ID: 1097030966

View in Genome Browser
Species Human (GRCh38)
Location 12:56088986-56089008
Sequence TCTTTCAGGTCCTTTGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097030966_1097030968 2 Left 1097030966 12:56088986-56089008 CCTGTTACAAAGGACCTGAAAGA 0: 1
1: 0
2: 1
3: 18
4: 178
Right 1097030968 12:56089011-56089033 GCTTAACACATCCTCCATCCAGG 0: 1
1: 0
2: 2
3: 9
4: 169
1097030966_1097030972 19 Left 1097030966 12:56088986-56089008 CCTGTTACAAAGGACCTGAAAGA 0: 1
1: 0
2: 1
3: 18
4: 178
Right 1097030972 12:56089028-56089050 TCCAGGCCTTCGGTCCCCTCAGG 0: 1
1: 0
2: 2
3: 16
4: 144
1097030966_1097030969 9 Left 1097030966 12:56088986-56089008 CCTGTTACAAAGGACCTGAAAGA 0: 1
1: 0
2: 1
3: 18
4: 178
Right 1097030969 12:56089018-56089040 ACATCCTCCATCCAGGCCTTCGG 0: 1
1: 0
2: 0
3: 15
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097030966 Original CRISPR TCTTTCAGGTCCTTTGTAAC AGG (reversed) Intronic
902881870 1:19376930-19376952 TCTGTCAGCTCGTTTGTAAGAGG + Intronic
903310741 1:22453101-22453123 TCTTTCAAGTCTTTTCTACCTGG + Intronic
905550243 1:38831807-38831829 TCTTTCTGGCATTTTGTAACTGG + Intergenic
905851644 1:41279337-41279359 TCTATCAGGGCCTCTGGAACAGG + Intergenic
908383139 1:63615432-63615454 TCTTTCATGTCCTTTACAGCCGG + Intronic
911872217 1:103112425-103112447 TATTTTAGGTCCTTTTAAACAGG - Intergenic
911966187 1:104374962-104374984 TCTTTCATGTCCGTTGTAATTGG - Intergenic
913472023 1:119197586-119197608 TCTTTCAGGGTCTGTGAAACAGG + Intergenic
917204228 1:172553474-172553496 ACTTTGAGGTACTCTGTAACTGG + Intronic
917399850 1:174635344-174635366 TCTTTCAGGTAGTTTATAAGTGG + Intronic
918531566 1:185527913-185527935 CCTTTCATGTGCTCTGTAACAGG + Intergenic
918578061 1:186088151-186088173 TCTTTCAGGTCCTTCAATACTGG - Exonic
921153437 1:212419474-212419496 TCTTTCATCACCTGTGTAACTGG + Intergenic
922009724 1:221570701-221570723 TCTTTAAAATCCTTTGTGACTGG - Intergenic
922682318 1:227610817-227610839 TCTATCATGTCATATGTAACAGG - Intronic
923305553 1:232685114-232685136 TCTTTCATGTCCTAAGTAGCTGG + Intergenic
1063028275 10:2204780-2204802 TCTTTCAGCCCTTTTGTTACAGG - Intergenic
1064518249 10:16173276-16173298 TCCTTCACATCCCTTGTAACTGG + Intergenic
1065001484 10:21341574-21341596 CCTATGAGGTCCTTTCTAACTGG + Intergenic
1066698694 10:38102925-38102947 TATTTCAGATCCTTTGTACATGG + Intronic
1066806737 10:39263697-39263719 TCCTTCATGTCCCTTGTAATTGG - Intergenic
1066993965 10:42545290-42545312 TATTTCAGATCCTTTGTACATGG - Intergenic
1067107799 10:43377253-43377275 TCTTCCAGGGCCTTTGAAACAGG + Intergenic
1069763108 10:70829386-70829408 TCTTCCAGCTCCTTTGTGACTGG + Intronic
1074564773 10:114567437-114567459 TATATCAGGTACTGTGTAACTGG - Intronic
1074568481 10:114602872-114602894 TCTCTCTGGGCCTTTGTAAAGGG - Intronic
1075433637 10:122413922-122413944 TTTTTCAGGTCTTTTGCTACGGG + Intronic
1077704146 11:4468095-4468117 TCTCTCAGGGCCTTTATAAGGGG - Intergenic
1078961470 11:16277528-16277550 TCTATCTGCTTCTTTGTAACAGG - Intronic
