ID: 1097038693

View in Genome Browser
Species Human (GRCh38)
Location 12:56141336-56141358
Sequence AGGTTGTTACATTTGGAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097038688_1097038693 9 Left 1097038688 12:56141304-56141326 CCGTGAGAACAAAGAAAACAGGA 0: 1
1: 0
2: 8
3: 68
4: 649
Right 1097038693 12:56141336-56141358 AGGTTGTTACATTTGGAATATGG 0: 1
1: 0
2: 2
3: 9
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097038693 Original CRISPR AGGTTGTTACATTTGGAATA TGG Intronic
901892879 1:12283143-12283165 AGGTTCTTATATTTAGAATCTGG - Exonic
904380226 1:30105702-30105724 AGGCTGTTTCATTTGGCAAAAGG - Intergenic
906089579 1:43167139-43167161 AGGTTGGTACATCTCTAATAGGG - Exonic
906285299 1:44583500-44583522 AGGTCAAAACATTTGGAATAGGG - Intronic
908051067 1:60231121-60231143 CCTTTGTTCCATTTGGAATATGG - Intergenic
908591001 1:65633237-65633259 AGATTTTTACATTTTGAAGAAGG + Intronic
908597579 1:65705078-65705100 AAGATGATAAATTTGGAATATGG + Intergenic
911471918 1:98329578-98329600 AGTTCGATAAATTTGGAATATGG - Intergenic
921275296 1:213513089-213513111 AGGTTCTTAAATATGGAAGAGGG + Intergenic
921573593 1:216807541-216807563 ATGTTTTTTCTTTTGGAATATGG + Intronic
924717526 1:246591408-246591430 AGGTTGTTTCATTGTAAATAGGG - Intronic
1063885621 10:10575261-10575283 AGGGTGTTAGATGTAGAATAAGG + Intergenic
1065641011 10:27782872-27782894 AGTTTGTGACAGTTGGAATCTGG + Intergenic
1066747679 10:38617079-38617101 AAATTGTTAGATTTTGAATATGG + Intergenic
1071760814 10:88604215-88604237 AGATGGTGACATTTGGAACATGG + Intronic
1078040048 11:7851901-7851923 AAGTTGGTACATTGGGAAGATGG + Intergenic
1078873522 11:15371521-15371543 AGATTGGTACAATTTGAATAGGG - Intergenic
1079530769 11:21449950-21449972 AGGTTGATAACCTTGGAATAAGG + Intronic
1081128896 11:39352231-39352253 AGGATGATCCATTTCGAATATGG - Intergenic
1085828655 11:79875789-79875811 AGGTTGTTTCATTAGGTTTAAGG - Intergenic
1086194342 11:84119122-84119144 AGGTTGTCACTTTTGCCATATGG - Intronic
1088221406 11:107574094-107574116 CAGTTGTTACATTTGTAAAATGG - Intergenic
1089211268 11:116804790-116804812 ATGTTGTTCCATTTTCAATATGG - Intergenic
1091677665 12:2503075-2503097 GTGTTGTTACATTTGAAATTGGG + Intronic
1092829561 12:12430507-12430529 AGGTTTTTACTTATGGAGTAGGG + Intronic
1092901973 12:13068338-13068360 AGGTTGCTGCAGTTGGAATCTGG - Exonic
1093181349 12:15970984-15971006 AGGTTGTAAGATTTGGAAAAAGG + Intronic
1093795590 12:23306692-23306714 AGGAAGTTAGATATGGAATAAGG - Intergenic
1093982747 12:25492918-25492940 ATGTTGGTACGTTTAGAATATGG - Intronic
1094793482 12:33942197-33942219 AGGTCCTTACATGTGGAAGAAGG + Intergenic
1097038693 12:56141336-56141358 AGGTTGTTACATTTGGAATATGG + Intronic
1098881668 12:75923808-75923830 AGGTTGTTATAAATGGAAAATGG - Intergenic
