ID: 1097032946

View in Genome Browser
Species Human (GRCh38)
Location 12:56102670-56102692
Sequence CATTTTACACAAAGGGAAGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 470
Summary {0: 1, 1: 1, 2: 4, 3: 54, 4: 410}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097032942_1097032946 20 Left 1097032942 12:56102627-56102649 CCTTTATCATCCTTAAAACAATT 0: 1
1: 0
2: 2
3: 49
4: 476
Right 1097032946 12:56102670-56102692 CATTTTACACAAAGGGAAGTCGG 0: 1
1: 1
2: 4
3: 54
4: 410
1097032943_1097032946 10 Left 1097032943 12:56102637-56102659 CCTTAAAACAATTCTGTGACATA 0: 1
1: 0
2: 8
3: 78
4: 662
Right 1097032946 12:56102670-56102692 CATTTTACACAAAGGGAAGTCGG 0: 1
1: 1
2: 4
3: 54
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097032946 Original CRISPR CATTTTACACAAAGGGAAGT CGG Exonic
901236053 1:7668181-7668203 CATTTTGCAGACTGGGAAGTAGG - Intronic
901690884 1:10972657-10972679 CATTTTGCAGAAAAGGAAATGGG - Intronic
901813227 1:11779420-11779442 CATTTTACAGATAGGCAAATAGG - Intronic
901892945 1:12283652-12283674 CATTCTGCACAACGTGAAGTTGG + Exonic
901972832 1:12921282-12921304 CATTTTGCTGAAAGGGAATTTGG - Intronic
902012348 1:13280480-13280502 CATTTTGCTGAAAGGGAATTTGG + Intergenic
902027338 1:13393899-13393921 CATTTTTCTAAAAGGGAAATTGG - Intergenic
902996135 1:20226705-20226727 CATTTTACAGATAAGGAAATAGG - Intergenic
903409870 1:23133413-23133435 GATTTCTCACAAAGGGAAGTAGG + Intronic
903438606 1:23370497-23370519 CATTTTAGAGAAAAGGAAATGGG - Exonic
904047519 1:27617383-27617405 CATTTTACACATGGGGAAAATGG - Intronic
904112524 1:28137453-28137475 AAACTTACACAAAGGGAAGAGGG - Intergenic
904416702 1:30366263-30366285 CATTTTACAGAATGGGAATGGGG - Intergenic
906042671 1:42800666-42800688 CATTTTACAGATAGGAAAATAGG - Intergenic
906934095 1:50196530-50196552 CATTTTCATCAAAGGGAAGCTGG - Intronic
907044706 1:51293541-51293563 CATTTTACATAAGGGGAAGAGGG + Intronic
907063575 1:51456386-51456408 CATTTAACCCAAGGGGAAATGGG + Intronic
907256255 1:53181249-53181271 CATGTTACACATAAGGAAATAGG + Intergenic
907381669 1:54095791-54095813 CATTTTACAGATAAGGAAATAGG - Intronic
907543483 1:55238198-55238220 CATTGTACACAAATCAAAGTGGG + Intergenic
909070631 1:70989274-70989296 CATTTTCTACGCAGGGAAGTTGG + Intronic
909252033 1:73370819-73370841 CATGTGACACAAGGGGAAGCAGG - Intergenic
910545831 1:88416750-88416772 GATTATACACAAAAGGAAATAGG + Intergenic
911702088 1:100965646-100965668 CATTTTAAAAAAAGGAAAGGAGG - Intronic
911793140 1:102044448-102044470 CATTTTACAAAAAGGAACCTGGG + Intergenic
912197884 1:107421538-107421560 CATTTGTCACAAAGTGAAATGGG - Intronic
912992431 1:114501945-114501967 CATTTGACTCAAGGGGAAGTGGG - Intronic
913141298 1:115943840-115943862 CGTTTTACAGATAAGGAAGTCGG + Intergenic
914326341 1:146620595-146620617 CATTTTACACATGGGGAAACTGG + Intergenic
914674539 1:149898658-149898680 CATTTTTCAAAATGAGAAGTTGG + Intronic
915196261 1:154192278-154192300 GATTTTAGACAATGGAAAGTGGG + Intronic
915847509 1:159283006-159283028 AATTTTACGCAAATGGAATTAGG + Intergenic
915883581 1:159700133-159700155 CAATTTATACAAAAGGCAGTGGG + Intergenic
916459112 1:165004127-165004149 CTTTTTGCACAAATGGAAGAGGG + Intergenic
916487947 1:165275989-165276011 GAGTTTTCACAAAGGGAAGCTGG + Intronic
918561186 1:185869287-185869309 CATTTTACAGACAGGGAAACTGG - Intronic
918748495 1:188239357-188239379 CATTTTACTGAGAAGGAAGTAGG - Intergenic
919676517 1:200389060-200389082 CATTTTACTCTAAGAGTAGTAGG + Intergenic
920988252 1:210910999-210911021 CAATCTACACAAATGCAAGTAGG - Intronic
921366264 1:214377648-214377670 CATTTTACAAAACAGGAAGTGGG + Intronic
921429347 1:215045655-215045677 CATTTTACACAAATTAAAGAGGG - Intronic
921493527 1:215808400-215808422 CATTTTACACATAGGAAAAATGG - Intronic
922778199 1:228227254-228227276 CATTTTACAGACAGGGAAACAGG - Intronic
924386083 1:243498805-243498827 CATCTTCCAAAAAGAGAAGTGGG - Intronic
1063686183 10:8239215-8239237 GAGTTGACACAAAGGGAAGCGGG - Intergenic
1064346259 10:14535282-14535304 CATTTTACACATAGGAGAGCTGG - Intronic
1065353528 10:24816860-24816882 CATTTTACACAAGTGGAAACAGG - Intergenic
1065370275 10:24977363-24977385 TAATTTACTCAAAGGTAAGTAGG - Intergenic
1065992307 10:31024238-31024260 CATTTTATAGAAAAAGAAGTTGG - Intronic