1080131691 11:28802912-28802934 GCTTTCTGATCCTATGTAACAGG + Intergenic
1080428668 11:32178826-32178848 TCTGCCAGCTCCTTGGTAACAGG + Intergenic
1081211394 11:40339008-40339030 ACCCTCTGGTCCTTTGTAACTGG - Intronic
1086461773 11:87012979-87013001 TCTTTGAGGTCCTAGGTTACTGG - Intergenic
1087055824 11:93935067-93935089 TCTTTTAGGGCCTTTGTATTTGG + Intergenic
1089217623 11:116844552-116844574 TCTTTCAGCCTCTTTGTCACAGG - Intronic
1089908987 11:122076459-122076481 TCTATCAGGTACTCTCTAACAGG + Intergenic
1090247958 11:125230099-125230121 CTTTCCAGGTCCTTTGCAACTGG + Intronic
1090517799 11:127447303-127447325 TCTTTGAGGGCCTTTGTCATTGG + Intergenic
1093096632 12:14979391-14979413 TCTTTTAGGGCTTTTGTATCTGG - Intronic
1093775102 12:23064499-23064521 TCTTTCACGTTCTTTGTCATGGG + Intergenic
1096419664 12:51446214-51446236 TATCTCAGGTCATTTTTAACAGG - Intronic
1097030966 12:56088986-56089008 TCTTTCAGGTCCTTTGTAACAGG - Intronic
1097691309 12:62737010-62737032 TCTTACAGGCCCTTTGGAAAAGG - Intronic
1098061311 12:66565833-66565855 TCCTTCATGTCCCTTGTAAGTGG + Intronic
1104183057 12:126400957-126400979 TATTTCAGGTTCTTTCCAACTGG - Intergenic
1104213136 12:126709906-126709928 TCATTCAGGTCCTTTAAAATTGG - Intergenic
1109177316 13:59172354-59172376 TCTTTCTTGTCCTTTTTAAAGGG - Intergenic
1109241871 13:59899404-59899426 TCTTTCTGGTCTTTTTTCACAGG - Intronic
1109635932 13:65116293-65116315 ACTTACAAGTCCTTTGTATCCGG + Intergenic
1110176689 13:72565186-72565208 TCTTTGAGATGCTTTGTAAGTGG + Intergenic
1112298674 13:98210984-98211006 TGTTACAGGTGATTTGTAACTGG + Intronic
1113749022 13:112765767-112765789 TCTTTCAGATCCACTGTAGCAGG - Intronic
1116443795 14:44985310-44985332 GCTTTCAGATCCTTTTTAAGCGG + Intronic
1117085261 14:52194352-52194374 TCTTCCAGTTCCTTTGTAGTTGG - Intergenic
1117130696 14:52683907-52683929 TATTTCATTTTCTTTGTAACAGG - Exonic
1117991904 14:61442010-61442032 TCTATAATTTCCTTTGTAACAGG + Intronic
1119705814 14:76781972-76781994 TCTTTCAGCTCCTTTGCCCCTGG + Exonic
1119923970 14:78473890-78473912 TCTTTTGGGTCCCTTGTAATAGG - Intronic
1119985820 14:79136249-79136271 TCGTTCATGTTCTTTGAAACAGG + Intronic
1121869823 14:97396859-97396881 TCTATCAGGTCCTGTGTATGAGG - Intergenic
1122332820 14:100936345-100936367 TCTCTGAGGTCCATTGTAAAAGG + Intergenic
1122684277 14:103492774-103492796 TATTTCTGGGCTTTTGTAACAGG - Intronic
1123456773 15:20433429-20433451 TCTCCCAGGTACTCTGTAACAGG + Intergenic
1123569555 15:21590072-21590094 TCCTTCATGTCCCTTGTAAGTGG + Intergenic
1123661289 15:22566927-22566949 TCTCCCAGGTACTCTGTAACAGG - Intergenic
1124240767 15:28025890-28025912 TCTTTCTGATCCTTTGAAAATGG + Intronic
1124262921 15:28208583-28208605 TCTCCCAGGTACTCTGTAACAGG + Intronic
1124315089 15:28661163-28661185 TCTCCCAGGTACTCTGTAACAGG - Intergenic
1130077509 15:80702066-80702088 TCTGTCAGATCCTTTGCAACTGG - Intronic
1131884284 15:96894183-96894205 TCTTTTAGGTCTTGTGTAACAGG + Intergenic
1202977907 15_KI270727v1_random:317163-317185 TCCTTCATGTCCCTTGTAAGTGG + Intergenic
