ID: 1097037615

View in Genome Browser
Species Human (GRCh38)
Location 12:56134098-56134120
Sequence TACCCACCACAGCTGAAGAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 146}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097037605_1097037615 21 Left 1097037605 12:56134054-56134076 CCAAAACCAAAACCGAATCCCCC 0: 1
1: 0
2: 1
3: 13
4: 143
Right 1097037615 12:56134098-56134120 TACCCACCACAGCTGAAGAAGGG 0: 1
1: 0
2: 0
3: 6
4: 146
1097037610_1097037615 2 Left 1097037610 12:56134073-56134095 CCCCAAGATGGTGACCTCTGAAT 0: 1
1: 0
2: 1
3: 9
4: 126
Right 1097037615 12:56134098-56134120 TACCCACCACAGCTGAAGAAGGG 0: 1
1: 0
2: 0
3: 6
4: 146
1097037604_1097037615 27 Left 1097037604 12:56134048-56134070 CCTTCACCAAAACCAAAACCGAA 0: 1
1: 0
2: 4
3: 127
4: 733
Right 1097037615 12:56134098-56134120 TACCCACCACAGCTGAAGAAGGG 0: 1
1: 0
2: 0
3: 6
4: 146
1097037611_1097037615 1 Left 1097037611 12:56134074-56134096 CCCAAGATGGTGACCTCTGAATT 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1097037615 12:56134098-56134120 TACCCACCACAGCTGAAGAAGGG 0: 1
1: 0
2: 0
3: 6
4: 146
1097037606_1097037615 15 Left 1097037606 12:56134060-56134082 CCAAAACCGAATCCCCCAAGATG 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1097037615 12:56134098-56134120 TACCCACCACAGCTGAAGAAGGG 0: 1
1: 0
2: 0
3: 6
4: 146
1097037612_1097037615 0 Left 1097037612 12:56134075-56134097 CCAAGATGGTGACCTCTGAATTG 0: 1
1: 0
2: 0
3: 19
4: 111
Right 1097037615 12:56134098-56134120 TACCCACCACAGCTGAAGAAGGG 0: 1
1: 0
2: 0
3: 6
4: 146
1097037609_1097037615 3 Left 1097037609 12:56134072-56134094 CCCCCAAGATGGTGACCTCTGAA 0: 1
1: 0
2: 0
3: 17
4: 166
Right 1097037615 12:56134098-56134120 TACCCACCACAGCTGAAGAAGGG 0: 1
1: 0
2: 0
3: 6
4: 146
1097037608_1097037615 9 Left 1097037608 12:56134066-56134088 CCGAATCCCCCAAGATGGTGACC 0: 1
1: 0
2: 0
3: 12
4: 118
Right 1097037615 12:56134098-56134120 TACCCACCACAGCTGAAGAAGGG 0: 1
1: 0
2: 0
3: 6
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097037615 Original CRISPR TACCCACCACAGCTGAAGAA GGG Exonic
900352294 1:2240942-2240964 TACCCACCAAAGCTCAACCAGGG - Intronic
904511830 1:31017311-31017333 AACCTACTACAGATGAAGAAAGG + Intronic
905908761 1:41639543-41639565 GTCCCACCATAACTGAAGAAGGG - Intronic
906174677 1:43760816-43760838 AATACACAACAGCTGAAGAAGGG + Intronic
906258960 1:44371808-44371830 TATCCACCACATCAGAAAAAAGG + Intergenic
906705963 1:47895464-47895486 CTCCCACCACAGTTAAAGAAAGG + Intronic
911434021 1:97831688-97831710 CAACCATCACAGCAGAAGAAAGG + Intronic
911689399 1:100815124-100815146 ACCCAAACACAGCTGAAGAAAGG + Intergenic
916076952 1:161206587-161206609 CACCCCCCACACCTGAAGATAGG - Exonic
916965704 1:169940257-169940279 TCTTCACAACAGCTGAAGAAGGG - Intronic
918093452 1:181316543-181316565 TTCCTGCCACAGCTGAGGAAAGG + Intergenic
922383841 1:225061135-225061157 GGCCCACCACAGCTCAAGGAGGG - Intronic
922554772 1:226524253-226524275 TATCCTCCACATCTGGAGAAAGG - Intergenic
1070343941 10:75523561-75523583 TACCCACCACAGGTAGAGACTGG - Intronic
1074655897 10:115587255-115587277 AGCCCACCACAGCTCAAGGAGGG - Intronic
1075931832 10:126303731-126303753 AACCCACCACAGGTAAAGAGAGG - Intronic