1066552565 10:36575791-36575813 CATTTTAAAAAAATGGATGTGGG + Intergenic
1067276919 10:44844306-44844328 AATATTACCCAGAGGGAAGTGGG + Intergenic
1067395903 10:45917112-45917134 CATTGGTCACATAGGGAAGTAGG - Intergenic
1067565854 10:47336264-47336286 CATTACACACAAAGAGAAGCAGG - Intergenic
1067864227 10:49886237-49886259 CATTGGTCACATAGGGAAGTAGG - Intronic
1069807962 10:71137746-71137768 CATTTTATAGAATGGGAAGATGG + Intergenic
1070442230 10:76457991-76458013 CATGTTACAGTAAGGGAAATAGG + Intronic
1071126001 10:82335488-82335510 CATTTTACAAATAGGGAAATTGG + Intronic
1071675647 10:87653580-87653602 CATTTTAAAGAAAGGAAAGAAGG - Intergenic
1071773517 10:88757714-88757736 CTCTTTACTCAAAGCGAAGTTGG - Intergenic
1073447923 10:103592166-103592188 CATTTTATAGAAATGGAAGCTGG - Exonic
1074211392 10:111338525-111338547 CATTTTACACATATGGAAATTGG - Intergenic
1074339558 10:112614042-112614064 AATTTTTTACAAAGAGAAGTGGG + Intronic
1074611447 10:115025867-115025889 CATTTTACAGATAGGGAAATTGG + Intergenic
1075426198 10:122343588-122343610 CATTTTGCATAAAGGGAAATAGG - Intergenic
1075630508 10:123998021-123998043 CATTTTACAGAAAAGGAAGCTGG - Intergenic
1077537332 11:3130624-3130646 CATCTTACACACAGGGCAGCTGG + Intronic
1077972650 11:7211237-7211259 CATTTTACCCAAAGGGCAGAGGG - Intergenic
1078374354 11:10781153-10781175 TATTTTTCTCAAAGGGAACTAGG - Intergenic
1080295612 11:30723657-30723679 AATTTTATACAAAGGGCAGTGGG + Intergenic
1080415291 11:32064507-32064529 CACTGTACAAAAAGGAAAGTTGG - Intronic
1080450814 11:32377471-32377493 CAATTCAGACAAAGGGAAGGTGG + Intergenic
1080711556 11:34752684-34752706 CATTATACTCATAGGGAAGAGGG + Intergenic
1080716358 11:34805564-34805586 CATTTTACAGAAAAGGGTGTCGG + Intergenic
1081282508 11:41227110-41227132 CATTTTTCAAAAGGGGAAGGAGG - Intronic
1081851251 11:46276702-46276724 CCTTTCACACAGAGGGAAGCTGG + Intergenic
1082714834 11:56599644-56599666 CATTCTACACAAAAGGACATTGG + Intergenic
1084266804 11:68009183-68009205 CATTTTACAAACGAGGAAGTGGG - Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1085120858 11:73966480-73966502 CATTTTACAGAGTGGGAAATGGG + Intronic
1085504167 11:77046867-77046889 TTTGTTACAGAAAGGGAAGTTGG - Intergenic
1086647918 11:89247661-89247683 TATTTTACAAAAAAGGAAATTGG + Intronic
1087284954 11:96255375-96255397 CATTTTACAGAAGAGGAACTGGG + Intronic
1087662238 11:101001152-101001174 CAATTTACACAAGGGGAATTAGG - Intergenic
1088330862 11:108649952-108649974 ACTTTTACACAAAGGAAAATGGG + Intergenic
1090422267 11:126583649-126583671 CATTTTACAAAGAAGGAAGCAGG - Intronic
1090788168 11:130068730-130068752 CAGTTTACCCACAGGGAACTGGG + Intergenic
1091155040 11:133364081-133364103 CATTTTAGAAAAGGGGACGTTGG - Intronic
1091533538 12:1383919-1383941 CATTTTACAGAGAGGGAAAGAGG + Intronic
1093133659 12:15422588-15422610 CATTTTTCACAGAGGAAATTAGG + Intronic
1093226573 12:16491242-16491264 CATTTTACACATAAGGTAATTGG - Intronic
1093619580 12:21273134-21273156 CATTGTACACACAGTGAATTTGG + Intronic
1093622994 12:21314332-21314354 CAATTTACACAATGGGGATTTGG - Intronic
1093637741 12:21491938-21491960 CATTTTACAGGAAGGGAAATGGG - Intronic
1093987181 12:25548571-25548593 CATTTTCCACAAATGCAAATGGG - Intronic
1094009400 12:25791387-25791409 CATTTTAGTCAAAGAAAAGTGGG - Intergenic
1094032778 12:26032272-26032294 CATTTTCCCCGAAAGGAAGTGGG + Intronic
1094217195 12:27955660-27955682 CAATTTACACAAAGGCAAGTTGG - Intergenic
1095507707 12:42915114-42915136 CATTTTACACATGAGGAAATTGG + Intergenic
1095816410 12:46427175-46427197 CATCTTACTCAATGGGAAGATGG + Intergenic
1095869841 12:47014470-47014492 AAGTTTACACAAAGAGGAGTAGG - Intergenic
1096935667 12:55271467-55271489 CATTCTACACAACTGCAAGTTGG + Intergenic
1097032946 12:56102670-56102692 CATTTTACACAAAGGGAAGTCGG + Exonic
1098165655 12:67695015-67695037 AATTTTACATAGAGGGAAATAGG + Intergenic
1098285671 12:68904683-68904705 CATTTAACACACAGAGAGGTGGG + Intronic
1098505684 12:71247826-71247848 CATTTTACTCAAAGAGGTGTTGG + Intronic
1099813965 12:87621525-87621547 CAATTTATACAGACGGAAGTTGG - Intergenic
1100388064 12:94121888-94121910 CATTTTACAGAATGGGAAACAGG - Intergenic
1101577831 12:106014215-106014237 CATCTTAAACCAAGGGAAGGGGG + Intergenic
1101849960 12:108393976-108393998 CATTTTACAGAAAGGGAAGTGGG - Intergenic