1134809297 16:17153724-17153746 TCTTTTGGGTCCTTTATAAGTGG - Intronic
1135792587 16:25410901-25410923 TGTCTCAGGTCCTTTGCATCTGG + Intergenic
1138082062 16:54099980-54100002 TCTTTGTGGTCCTTTGTGGCAGG + Intronic
1138803354 16:60062213-60062235 TCTTTTTGTTCCTTTTTAACTGG + Intergenic
1140703970 16:77608890-77608912 TCTTTCACCTGCTTTGTACCTGG + Intergenic
1140841290 16:78841847-78841869 TATTTCAGGACCTTGGTAAGGGG + Intronic
1143837570 17:9704155-9704177 GCTTTCAGGTTCTTTTTCACAGG + Intronic
1144546725 17:16203381-16203403 TCTGCCAGGTCCTTCCTAACTGG + Intronic
1144713648 17:17419734-17419756 ATTTTCAGATCCTTAGTAACTGG + Intergenic
1148481742 17:47964222-47964244 ACTTTCAGGTCCATTATAAAGGG - Intergenic
1153508280 18:5826168-5826190 TCTTTCAGGGGCTTTCTAAATGG + Intergenic
1156573608 18:38286390-38286412 TCTTTCAGGTCCTGTGGGGCAGG + Intergenic
1159406043 18:68004188-68004210 AGATTCAGCTCCTTTGTAACAGG + Intergenic
1159900536 18:74040807-74040829 TCTTTCTGGCCGTTTTTAACAGG + Intergenic
1160157422 18:76444179-76444201 TCTCTCACATCCTTTCTAACTGG - Intronic
1161780417 19:6287972-6287994 TCCTTCTGGTCCCATGTAACAGG - Intergenic
1167655706 19:50762672-50762694 TCTTTCAGCTCCATTATAATCGG - Intergenic
926833994 2:16997824-16997846 TCCTTCATGTCCCTTGTAAGTGG + Intergenic
927196288 2:20549530-20549552 TCTTTCAAGGCCTTTGGAAGGGG - Intergenic
930059276 2:47274823-47274845 TCTTTCAGGCCCTATGGAGCTGG - Intergenic
931982981 2:67714035-67714057 TCTTTCAGGTACATTCTACCTGG - Intergenic
936880160 2:117241031-117241053 GAGTTCATGTCCTTTGTAACAGG + Intergenic
936891819 2:117379477-117379499 TTTCTGAGCTCCTTTGTAACAGG - Intergenic
936943724 2:117912175-117912197 TCCTTCATGTCCCTTGTAAGTGG - Intergenic
937451543 2:122006057-122006079 TCTCTCAGGACCTTTGCACCTGG - Intergenic
937583073 2:123512716-123512738 ACTCTCAAGTCCTTTGGAACTGG + Intergenic
940433883 2:153628057-153628079 TCCTTCACGTCCCTTGTAAGTGG + Intergenic
940716319 2:157228909-157228931 TCTTTCATCTCCTTTGTTAAAGG + Intergenic
941242635 2:163058856-163058878 TCTTGCAGCTACTTTGTATCAGG + Intergenic
947109813 2:226706791-226706813 TCTTTCAGATGCTATGTACCAGG + Intergenic
948323238 2:237088415-237088437 TATTTCATGTCCTTTTTATCTGG + Intronic
1169547774 20:6668222-6668244 TCTTTCAGGTCAATTGGAAAAGG + Intergenic
1170315685 20:15039035-15039057 CCTATTAGGTCCTTTGTTACAGG - Intronic
1172966750 20:38841016-38841038 TTTATCAGGTGCTTTGTACCAGG + Intronic
1173064884 20:39700761-39700783 TCTGTCACTTCCTTTGTAAGTGG + Intergenic
1173209455 20:41020825-41020847 TCTTTGAGGTCCTTTGCATTTGG - Intergenic
1173386286 20:42591393-42591415 TGTTTCAGGCCCTCTGTAAGAGG - Intronic
1173651664 20:44670213-44670235 TTTTTCAGGTCTTTTGTGTCAGG + Intergenic
1178989969 21:37344831-37344853 TCTTTCAGGTCACTTGTGCCTGG - Intergenic
1182728425 22:32467554-32467576 ACTTTCAGGTCTTTTGTAACAGG - Intergenic
949202981 3:1402794-1402816 TCTTTCGGGTCTTTTACAACAGG + Intronic
949447020 3:4145891-4145913 TCGCTGAGGTTCTTTGTAACAGG - Intronic