1099606406 12:84807350-84807372 AGGTTATTGAATTTGAAATAGGG + Intergenic
1099677765 12:85784917-85784939 AAGGAGTTACATTTTGAATATGG - Intergenic
1102759346 12:115371975-115371997 AGGTTGTTTCACTAGGCATATGG + Intergenic
1104770935 12:131363986-131364008 AGGTAGCTACAGTCGGAATATGG - Intergenic
1106947332 13:34843054-34843076 AGGATGTGACAATGGGAATAGGG + Intergenic
1109416929 13:62052174-62052196 AATTTCTTACATTTGGAAAAAGG + Intergenic
1109979493 13:69888273-69888295 AGGTTTTAACATATGGAATTTGG + Intronic
1109992799 13:70081254-70081276 AAGTTGTTAAATTTGTAGTAAGG - Intronic
1111234556 13:85391567-85391589 AGGTGGTACCATTTGGATTATGG + Intergenic
1112222086 13:97501268-97501290 AGGGTGCTAGATTGGGAATATGG + Intergenic
1114408593 14:22479322-22479344 ATGTTGGTACATTTCCAATAAGG + Intergenic
1115801424 14:36998362-36998384 AGTTTGACAGATTTGGAATACGG + Intronic
1116286709 14:42982944-42982966 AGGTTATTTGATTTAGAATATGG + Intergenic
1116860092 14:49988223-49988245 CTGTTGTCACATTTGGAAAATGG - Intronic
1118542784 14:66847994-66848016 AGATTGTTACATGTGAAAAAAGG - Intronic
1123953660 15:25311330-25311352 AGGTTGGAACATTTCAAATAAGG + Intergenic
1125309910 15:38367529-38367551 AGGTAGTTACTTCTGGAAAATGG + Intergenic
1126898948 15:53291563-53291585 AGGTTGGTACATTTGGAAGATGG - Intergenic
1134431233 16:14208535-14208557 AGGTTGATACTTCTGGAACATGG - Intronic
1134583034 16:15387880-15387902 AGGGTGCTACATGTGGAATGAGG - Intergenic
1136735134 16:32460508-32460530 AAATTGTTAGATTTTGAATATGG - Intergenic
1138096196 16:54213822-54213844 AGTTTGTTTCATTTGTAAAATGG + Intergenic
1139063575 16:63286188-63286210 AAGTTTTCACATTGGGAATATGG - Intergenic
1139161090 16:64509763-64509785 AGGTTATTACATTTGTGATGTGG + Intergenic
1140126273 16:72121431-72121453 AGGATGAGACCTTTGGAATAAGG - Intronic
1141406752 16:83801255-83801277 AGGATGTTACACTTGGAGTGAGG + Intergenic
1141491177 16:84374539-84374561 AGCTTGTGACATTTGGATTGGGG - Intronic
1203017945 16_KI270728v1_random:369084-369106 AAATTGTTAGATTTTGAATATGG + Intergenic
1203036280 16_KI270728v1_random:642242-642264 AAATTGTTAGATTTTGAATATGG + Intergenic
1149083340 17:52684519-52684541 AGATTGTTACATGTAGAATGGGG - Intergenic
1149237570 17:54610801-54610823 AGGTTGTTCAATGTGGAGTAAGG + Intergenic
1150166331 17:62947083-62947105 TGGTTGTTAGTTTTGAAATATGG + Intergenic
1151404628 17:73878410-73878432 AGGTTTTTCCATTTGCAAAATGG - Intergenic
1153175472 18:2367464-2367486 AGGTTGTTACATGAGGTTTAAGG + Intergenic
1155826809 18:30455358-30455380 AGTTTGTCATATTGGGAATAAGG - Intergenic
1157786122 18:50484371-50484393 AAATTGTTTCATTTGGAGTATGG + Intergenic
1157972628 18:52287753-52287775 AGGTTGTTTAATTTGAAAGAAGG - Intergenic