1102510020 12:113408934-113408956 CATCTTACAGAAAGGGAAACAGG + Intronic
1102835682 12:116057129-116057151 CATTTAACAGAAAATGAAGTTGG + Intronic
1103483853 12:121269353-121269375 CATTTTACAGATAGGAAAATGGG - Intronic
1103600326 12:122050650-122050672 CATTTTACAAACAAGGAAGTAGG - Intronic
1104026772 12:125033214-125033236 CATTTTACACAAGATAAAGTAGG - Intergenic
1104619725 12:130302003-130302025 CATTTTTCCCAGAGGGAAGAGGG - Intergenic
1106523385 13:30518374-30518396 AATTCAACACAAAGGGAAATAGG - Intronic
1107044693 13:35982205-35982227 CACTTTTCACAAAGGAAAGAGGG + Intronic
1107076255 13:36324145-36324167 CATTCTTCCCAGAGGGAAGTGGG + Intronic
1107303608 13:38994039-38994061 TATTTTACAGAAAAAGAAGTAGG - Intergenic
1107956390 13:45516759-45516781 CATTTTACATAAAAGGAAGGTGG - Intronic
1108126838 13:47253750-47253772 CATTATACTCAAAGGCAAGCTGG + Intergenic
1109068982 13:57738548-57738570 CAATTTACACAAAGAGACGAGGG - Intergenic
1109301473 13:60593936-60593958 CCTCTTCCACAAAGGGAAGGAGG + Intergenic
1109939340 13:69339778-69339800 CATTTTTCTCACAGGGAAATAGG - Intergenic
1110053219 13:70931442-70931464 CATTTTACAGATTGGGCAGTGGG + Intergenic
1112246649 13:97741280-97741302 CATTTTACACAGAAAGATGTAGG - Intergenic
1112754554 13:102616861-102616883 CATTTTACACAAATCAAAATAGG - Intronic
1113119665 13:106912708-106912730 CATTTTACAAAAAAAGAGGTAGG + Intergenic
1113454364 13:110437495-110437517 CATTTTAGACGAAGAGAAATGGG + Intronic
1113548774 13:111175696-111175718 CCTTATCCACAAAGAGAAGTGGG - Intronic
1113793577 13:113043504-113043526 CCTTTTCCACAAAGGGACCTTGG - Intronic
1114070563 14:19102280-19102302 TATTTTAGAGAAAGTGAAGTGGG - Intergenic
1114091697 14:19297725-19297747 TATTTTAGAGAAAGTGAAGTGGG + Intergenic
1114684810 14:24518669-24518691 CATTTTACAGATGTGGAAGTGGG - Intergenic
1117352371 14:54893668-54893690 CATTTTATACATAAGGAAATTGG - Intronic
1117378716 14:55138723-55138745 CATTTCACACATGGGGAAATGGG + Intronic
1118519134 14:66561526-66561548 CATTTTACATATAAGGAAATTGG + Intronic
1118855521 14:69618989-69619011 CATTTTAAAGAAATGCAAGTGGG + Intronic
1119392029 14:74297311-74297333 CATTTTACAGAAGGGGAACCTGG + Intronic
1120526732 14:85585098-85585120 CATTTTACAAAGAGGGAAACTGG - Intronic
1121176329 14:91893149-91893171 CATTTTAGACAAAGTGAGTTGGG - Intronic
1121319861 14:92985901-92985923 CATTTTACAGATAGGAAAGCTGG + Intronic
1123963674 15:25434803-25434825 CATTTTATACAAGAGGAAATTGG - Intronic
1124076193 15:26446762-26446784 CATATTAAACAATGAGAAGTAGG - Intergenic
1126306995 15:47271255-47271277 CATTTCAAAGAAAAGGAAGTGGG + Intronic
1128750838 15:70147936-70147958 CACTCTACACAAAGGAAACTGGG + Intergenic
1129389049 15:75211435-75211457 CATTTTACACATGGGGAATGAGG - Exonic
1129453329 15:75662898-75662920 CATTTTACACACCAGGAAATGGG + Intergenic
1129774727 15:78229324-78229346 TTTTTTACATAATGGGAAGTGGG + Intronic
1130012520 15:80162810-80162832 CATTTTACAGACAGGAAAATGGG + Intronic
1131527660 15:93165580-93165602 CATTTTATAAAATGGGATGTTGG + Intergenic
1133448349 16:5882064-5882086 CATTTTACAGAATAGGAACTAGG + Intergenic
1133534199 16:6684983-6685005 CATTTTACAAAATGGGAAAATGG + Intronic
1133536315 16:6705546-6705568 CATTCTCCAAAAAGGGAAGAAGG + Intronic
1133981344 16:10635340-10635362 AACTTTACAAAAAGGGAGGTGGG + Intronic
1134685685 16:16156575-16156597 CACTTTACCCCAAGGGAAGCTGG + Intronic
1134837717 16:17376039-17376061 CACTTTACAGAGAAGGAAGTGGG + Intronic
1135056308 16:19234696-19234718 CACTTTACACAAAAGTAAGCTGG - Intronic
1137008126 16:35297352-35297374 CACTTTCCACAAAAGGAATTGGG + Intergenic
1137311855 16:47270055-47270077 CAATTTACAAAAAAGGAACTCGG + Intronic
1137716801 16:50603154-50603176 CATTTTACAGAAGGGGAAAATGG + Intronic
1137753714 16:50885362-50885384 CATTTAACCCAAAGGAATGTGGG - Intergenic
1138080812 16:54089476-54089498 CATCTTATAAAAAGGGAAGTTGG + Intronic
1138085102 16:54126388-54126410 CATTTTATACAAGGGAAACTGGG - Intergenic
1138379923 16:56592742-56592764 CATTTTACAGATGGGGCAGTAGG + Intergenic
1138724165 16:59117658-59117680 TCTTATACACAAAGGCAAGTTGG + Intergenic
1139203499 16:65003608-65003630 CATTTTACTCAAATGCTAGTGGG + Intronic
1139925598 16:70484130-70484152 CATATTACAGAGGGGGAAGTGGG - Intronic
1139934749 16:70561369-70561391 CATTTTACACACGTGGAAGCAGG + Intronic