950841374 3:15971268-15971290 TCTTTCACCTCCTTGGTAACAGG - Intergenic
952529926 3:34252952-34252974 TCTTTCAGGTCCTCAGGAAGTGG + Intergenic
953134443 3:40170645-40170667 TCTGTCACATCCTTTGTTACTGG + Intronic
954886493 3:53879656-53879678 ACATTCAGGTCCTTGTTAACAGG - Intronic
957281187 3:78153816-78153838 ACTTTCAGGTCCTTGGTCAGGGG - Intergenic
959239222 3:103767148-103767170 TCTTTCAGGTCATTTTTGAATGG + Intergenic
960188239 3:114670913-114670935 TCCTTCAAGTTCTTTGTAATGGG - Intronic
960638095 3:119803615-119803637 TTATTCAGGTCCTTTGTAAAAGG - Intronic
961948502 3:130720113-130720135 TATTTGAGGTGCTTTGTATCAGG - Intronic
962395615 3:135013229-135013251 CCTCTCAGGACCTTAGTAACAGG + Intronic
963772455 3:149402031-149402053 TCTACCAGTTCCTTTGAAACTGG - Intergenic
966950078 3:184808639-184808661 TCGTTCAGATCCTTTGTAAGGGG + Intergenic
967687892 3:192438847-192438869 TGTTTCAGTTCTTTTGAAACCGG - Intronic
971685371 4:29759037-29759059 TCTGTCAGATTCTTTGTACCAGG + Intergenic
974825341 4:67121072-67121094 TTTTTCATTTCCTTTGTAGCTGG - Intergenic
974862431 4:67538753-67538775 TATTCTAGGTCCTTTGTAACTGG - Intronic
976335039 4:83875774-83875796 TCTTTCAGCTACCTTGTGACTGG - Intergenic
976767960 4:88618167-88618189 TCTTTGAGGTGCTATGTAATAGG + Intronic
977234476 4:94491471-94491493 TCTTTTAGGGCCTTGTTAACTGG + Intronic
978204455 4:106063758-106063780 TCTCTCAGGTCCTTTTTATCAGG - Intronic
979235370 4:118394135-118394157 GATTTCAGGACCTTTGTAACAGG + Intergenic
980569275 4:134591447-134591469 TCTTCCAGCTCCTCTGTAAAAGG + Intergenic
984903806 4:184608789-184608811 TTTTACAGGGCCTTTGTAAAAGG + Intergenic
987520935 5:18982594-18982616 TTTTTCTAGTCCTGTGTAACAGG - Intergenic
987621013 5:20338644-20338666 TGTTTCAGTTCCATTGCAACTGG - Intronic
988405367 5:30817606-30817628 TCTTTCATCTCCTTTGTCAGAGG + Intergenic
990258451 5:53996007-53996029 TCTTTCAGTTTATTTGTAAAAGG + Intronic
991086648 5:62653800-62653822 TGTTTCATGTCCTTTGTATCCGG + Intergenic
992509726 5:77421044-77421066 TCTTTCAGGTTCTATGTAAATGG + Intronic
992560501 5:77948030-77948052 ACTTTCAGATCCTTTGTATGGGG - Intergenic
993343042 5:86748731-86748753 GCTTTCAGGTCCTCTGAAAGTGG - Intergenic
993698307 5:91088389-91088411 TCTTTCACAGACTTTGTAACTGG + Intronic
993776319 5:92002202-92002224 TCTTTCAAAACCTTTTTAACTGG + Intergenic
993968367 5:94386671-94386693 TATATCAGGACCTTTTTAACAGG + Intronic
996001172 5:118365682-118365704 TACTTCAGCTCCTTTCTAACTGG - Intergenic
996543433 5:124653347-124653369 TCTGTTATGTCCTTTGTAAAGGG + Intronic
998776976 5:145614527-145614549 TCTTTCAGCTCCTTGGTTAGGGG + Intronic
999513821 5:152280479-152280501 TCTTTCAGCTTCTCTGAAACTGG + Intergenic
999630465 5:153565698-153565720 TATTTGTGGTCCTTTGTGACTGG + Intronic
1006219236 6:32474078-32474100 TCTTTCAGGTCTTTCGATACTGG + Intergenic
1006544310 6:34766680-34766702 TCTCTCACATCCTTTGTAAGAGG - Intronic
1008825561 6:55688957-55688979 TCCTTCACGTCCCTTGTAAGTGG - Intergenic
1009736046 6:67676504-67676526 TCTTCCAGCTCCTTTGTATCTGG - Intergenic
