ID: 1097027044

View in Genome Browser
Species Human (GRCh38)
Location 12:56064440-56064462
Sequence CTGAGGAAACAGGCGGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097027037_1097027044 21 Left 1097027037 12:56064396-56064418 CCGACATCACGCCAAAAAAAAAA No data
Right 1097027044 12:56064440-56064462 CTGAGGAAACAGGCGGATGGTGG No data
1097027039_1097027044 10 Left 1097027039 12:56064407-56064429 CCAAAAAAAAAAAAAAATGGCAC No data
Right 1097027044 12:56064440-56064462 CTGAGGAAACAGGCGGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097027044 Original CRISPR CTGAGGAAACAGGCGGATGG TGG Intergenic
No off target data available for this crispr