1140007224 16:71090354-71090376 CATTTTACACATGGGGAAACTGG - Intronic
1140351636 16:74267315-74267337 CTTTTCACAGGAAGGGAAGTAGG - Intergenic
1141850727 16:86644034-86644056 CATTCTACACAAAGGGCAGTGGG - Intergenic
1142014392 16:87736822-87736844 CATTTTACAGACAAGGAAATCGG + Intronic
1142053798 16:87978924-87978946 AATTTTAGACAAAAGGAAGGAGG - Intronic
1143131082 17:4677416-4677438 CATTTTACAAATAGGCTAGTGGG - Intronic
1144773686 17:17773224-17773246 CATTTTACAGACAGAGAAATTGG - Intronic
1145264597 17:21373761-21373783 CATTTTACAGAGAGGGAAGTGGG + Intergenic
1145767109 17:27466336-27466358 CCTTTTTTACAAAGGGAAATAGG + Intronic
1145925864 17:28646070-28646092 CATTTTACAGAGAAGGAAGCAGG - Intergenic
1146023601 17:29300159-29300181 CATTTTATATAAATGGAAATTGG + Intergenic
1146467400 17:33096996-33097018 CATTTTACAGACAGGGAAACAGG + Intronic
1146795223 17:35775625-35775647 CATTTTGCACATAGGGAAACAGG - Intronic
1146838826 17:36135341-36135363 GATTTTACACAATGGGAATTGGG + Intergenic
1146976521 17:37117880-37117902 CATTTTACCCACAGTGCAGTCGG + Intronic
1147211985 17:38877244-38877266 CATTGTACACACCAGGAAGTGGG + Intronic
1148222072 17:45870046-45870068 CATTTTACAGACAGGGAAACGGG - Intergenic
1148576059 17:48712112-48712134 CATTTTACAGAAAGGGTAAATGG - Intergenic
1149080758 17:52654312-52654334 CAGCTTACAGAAAGGGAAATGGG + Intergenic
1149450964 17:56749777-56749799 CATTTTACAGATAGGGAAGCAGG - Intergenic
1150880368 17:69018712-69018734 CATTTTAGAAACAAGGAAGTGGG - Intronic
1151378594 17:73708977-73708999 CATTTTCTCCAGAGGGAAGTTGG - Intergenic
1151901304 17:77017204-77017226 CATCTTAGCCACAGGGAAGTGGG + Intergenic
1152879089 17:82805209-82805231 CATTTTATAGAGGGGGAAGTGGG + Intronic
1153338077 18:3945129-3945151 CATTTTAGAGAGAGGGAAATTGG - Intronic
1153988310 18:10372815-10372837 CAGTTTAAACCAAGAGAAGTCGG - Intergenic
1155349538 18:24892931-24892953 CATTTTACAGATAGGGAATCTGG - Intergenic
1156630723 18:38965124-38965146 AATAAAACACAAAGGGAAGTAGG - Intergenic
1156732912 18:40216786-40216808 CATTTTAAACAAAGAAAAGTTGG - Intergenic
1157342664 18:46793291-46793313 CATTTTACACAACAGGAAACTGG + Intergenic
1157542830 18:48524348-48524370 CATTTTAGCCAAAGGAAACTAGG + Intergenic
1157618658 18:49002807-49002829 CATTCTTCACAAAGGCATGTGGG - Intergenic
1157643106 18:49238038-49238060 CATTTTGCACAAATGCACGTAGG + Intronic
1159235109 18:65661512-65661534 CAGTTTAGAAAAAGGGCAGTTGG + Intergenic
1159707120 18:71705501-71705523 CATTTACCACAAAGGAAACTAGG - Intergenic
1161290265 19:3490397-3490419 TATTTTACAGAGAGGTAAGTGGG + Intergenic
1161625114 19:5322016-5322038 CAGTTTACCCAAATGGAAATGGG - Intronic
1162847840 19:13407415-13407437 CATTTTACAGAGAAGGAAATAGG - Intronic
1164400431 19:27898450-27898472 CATTTTACAGAAAGGGAAACTGG - Intergenic
1164796002 19:31030822-31030844 CATTTTACAGATTGGGAAATGGG - Intergenic
1164899004 19:31902247-31902269 CATTCCAGAAAAAGGGAAGTAGG - Intergenic
1165379709 19:35470000-35470022 CTTTTTACAAAAAGGGAAATTGG + Intergenic
1166360855 19:42252493-42252515 CATGCAACACAAAGGGAACTCGG + Intronic
1166867677 19:45850537-45850559 CTTTTTACAGAAAGGGAAACAGG - Intronic
1167850944 19:52201464-52201486 CATTTTACAGACAGGGAAACAGG - Intronic
926359594 2:12073620-12073642 CATTTTACAGAGAAGGAAGCAGG + Intergenic
927309196 2:21609559-21609581 CATTTTACATATACGGAAATTGG - Intergenic
927891844 2:26755812-26755834 CATTTTACAGATAGGAAAGTGGG + Intergenic
927899924 2:26811923-26811945 CATTTTACAGACAGGTAAGTGGG + Intergenic
928286554 2:29995098-29995120 CATTTTACAGAAGAGAAAGTTGG + Intergenic
928730018 2:34220857-34220879 CATTTTACAAAATGGAAAATAGG + Intergenic
929582065 2:43087663-43087685 CATTTTCCAGATAAGGAAGTTGG + Intergenic
929791134 2:45024010-45024032 CATTTTACGTAATGGAAAGTGGG + Intergenic
930205937 2:48586797-48586819 GATTATAGACACAGGGAAGTTGG + Intronic
930304436 2:49660238-49660260 ATTCTTACAAAAAGGGAAGTTGG + Intergenic
930642990 2:53873366-53873388 GATTTTACTCACAGGAAAGTAGG - Intronic
931244917 2:60484469-60484491 CATTCACCAGAAAGGGAAGTAGG + Intronic
931599684 2:63990875-63990897 CATTTAACATAAGGAGAAGTAGG - Intronic
931636804 2:64348313-64348335 CATTTTACACAAGAGGAATCTGG + Intergenic
932171474 2:69561213-69561235 CATTTTACTCAAAGCCAAGAAGG + Intronic