1012597076 6:101053760-101053782 TCTTCCAGGTGCTTTGTCCCAGG + Intergenic
1013244699 6:108275343-108275365 TATTTGAAGTCCTTTGTGACGGG + Intergenic
1014140782 6:117939626-117939648 CCCTTTAGGTCCTTTTTAACTGG - Intronic
1014982676 6:127963924-127963946 TCTTTCTGCTCCTTTGTACCTGG - Intergenic
1020434178 7:8144677-8144699 TCTTTCAGGATCATTGTCACTGG - Intronic
1021171784 7:17406161-17406183 ACTTTTAGGTGCTTTGTAGCAGG - Intergenic
1027626249 7:80548155-80548177 GCATTCAGGTCCCTTGTATCAGG + Intronic
1028366481 7:90038291-90038313 TCTTTTAAGCCCTTTGTTACAGG + Intergenic
1031269702 7:119632930-119632952 TCTTTCAATTTCTTTGGAACAGG - Intergenic
1033589964 7:142801031-142801053 TTTTTCAGGTCCTCTGGAAAGGG - Intergenic
1034617429 7:152430831-152430853 TCCTTAATGTCCTTTATAACTGG + Intronic
1034936482 7:155203717-155203739 TCTTTCTGGGACTTTCTAACAGG - Intergenic
1036956792 8:13196622-13196644 TCTTACAGTTCCTCTGAAACTGG + Intronic
1039354694 8:36802167-36802189 TCTTTCAAGAGCTTTGTAAGTGG - Intronic
1042406521 8:68411985-68412007 TACTTCAGGTCCTTTTTAAGGGG - Intronic
1043862542 8:85337005-85337027 TCTTTCAGTTCCATTTTCACTGG - Exonic
1045867889 8:106890053-106890075 ACTTTCAGGTGCTTATTAACTGG - Intergenic
1046157974 8:110319011-110319033 TCTTTCAGATCCTTAGTACCAGG + Intergenic
1050364028 9:4857359-4857381 ACTATCTGGTCCTTTGTGACTGG + Intronic
1052485820 9:29098850-29098872 TCTTTCAGTTGCTTCTTAACTGG - Intergenic
1053056400 9:34995411-34995433 TCTGTCAGGTCCTGTCTAAGGGG - Intronic
1053613248 9:39736932-39736954 TCTTACTGTTACTTTGTAACGGG + Intergenic
1053871290 9:42494878-42494900 TCTTACTGTTACTTTGTAACTGG + Intergenic
1054240269 9:62605470-62605492 TCTTACTGTTACTTTGTAACTGG - Intergenic
1054554402 9:66639996-66640018 TCTTACTGTTACTTTGTAACTGG - Intergenic
1054978743 9:71179249-71179271 TCTTTTAGGTCCAGTGTGACTGG - Intronic
1058264528 9:102882382-102882404 AGTTTCAGGTCTTTTGTAAACGG + Intergenic
1059657233 9:116367977-116367999 TCTGTCAGGTCCTATGTGAAGGG + Intronic
1060613933 9:124993938-124993960 TCTTTAGAGTCCTTTGTATCTGG - Intronic
1185470453 X:378589-378611 CCTCTCAGGGCCTTTGAAACAGG - Intronic
1186776368 X:12868625-12868647 TTTTTCAAGTCCTTTGCAAGTGG + Intronic
1190555241 X:51627538-51627560 TCCTTCAGATCCATTGTAAGTGG - Intergenic
1191693467 X:63964347-63964369 TGCTTGAGGTCCTTGGTAACAGG + Intergenic
1192073489 X:67965557-67965579 TCCTTCACGTCCCTTGTAAGTGG - Intergenic
1192551173 X:72054958-72054980 TCTTTCAGCCCCTTTGTAAAAGG + Intergenic
1193180888 X:78455228-78455250 CCACTCAGGTCCTTTGTTACTGG - Intergenic
1193514759 X:82449827-82449849 TGTTTCATGTCCTTTGTAAGTGG - Intergenic
1193854094 X:86577295-86577317 TCTTTCAGGTTGTTTTTAATAGG + Intronic
1195027139 X:100888798-100888820 CATTTCAGGTCCTTTGTACATGG - Intergenic
1195475343 X:105278817-105278839 CCATTCAGGTAATTTGTAACAGG - Intronic
1195896745 X:109753039-109753061 TCTTTCACTTCCTTAGTAATGGG - Intergenic
1198974559 X:142321696-142321718 TCTTTGAGCTCCTTTTTAAATGG - Intergenic