1076199511 10:128547112-128547134 TGACTACCGCAGCTGAAGAAGGG - Intergenic
1079277802 11:19057964-19057986 TACCAACTACACATGAAGAAAGG + Intronic
1079985918 11:27200829-27200851 TACACACTTCAGCTGAAGAGAGG - Intergenic
1080199066 11:29647508-29647530 TACCCACCAGAGATGAAGCACGG + Intergenic
1082112537 11:48292943-48292965 AGCCCACCACAGCTCAAGGAGGG + Intergenic
1082117849 11:48346484-48346506 AGCCCACCACAGCTCAAGGAGGG + Intergenic
1083312088 11:61789093-61789115 CACCCACCACCCCTGCAGAATGG + Exonic
1085637635 11:78170653-78170675 TTCACACCACAGCTGCACAAGGG - Intergenic
1088957654 11:114626166-114626188 AGCCCACCACAGCTTAAGGAGGG + Intergenic
1088958796 11:114639093-114639115 AGCCCACCACAGCTCAAGGAGGG - Intergenic
1089495758 11:118908003-118908025 TTCCCACCAGAGCTCCAGAAGGG - Intronic
1089625572 11:119748801-119748823 TTCTCACCACAGCTTAGGAAAGG - Intergenic
1090599088 11:128351199-128351221 TACCCAGCACATCTAAAGAGTGG - Intergenic
1093664997 12:21801846-21801868 TAACACCCACAGCTGAGGAATGG - Intronic
1095179350 12:39129327-39129349 TACCCACTACATCTGTAGACAGG + Intergenic
1097037615 12:56134098-56134120 TACCCACCACAGCTGAAGAAGGG + Exonic
1100812399 12:98352252-98352274 TGCCAACCACAGCTCAAGACTGG - Intergenic
1101952713 12:109188838-109188860 TAAGTACCATAGCTGAAGAAAGG + Intronic
1105751532 13:23425654-23425676 TCCCCACCACATGTGCAGAAGGG - Intronic
1105794453 13:23836623-23836645 TAGCCAGCATAGCTGAAGACAGG - Intronic
1106735567 13:32585659-32585681 TCCCTGCCAGAGCTGAAGAAGGG - Intergenic
1107193127 13:37614017-37614039 TTCCCACCAGTGCTGAAAAAGGG + Intergenic
1107389991 13:39953845-39953867 AACCCACCAAAGTTGGAGAAAGG + Intergenic
1114694079 14:24610428-24610450 TCCCCACCTCAGCTTAAGGAGGG - Intergenic
1114922156 14:27345096-27345118 GACCCTCAAGAGCTGAAGAATGG - Intergenic
1115852296 14:37598209-37598231 TCCTCCCCACAGCTGAAGACAGG - Intronic
1121323097 14:93004163-93004185 TGCCCACCACAGGTGAGGGAGGG + Intronic
1126249628 15:46552502-46552524 TACTCAGCATAGCTGAAGAGTGG + Intergenic
1130877111 15:88024090-88024112 TCCCCACCACAGCTGGAAACTGG + Intronic
1131561480 15:93446975-93446997 TACCCAGAACAGTTCAAGAAAGG + Intergenic
1137006510 16:35279601-35279623 TAGCCACCATAGCTTTAGAAAGG - Intergenic
1137022402 16:35441653-35441675 ATCCCGCCACAGCTGTAGAAAGG - Intergenic
1138292733 16:55861741-55861763 TAAACACCACAGCTGGAGATGGG + Intronic
1139263799 16:65621321-65621343 TCCCCACCACAGCTGACCCAGGG + Intergenic
1143351858 17:6294583-6294605 TACCCAACAGAACTGAAGACAGG + Intergenic
1143607538 17:7998005-7998027 TACCCAAAACAACTGAAGGAAGG + Intergenic
1146267348 17:31461536-31461558 TATGCTCCAGAGCTGAAGAAAGG - Intronic
1151916863 17:77124536-77124558 GAACCACCACAGCTGAAAAAAGG - Intronic
1153719816 18:7890354-7890376 TAAACACCAAAGCTGCAGAATGG - Intronic
1159539485 18:69756763-69756785 TACACACCACAGTAGCAGAAAGG + Intronic
1164676387 19:30104375-30104397 TTTTCAGCACAGCTGAAGAAGGG + Intergenic
1164832936 19:31336595-31336617 GACCCACCAGAACTGTAGAAGGG + Intronic
1165585798 19:36915123-36915145 TACCCACCACACATGAGGAATGG + Exonic
1166563256 19:43747528-43747550 GACCCACGACAGCTGGAGATTGG + Exonic
1168404493 19:56103670-56103692 TACCCATCACAGCAGAAACAGGG + Intronic
928079823 2:28300942-28300964 TACTCAGTTCAGCTGAAGAATGG - Intronic
