ID: 1097026883

View in Genome Browser
Species Human (GRCh38)
Location 12:56063305-56063327
Sequence TCTTCTTTTTCACCTGGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097026883_1097026887 29 Left 1097026883 12:56063305-56063327 CCTGTTCCAGGTGAAAAAGAAGA No data
Right 1097026887 12:56063357-56063379 CTATAGAATTTCCTGCATTCTGG No data
1097026883_1097026885 -3 Left 1097026883 12:56063305-56063327 CCTGTTCCAGGTGAAAAAGAAGA No data
Right 1097026885 12:56063325-56063347 AGAAAAAAAGAAAAAAAAAATGG 0: 24
1: 523
2: 25284
3: 36054
4: 74387

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097026883 Original CRISPR TCTTCTTTTTCACCTGGAAC AGG (reversed) Intergenic
No off target data available for this crispr