932178646 2:69625534-69625556 CATTTTACACATAGGGAGCCTGG + Intronic
933101907 2:78270761-78270783 TATTTTAAACAAATGGTAGTTGG - Intergenic
933272801 2:80251423-80251445 CATTTTTCAAACTGGGAAGTTGG - Intronic
933859750 2:86454126-86454148 TTTTTTACAAAAAGGGAGGTGGG - Intronic
935670001 2:105546983-105547005 CGTTTTAAAAAAAGGGACGTGGG - Intergenic
936004042 2:108866129-108866151 GATTTCACAGAAAGGGAATTTGG + Intronic
939577807 2:143917236-143917258 CATTTTACATAAAAGGAAATAGG - Intergenic
941367170 2:164622219-164622241 CATTTTACACAAAAGGAAACTGG + Intergenic
941687259 2:168459829-168459851 CATTTTTGAAAAAGTGAAGTTGG - Intronic
942257081 2:174113879-174113901 CATTTTACAGATAGGGCAGGCGG - Intronic
942398258 2:175574995-175575017 CATTTTACAAAAGGGGAAACAGG - Intergenic
942415699 2:175757024-175757046 CATTTTACAGAGAGGAAAGCAGG + Intergenic
942501979 2:176600905-176600927 CGTTTTACAAAGAGAGAAGTAGG + Intergenic
942513020 2:176722865-176722887 CATTTTACAGAAGAGGAAGCAGG - Intergenic
942561462 2:177224340-177224362 CGTTTGACACAAAGGGAAAAGGG + Intergenic
943473688 2:188328301-188328323 CATTTTCCTGAAAGGGAAGATGG - Intronic
944897607 2:204181041-204181063 CATTTTACACACAGGGAAATAGG + Intergenic
945359448 2:208879416-208879438 TATTTTAAACAAAGGGACTTTGG + Intergenic
946609916 2:221446873-221446895 CATTTTACTGAAAGTGAATTAGG - Intronic
946935644 2:224717855-224717877 CATTTTACAGCAAAGGAAATGGG + Intergenic
947168433 2:227286549-227286571 CATTTTACATACGGGGAAATAGG + Intronic
947527278 2:230886375-230886397 CATTTTACAGAAGGGCAAGTTGG - Intergenic
1168828394 20:829848-829870 CATCTGATGCAAAGGGAAGTTGG - Intergenic
1169423931 20:5481786-5481808 CATTTTACACCAGGGAAAATTGG + Intergenic
1169745925 20:8942834-8942856 GATTTTACAAAAAGGTTAGTTGG - Intronic
1170309518 20:14976781-14976803 CATTTTACACACGAGGAAATGGG - Intronic
1170408328 20:16063003-16063025 CAATTAACACAAAGGGAAGCCGG + Intergenic
1172184278 20:33021579-33021601 CCTTTTACAGAAGGGGAAGCTGG - Intronic
1172484106 20:35288175-35288197 CATTTGACAGATGGGGAAGTTGG - Intronic
1172918243 20:38460559-38460581 CATATTTCACAAAGGTAAGGTGG - Intergenic
1173639015 20:44586151-44586173 CACTTGACAGAAAGAGAAGTAGG - Intronic
1173950866 20:46992451-46992473 CATTTTACAGACATGGAAGTTGG + Intronic
1175105433 20:56611430-56611452 TATTTCACCCACAGGGAAGTTGG - Intergenic
1175941292 20:62538689-62538711 CAAGTTACTCAAAGGGAAGGTGG - Intergenic
1179152445 21:38820664-38820686 CATTTTACAGATGGGGAAATTGG + Intronic
1179267130 21:39813501-39813523 CATGTTATACAAAGGAATGTGGG - Intergenic
1180489034 22:15824747-15824769 TATTTTAGAGAAAGTGAAGTGGG - Intergenic
1181911990 22:26245484-26245506 CATTTTACACCATGGGGACTTGG + Intronic
1182091838 22:27601253-27601275 CATTTTACTTAAAGGGCGGTGGG - Intergenic
1182327838 22:29527473-29527495 TTTTTTACACAAATGGAAATAGG - Intronic
1183000817 22:34857168-34857190 CTGTTTACACAGAGAGAAGTAGG + Intergenic
1183049675 22:35250680-35250702 CAGCTTACACAAAGGGGAGTGGG + Intergenic
1183229869 22:36575090-36575112 CATTTTACAGAAAAGGAAATTGG - Intronic
1184415217 22:44348237-44348259 CATTTTACACAGGGGGAAGCAGG - Intergenic
1185105321 22:48866002-48866024 CATTTTGCAGACCGGGAAGTGGG + Intergenic
949221599 3:1640730-1640752 CATTTTACAGAAATGGAAAAAGG + Intergenic
949869092 3:8571613-8571635 CAATTTACATAAAGGGGAGTGGG - Intergenic
950450486 3:13062395-13062417 CATTTTACAGAAAAGGAAATAGG + Intronic
950748485 3:15109492-15109514 CATTTAACACGAAGGGAAAGGGG - Intergenic
951961522 3:28329246-28329268 CATTTTACACACGAGGAAATGGG + Intronic
952818496 3:37466011-37466033 CATTTTACAGATAGGGAAGCAGG - Intronic
953340879 3:42133177-42133199 CATTTTATCCAAAGGGCAATGGG - Intronic
953499934 3:43423531-43423553 CCTGTTACACAATGGGAAGAAGG + Intronic
953985891 3:47442754-47442776 CTTTTTACACAATGGGAGCTTGG - Intronic
954369915 3:50164834-50164856 CATTTTCCAGAAAAGGCAGTGGG - Intronic
955326857 3:58015187-58015209 CATTTTATAGACAGGGAAGCAGG - Intronic
955403209 3:58608554-58608576 CATTTTACAGATAGAGAAGCTGG + Intronic
955686769 3:61557260-61557282 CATTTTACAAAAAAGGAAGCAGG - Intergenic
955881229 3:63548347-63548369 CATTATGCAGATAGGGAAGTTGG - Intronic
956612557 3:71139134-71139156 CATTTTACAGGAGGGGAAATTGG + Intronic