928876765 2:36049144-36049166 TACACAACACAGCTGATGAGTGG + Intergenic
931632339 2:64312329-64312351 TTCCCACAACAGCTAAATAAGGG - Intergenic
932769667 2:74493454-74493476 AACCCACCAAGGCTCAAGAAGGG + Exonic
932867206 2:75356171-75356193 TAACCATCACAGTTGAATAATGG + Intergenic
939186646 2:138868971-138868993 TCCACATCACAGCTGAAGAAGGG - Intergenic
941626453 2:167835547-167835569 AGCCCACCACAGCTCAAGGAGGG + Intergenic
944037331 2:195310602-195310624 TACCAACCACAGCAGAAATATGG + Intergenic
947493737 2:230617830-230617852 TCTCCATCACAGCTGAAAAAGGG + Intergenic
947866268 2:233399896-233399918 TACCAACAACAGCAGAAGCATGG - Intronic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1169502376 20:6173352-6173374 TACCAACCACCTATGAAGAAAGG - Intergenic
1170509818 20:17065088-17065110 CACCCACAGCAGCTGGAGAATGG - Intergenic
1171056077 20:21908373-21908395 TTCCTACCAAAGCTGGAGAATGG - Intergenic
1171093615 20:22310121-22310143 GAGCCACCACAGCTGACCAATGG + Intergenic
1174543352 20:51306823-51306845 TCCCCACCACAGCTGGAGGTGGG - Intergenic
1175664457 20:60846219-60846241 TTCCCACCACTCCTGAAAAAGGG - Intergenic
1175981998 20:62743346-62743368 TCCCCACCACAGCTGAGGCCAGG - Intronic
1178149059 21:29773383-29773405 TACCTAACATAGGTGAAGAAGGG - Intronic
1178670213 21:34583419-34583441 CACCCACCTCAGCTGGAGATAGG + Intronic
1181581360 22:23830079-23830101 TACTCACAATAGCTGAAAAATGG - Intronic
1182789657 22:32940039-32940061 TACACAACCCACCTGAAGAATGG - Intronic
1182823097 22:33236082-33236104 CAACCACCACAGCTGGAGAGAGG + Intronic
949179256 3:1107641-1107663 TAGCCACCACACCTGGAGCATGG - Intronic
949878147 3:8640486-8640508 TACCCACAAGAGAGGAAGAAAGG + Intronic
950191301 3:10978240-10978262 TTCTCCCCACTGCTGAAGAAAGG + Intergenic
951602107 3:24388007-24388029 TACCCATCATAGCTGTAGATAGG - Intronic
952104176 3:30050408-30050430 AGCCCACCACAGCTCAAGGAGGG + Intergenic
953184041 3:40621550-40621572 TCCCCACCACAGCTGAACATGGG - Intergenic
955829481 3:62986006-62986028 TACCCACCACAACTCAAAGAAGG - Intergenic
959860590 3:111210827-111210849 TGCCCACCATATTTGAAGAATGG + Intronic
961365937 3:126399205-126399227 TAAGCAACACAGGTGAAGAAGGG - Intronic
962524489 3:136224800-136224822 AGCCCACCACAGCTCAAGGAGGG + Intergenic
963256716 3:143152277-143152299 TACTCGCCTCAGCTGAAGCAGGG - Intergenic
967940080 3:194758908-194758930 TACCCAGAACAGCTGGAGCAAGG + Intergenic
972712370 4:41610201-41610223 TACAAACCACAGGAGAAGAAAGG - Intronic
977429203 4:96910086-96910108 TAGCCCCCAAAACTGAAGAAAGG - Intergenic
978395644 4:108276916-108276938 TACACACCAAAGCAGAAGAGAGG - Intergenic
979098523 4:116583773-116583795 AACCCATTGCAGCTGAAGAAAGG - Intergenic
980029187 4:127806361-127806383 TACCAAGCACAACTGAACAAGGG - Intronic
981464721 4:145055094-145055116 TACCCAAAAGAGCTGAATAAAGG + Intronic
983780412 4:171663436-171663458 AACCCACTGAAGCTGAAGAAGGG + Intergenic
988321708 5:29705960-29705982 TAACCACCCCAGCTGAAGCCAGG - Intergenic
990478345 5:56184053-56184075 CACCCTCCACATCTGGAGAACGG - Intronic
990665837 5:58070279-58070301 TACCCAACTGACCTGAAGAAAGG + Intergenic
992277134 5:75131529-75131551 AGCCCACCACAGCTCAAGGAAGG + Intronic
993006796 5:82437191-82437213 TACCCACCAAAAAGGAAGAAGGG - Intergenic
