAAGCTGAGG + Intergenic
1190362970 X:49666571-49666593 CCTTTTAAGTGTAAGATCTGTGG - Intergenic
1197246604 X:124173137-124173159 CCTTATGAGTGCAACCAATGTGG - Intronic
1199449177 X:147960226-147960248 CCTTCTCAGTGCATCATATGAGG - Intergenic
1201514192 Y:14799584-14799606 CCTCTTCAGTGCAAAGTCTGGGG - Intronic