956640662 3:71412553-71412575 CATTTTCTTCAAAGGGTAGTTGG - Intronic
957904194 3:86536948-86536970 CATCTTACATAAATGTAAGTTGG - Intergenic
960219589 3:115089567-115089589 CATTTAACACAATGGGAACCTGG + Intronic
961122087 3:124381415-124381437 CATTTTACCCCAAAGGCAGTGGG + Intronic
961201064 3:125045859-125045881 CATTTTACATATACGGAAGCAGG + Intronic
961699612 3:128732336-128732358 CATTTTAAATAAAAGGTAGTGGG - Intronic
962277664 3:134028616-134028638 CAGATTACACAAAGGGATGATGG - Intronic
964558857 3:157970991-157971013 CGTTTTGCCCAAAGGGAATTCGG + Intergenic
964862594 3:161219249-161219271 TTATTTACACAAAGGGAAGCAGG - Intronic
965198227 3:165625681-165625703 TATTTTACTCAAAGGAAAGAGGG + Intergenic
966422676 3:179748870-179748892 CAGTTTACAGATAGGGAAGCTGG - Intronic
967270791 3:187730430-187730452 CATTTTACACATAGGGAAACAGG + Intronic
967389456 3:188941246-188941268 CATTTTGCACAAGGGGAAGCGGG + Intergenic
968023418 3:195416639-195416661 CATTTTTCACAAAGAAAAATAGG + Intronic
968129969 3:196187339-196187361 CATTTTACACATAAGGAAACAGG + Intergenic
968758229 4:2427730-2427752 CATTCTACCCCAAGGGAAGGTGG - Intronic
970068074 4:12122303-12122325 CATTTTACAGAGGGGGAAATTGG - Intergenic
970110481 4:12631825-12631847 CATTTTACAAAACAGGAAATAGG + Intergenic
970660347 4:18278569-18278591 TATTTTAAAGGAAGGGAAGTGGG + Intergenic
973655184 4:53039763-53039785 CATTTTACAAATAAGGAAGTTGG + Intronic
974779815 4:66539974-66539996 CATTTTAGACAAAGTGAATTGGG - Intergenic
975097672 4:70476063-70476085 TATTTTACACATAGGGAAATTGG - Intronic
976051432 4:81015678-81015700 CATCTTACACAGATGGAAGCAGG + Intergenic
976607906 4:86999803-86999825 CTTCTTACACCAAGAGAAGTCGG - Intronic
977059221 4:92236102-92236124 CATTTTATAGAAAGGGTATTGGG + Intergenic
977869738 4:102077331-102077353 CATTTTACATATATGTAAGTTGG + Intergenic
979339334 4:119502229-119502251 AATATTACACCAAGGGACGTAGG + Intronic
979454940 4:120916570-120916592 CATTTTAAAGAATGGGAAGGAGG + Intronic
980015618 4:127646702-127646724 CAGTTTTCACAAAAGCAAGTTGG + Intronic
980224780 4:129968146-129968168 CATCTCACACAAAGGGCTGTAGG - Intergenic
980563741 4:134510206-134510228 CATTTTAAAAAGAGAGAAGTTGG - Intergenic
981759756 4:148181382-148181404 CATTTTACAGATAAGGAATTTGG - Intronic
981838531 4:149083371-149083393 CATTTTAAACGAATGGAAGGGGG - Intergenic
983332039 4:166342704-166342726 CATTTTACACAAAAAAAATTGGG + Intergenic
985176900 4:187211830-187211852 GATTTTACACGCAGGGAACTTGG - Intergenic
985199432 4:187469512-187469534 CATTTAACACAAAGAGGGGTAGG + Intergenic
985364983 4:189220064-189220086 TATTTTACACAAAGGTAATTGGG + Intergenic
987171996 5:15269024-15269046 AGTTTTTCCCAAAGGGAAGTAGG + Intergenic
987693708 5:21301320-21301342 CATTTAACACAACAGGAAATAGG - Intergenic
987967855 5:24899127-24899149 CATTTTGTACATAGGCAAGTGGG + Intergenic
988067537 5:26240715-26240737 CATTTTACATGAAGGGCAGCAGG + Intergenic
988227242 5:28427819-28427841 GATATTTCAAAAAGGGAAGTTGG - Intergenic
988722553 5:33892574-33892596 CAAGTCACACAAAGGGAAATGGG + Intergenic
989096820 5:37789475-37789497 CATTTTACAGATGGGGAAGCTGG + Intergenic
989563552 5:42877727-42877749 GATTCTAGACAAAGGGAAGAAGG - Intronic
990643535 5:57816434-57816456 CATTTTATACAAAGGAAATGGGG + Intergenic
990810857 5:59721541-59721563 CATTTTACATATAGGAAAATTGG + Intronic
991746554 5:69748220-69748242 CATTTAACACAACAGGAAATAGG + Intergenic
991751151 5:69807022-69807044 CATTTAACACAACAGGAAATAGG - Intergenic
991798154 5:70328163-70328185 CATTTAACACAACAGGAAATAGG + Intergenic
991825932 5:70623532-70623554 CATTTAACACAACAGGAAATAGG + Intergenic
991830440 5:70681917-70681939 CATTTAACACAACAGGAAATAGG - Intergenic
991890498 5:71327485-71327507 CATTTAACACAACAGGAAATAGG + Intergenic
994219229 5:97175515-97175537 CATTTTCCCAAAAGGGTAGTAGG - Intronic
994717452 5:103338803-103338825 CATTCTGCAGAAAGGCAAGTGGG - Intergenic
994853325 5:105085147-105085169 CATATTACACAGAGGGCAGCAGG - Intergenic
995155411 5:108906092-108906114 CATTTTACACACTGGGAAATGGG - Intronic
998017609 5:138745043-138745065 CATTTTAGACCAAGGGAACAAGG - Intronic
998382193 5:141733712-141733734 CAGATTACACAAAGGCAAGGGGG + Intergenic
999517145 5:152313061-152313083 CATTTTAGACAAAGAACAGTGGG - Intergenic
1000942421 5:167378183-167378205 CATATTACCAAAAAGGAAGTTGG - Intronic