993134972 5:83949265-83949287 TACCCTCCAAAGCTGAAATAAGG + Intronic
996773376 5:127108729-127108751 AGCCCACCACAGCTCAAGGAGGG - Intergenic
996813310 5:127544506-127544528 AGCCCACCACAGCTCAAGGAGGG - Intronic
998626516 5:143852587-143852609 AGCCCACCACAGCTCAAGGAGGG + Intergenic
999278694 5:150350069-150350091 TACCCTCCACAGGTGGAGGAGGG + Intergenic
1000563241 5:162816483-162816505 TACCAACAACAACGGAAGAAGGG + Intergenic
1003670040 6:8148677-8148699 TACCAACCAAAGCTTTAGAAAGG - Intergenic
1003910332 6:10737757-10737779 TACCCACCTCAGCTGGCAAATGG + Intergenic
1004062758 6:12214330-12214352 TACACACCAGAGATGAAAAAAGG - Intergenic
1006719839 6:36142965-36142987 TGCCCCCCACAGCAGGAGAATGG - Intronic
1010732146 6:79402723-79402745 TGCCAATCACAGCTGCAGAAAGG - Intergenic
1010944872 6:81961993-81962015 TACCCACAACAGTTGAAAACAGG + Intergenic
1011111281 6:83839114-83839136 TCCCGATCACAGCTGAAGATTGG + Intergenic
1011386292 6:86801972-86801994 TAGCCACCACAGCTGGAAATAGG + Intergenic
1015953479 6:138576861-138576883 TACCCATCACTGCTGACAAAGGG + Intronic
1016617526 6:146069552-146069574 TACCAACTACAGCTGAAAACTGG - Intronic
1017520012 6:155194007-155194029 TACAGACCACACCTGGAGAAGGG + Intronic
1019739059 7:2663843-2663865 TACTCACCAAGGTTGAAGAAAGG + Exonic
1028412999 7:90551152-90551174 AGCCCACCACAGCTTAAGCAAGG - Intronic
1031231744 7:119115348-119115370 CACCCACCATAGCAGCAGAATGG - Intergenic
1033055378 7:138047833-138047855 TACAATCCACACCTGAAGAACGG + Intronic
1033609626 7:142953319-142953341 TTCACACCACACCTGAGGAATGG + Intronic
1034276539 7:149826332-149826354 TACCCCCCACAGCTGGGGCAGGG - Intergenic
1035370792 7:158377696-158377718 TACGCACGACAGCTGAAAAGTGG + Intronic
1039347404 8:36722770-36722792 GACTTACCCCAGCTGAAGAAAGG - Intergenic
1040850564 8:51897963-51897985 TACCCACCACACTTGGAGACTGG + Intronic
1042741953 8:72059038-72059060 AAGCCACCAGGGCTGAAGAAGGG + Intronic
1045279969 8:100741664-100741686 TCCCCACTACAGGTGATGAAGGG - Intergenic
1045456001 8:102379583-102379605 GACCAACCACATCTGTAGAATGG - Intronic
1046854065 8:119009118-119009140 AACCCAACACAGGTGAGGAAAGG + Intronic
1050458645 9:5858037-5858059 TACAGACCAGAGCAGAAGAAAGG + Intergenic
1053464248 9:38293617-38293639 TACCCCCTGGAGCTGAAGAAAGG + Intergenic
1056345139 9:85685819-85685841 TGACAATCACAGCTGAAGAATGG + Intronic
1057131212 9:92655838-92655860 CACCCACAGCAGCTGCAGAAGGG + Intronic
1058410725 9:104728061-104728083 AACCAAACACAGCAGAAGAAAGG + Intergenic
1058642989 9:107105285-107105307 TACCAAGCACAGCAGAAGGAAGG + Intergenic
1058964952 9:110028511-110028533 CAGCCACCACATCTGTAGAATGG - Intronic
1061969511 9:134036310-134036332 TGCCCCAGACAGCTGAAGAAAGG - Exonic
1186775826 X:12863916-12863938 AGCCCACCACAGCTCAAGGAGGG - Intergenic
1187697674 X:21937981-21938003 TACCAACCACAGCTGTAGCCTGG - Intergenic
1192771101 X:74192266-74192288 TATTCACCACAGCTGAAATATGG - Intergenic
1199107936 X:143894034-143894056 TACTCCCCACTGCTGAATAAAGG + Intergenic
1199143189 X:144335086-144335108 CACACCCAACAGCTGAAGAAGGG - Intergenic
1201527554 Y:14953261-14953283 AGCCCACCACAGCTCAAGGAGGG + Intergenic
1202064631 Y:20925481-20925503 AGCCCACCACAGCTCAAGGAGGG - Intergenic