1001006979 5:168060803-168060825 CATTTTACACATAGAGAAACTGG + Intronic
1003439720 6:6128331-6128353 CATCTAATACAAAGAGAAGTAGG + Intergenic
1004181121 6:13381346-13381368 CATTTTACAGACAAGGAAATGGG + Intronic
1005460321 6:26063019-26063041 CATTTTACAGAGAAGGAACTTGG - Intergenic
1005557200 6:26998616-26998638 CATTTTACACAACAGGAAATAGG + Intergenic
1005708165 6:28477698-28477720 CATTTTACAGAAAAGAAAATTGG - Intergenic
1005792366 6:29317184-29317206 CCTTTTAGAAACAGGGAAGTAGG - Intergenic
1005975974 6:30799726-30799748 CATTTAAAAAAAAGAGAAGTGGG - Intergenic
1006454409 6:34123712-34123734 CATTTTACACACAAGGAAACGGG + Intronic
1006644116 6:35504467-35504489 CATTTTATAGATGGGGAAGTTGG - Intronic
1006646968 6:35521528-35521550 CTGTTAACACAGAGGGAAGTAGG - Intergenic
1007414866 6:41685502-41685524 CCCTTTACACAAAGGGCAATTGG - Intronic
1008093907 6:47319214-47319236 CAGTTTACTCAAAAGGCAGTGGG + Intergenic
1009562469 6:65265589-65265611 CACTTTAAACAATTGGAAGTGGG - Intronic
1010154994 6:72782149-72782171 CATTTTTCATAAAGGAAAGCTGG + Intronic
1010897745 6:81386116-81386138 ACTTTTAAATAAAGGGAAGTAGG + Intergenic
1011429289 6:87268093-87268115 TATTTTACTCAAAGTGCAGTGGG - Intergenic
1011646679 6:89465550-89465572 CATTTTAAACAGAGGAAACTGGG - Intronic
1011696765 6:89920186-89920208 CATTTTACAGATAAGGAAATAGG + Intergenic
1011707707 6:90019478-90019500 CATTTTACAAACATGGAAGCAGG - Intronic
1011725471 6:90206172-90206194 CATTTTACAGATGGGGAAATTGG + Intronic
1012309044 6:97698090-97698112 CATTTGACAGGAAGAGAAGTTGG + Intergenic
1013295489 6:108754845-108754867 CATTTCAAACAAAAGGAATTAGG - Intergenic
1013751952 6:113417393-113417415 CATTTTAAATAAGAGGAAGTTGG + Intergenic
1014720066 6:124905858-124905880 AATATTACTCAAAGGAAAGTAGG + Intergenic
1015617791 6:135096595-135096617 CATTTTACAGATAAGGAAGCTGG + Intronic
1015637842 6:135296410-135296432 GCTTTTACACCAAGTGAAGTAGG - Intronic
1016479312 6:144464819-144464841 CATAATACACAACGAGAAGTGGG - Intronic
1016820023 6:148338529-148338551 CATTTTACAGATGAGGAAGTAGG - Intronic
1016872201 6:148829377-148829399 CATTTTCCAGATAGGGAAGTTGG - Intronic
1017565383 6:155679377-155679399 CATTTTATACAAGGGGAAACTGG + Intergenic
1018076624 6:160222118-160222140 CATTTTACAGAAAGGAAAACAGG + Intronic
1018543462 6:164909868-164909890 CACTTTCCACAAATGGATGTTGG - Intergenic
1019195468 6:170279728-170279750 CATTTTACAGAAAAGGCAGAGGG - Intergenic
1019904106 7:4047924-4047946 CATTTTACAGGATGGCAAGTAGG + Intronic
1020461900 7:8436113-8436135 GAGTTTAAACGAAGGGAAGTGGG + Intronic
1021793275 7:24227755-24227777 CATTTTACAGAAATGGAGATGGG + Intergenic
1023247706 7:38223314-38223336 CATTTAATACAAAGGGATGCAGG - Intronic
1023576768 7:41636215-41636237 CATTTTACACACAAGGAAACTGG + Intergenic
1024254936 7:47533478-47533500 GATGTTAATCAAAGGGAAGTTGG + Intronic
1024904790 7:54364786-54364808 AATTTTAAACAAAGGTAAATAGG - Intergenic
1026149156 7:67773424-67773446 CATTTTAGACATAAGGAAATAGG - Intergenic
1027933390 7:84569631-84569653 TGTTTTACATGAAGGGAAGTGGG - Intergenic
1028138869 7:87249861-87249883 CAATTAACACTAAGAGAAGTAGG + Intergenic
1028620928 7:92828052-92828074 CATTTTAGACAAAGAGGAGTAGG - Intronic
1028766726 7:94568323-94568345 CATTTTAAACAAAATTAAGTTGG + Intergenic
1030651181 7:112117669-112117691 CATTTTACAAAAAGAAAAGGTGG - Intronic
1030683176 7:112453961-112453983 GATTTTACTGAAAGGGAATTAGG + Intronic
1030907051 7:115198833-115198855 CAATTTACACAAGGCTAAGTTGG + Intergenic
1032271772 7:130415158-130415180 CATTATTAGCAAAGGGAAGTTGG + Intronic
1033003512 7:137534530-137534552 TATTTTACAGAAAGTGAATTTGG + Intronic
1034268997 7:149794627-149794649 CAATTCACACCAAGGGAAGGAGG + Intergenic
1034377126 7:150655964-150655986 CATTTTACACCAGGGAAAATTGG + Intergenic
1035789574 8:2291754-2291776 CATTTTACTCAAAGAGTAATGGG + Intergenic
1035803231 8:2429951-2429973 CATTTTACTCAAAGAGTAATGGG - Intergenic
1036133735 8:6140083-6140105 CTGTTTACACAAAGGGAATAGGG - Intergenic
1036682981 8:10889341-10889363 CATTTTACAGAAAGAGAAATTGG + Intergenic
1038037777 8:23701366-23701388 CATTTTACTCATAGGGACATGGG - Intergenic
1038577742 8:28719488-28719510 CACTTTGCACAGAAGGAAGTAGG - Intronic
1039073298 8:33665597-33665619 CATTTTAAACAAAGGAAAAGTGG + Intergenic
1039333126 8:36560918-36560940 CAATATACAAAAAGGGAAGGAGG - Intergenic
1040946966 8:52894231-52894253 CATTTTACAGATAGGAAACTTGG - Intergenic
1040963592 8:53061892-53061914 CAAATTGCACAAAGGGAACTGGG + Intergenic
1041574599 8:59379898-59379920 CATTTTGGAAAGAGGGAAGTTGG + Intergenic
1042501320 8:69512537-69512559 CATTTTACAGAAAGGCAATCTGG - Intronic
1042843499 8:73147906-73147928 CACTTTACACAAAGGGAGTGTGG - Intergenic
1043083982 8:75804095-75804117 CATTTTACAAATAGGGAAATTGG - Intergenic
1044294340 8:90510309-90510331 AATTTTACACAGAAGGCAGTCGG - Intergenic
1044551902 8:93521834-93521856 ATTTTTACACATAGGAAAGTGGG - Intergenic
1045183374 8:99811094-99811116 CATATTACTCAATGGGAAGGTGG - Intronic
1045777953 8:105828515-105828537 CATTTAACACAAAGGGCTTTAGG + Intergenic
1045848066 8:106660240-106660262 CATTTTAAACAAAGGCTAGCTGG - Intronic
1045931063 8:107627194-107627216 GATTTGAAACAAAGGGAAGGAGG + Intergenic
1046373462 8:113343723-113343745 CATATTACACATAAGGAAATGGG + Intronic
1046518902 8:115299727-115299749 CATATTATAAACAGGGAAGTAGG - Intergenic
1046860602 8:119087003-119087025 CATTTTACAGAAAAGGAAATGGG - Intronic
1048202303 8:132384823-132384845 CATTTTACAGATGGGAAAGTGGG - Intronic
1048237112 8:132701656-132701678 CACTTTATCCAAAGGGAAGCAGG - Intronic
1048659758 8:136585848-136585870 CATTTTGCACCATGTGAAGTAGG - Intergenic
1049983103 9:922881-922903 CATTTTACCCAAAGGTCAGATGG + Intronic
1051076184 9:13239364-13239386 CATTTTATAGATAGGGAAATGGG - Intronic
1051176055 9:14361355-14361377 CATTTTAAACCAAGACAAGTGGG - Intronic
1051469493 9:17421653-17421675 ACTTTTACACAAAGGAAAATAGG - Intronic
1051567490 9:18517053-18517075 CATTTTCCTCAAGGGGAAGATGG + Intronic
1051703306 9:19848691-19848713 AATTTCACATAAAGGGTAGTAGG + Intergenic
1052276589 9:26683388-26683410 CTTATTTCACAAAGTGAAGTTGG + Intergenic
1054794608 9:69288695-69288717 CATCTTCCAGAAAGGGAAGAGGG - Intergenic
1055719334 9:79154096-79154118 CAGTTGACACAAAGACAAGTTGG - Intergenic
1055967215 9:81877147-81877169 CAATTTACACAGAAGGAAGTAGG - Intergenic
1056070971 9:82986240-82986262 CATTTTACAGAAGAGGAAATTGG - Intronic
1056197636 9:84243931-84243953 CATTTTACAAAGAGGGAACTGGG - Intergenic
1056423634 9:86454465-86454487 CATTTTACACCAAGGTCAGGAGG - Intergenic
1057746472 9:97756033-97756055 CATTTTACAGATAGGGAAGCTGG - Intergenic
1057847678 9:98538196-98538218 CATTTTACACAAGGGAAAAGTGG + Intronic
1058592221 9:106576925-106576947 CATTTTAGACAAAAGGGAATGGG + Intergenic
1058807352 9:108605218-108605240 TATTTAATACAAAGGGAATTTGG + Intergenic
1059091570 9:111364894-111364916 GTTTTTTCAAAAAGGGAAGTCGG + Intronic
1059338322 9:113583071-113583093 CATTTTACAGAAAAGGAAACAGG - Intronic
1059656058 9:116358488-116358510 CATTTTACAGATGGGGAAGCTGG + Intronic
1060489582 9:124072768-124072790 CATTTTACAGACAGGGAAACTGG - Intergenic
1061791727 9:133062722-133062744 CATTTTACAGAAGGGGAAACGGG + Intronic
1061795403 9:133083288-133083310 CATTTTACAGAAGGGGAAACGGG + Intronic
1186215062 X:7290775-7290797 CATTTTACAGAGAAAGAAGTGGG - Intronic
1186846587 X:13536708-13536730 CATTTCACACAAATGAAAGCAGG + Intergenic
1186955038 X:14672461-14672483 CATTTTACTCAAGAGGCAGTAGG + Intronic
1188670189 X:32872695-32872717 CAAGATGCACAAAGGGAAGTAGG + Intronic
1192921153 X:75707752-75707774 CATCTTAAACAAAGGAAAATAGG - Intergenic
1193202475 X:78708305-78708327 CATTTTACAAGTAGGGAAGTGGG - Intergenic
1193655461 X:84191379-84191401 CATTATATACAAAGAAAAGTTGG + Intergenic
1194187335 X:90789763-90789785 CATTTTTAACAATGAGAAGTTGG + Intergenic
1195288129 X:103405114-103405136 CATTTTACAGAACGGGACGCTGG - Intergenic
1195527745 X:105911373-105911395 CCTTTTACACAAATGGATGTGGG - Intronic
1195767768 X:108314770-108314792 CATTTTACAGATAGGAAAATTGG - Intronic
1196548920 X:116997937-116997959 CATTTTACACATAAGAAAATTGG - Intergenic
1197772282 X:130096910-130096932 CACTTTACAGATAGGGAAATTGG - Intronic
1198407315 X:136326368-136326390 CATTTTATACAAAAGGAAATAGG + Intronic
1198805382 X:140489140-140489162 CATTTTACAGATAAGGAAATTGG + Intergenic
1199113961 X:143968089-143968111 CATTTTACAGATGGGGAAGATGG + Intergenic
1200459209 Y:3433949-3433971 CATTTTAAAAAAAAGAAAGTTGG + Intergenic
1201673981 Y:16558557-16558579 TATTTTGCAAACAGGGAAGTTGG - Intergenic