1158726335 18:59976233-59976255 ATGTTGCTACATGTGGAAAATGG - Intergenic
1160241973 18:77131537-77131559 ACGTTGTTGCAATTGGAAAACGG + Intronic
925556018 2:5132406-5132428 AGGTTCCTAAATTTGGAAAAGGG - Intergenic
925694357 2:6560104-6560126 AGGTTTTTAAATATGGAATGTGG + Intergenic
927060394 2:19413202-19413224 AGCTTGTTACACTAGGAAAAAGG + Intergenic
928513495 2:32023124-32023146 TGGTTGTCACAACTGGAATAAGG - Intronic
929220808 2:39463209-39463231 AAGTTGTTACATTTTGAGTAAGG - Intergenic
930136608 2:47908364-47908386 GGGTTGTTATATGTGGTATAAGG + Intergenic
930434381 2:51321968-51321990 AGGTTTTTACATCTGTAACATGG - Intergenic
931102117 2:59013852-59013874 AGATTGTTGGATATGGAATAGGG + Intergenic
934310644 2:91859219-91859241 AAATTGTTAGATTTTGAATATGG + Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
937132859 2:119526042-119526064 TGATTGATGCATTTGGAATAAGG + Intergenic
938556754 2:132431312-132431334 AGGATCTTACATCTGAAATAAGG - Intronic
941144449 2:161826763-161826785 AGGTATTTCCATTTGGAATATGG - Intronic
941226190 2:162851607-162851629 AGGTTGTTACCACTGTAATAAGG + Intergenic
941402730 2:165050568-165050590 TGATTGTTATATTTGGAAAATGG - Intergenic
943547314 2:189296623-189296645 AGGGATTTACATTTGGACTAAGG - Intergenic
944340700 2:198594683-198594705 AGGTGGTTATATGTAGAATATGG + Intergenic
1169347081 20:4837086-4837108 CAGCTGTTACATTTGGAAGATGG - Intergenic
1170840042 20:19917298-19917320 AGGTGCTTACATTTGCCATATGG - Intronic
1173120173 20:40281977-40281999 GGGTTTTTACATTTTGAATGAGG + Intergenic
1173622246 20:44445546-44445568 TGGTTGGTACATTGGGAAGAAGG - Intergenic
1174729204 20:52898230-52898252 AGGTATTCACATTTGGAATCTGG - Intergenic
1177098907 21:16875053-16875075 TGGTTTTTACATTTGAAAAAGGG + Intergenic
1177654608 21:24001676-24001698 AGATTGTAACATTAGGAATCTGG - Intergenic
1182039827 22:27229021-27229043 AGGCTGTTACCATTGGAAGAAGG + Intergenic
950467640 3:13164630-13164652 AGGTTGTCTCCTTTGTAATATGG - Intergenic
951766816 3:26208859-26208881 AGCTTGGCACATTTGGAACAAGG - Intergenic
952860669 3:37809944-37809966 AGGAAATTACATATGGAATATGG - Intronic
953076477 3:39575472-39575494 AGGTTGTGATAGTTGGAAAATGG + Intergenic
954210189 3:49092862-49092884 AGGTTGTTCCATTTTGTTTAAGG + Intronic
956059549 3:65335782-65335804 TGGTTGTCACATCTGGGATAGGG - Intergenic
957243002 3:77682945-77682967 TGGTTCTGACATTTGAAATACGG + Intergenic
958803184 3:98779852-98779874 TGGTTGTTACATTAAGTATATGG - Intronic
959649543 3:108738229-108738251 AGGCTGTTATATTAGAAATAGGG - Intergenic
960897892 3:122525214-122525236 AAATTGTTAAATTTGGAATATGG + Intergenic
964679631 3:159323189-159323211 AATTTGCAACATTTGGAATAAGG - Intronic
964703809 3:159597174-159597196 AGGTTGTAAAATATGAAATATGG + Intronic
965154326 3:165027570-165027592 ATGTTGTTGAATTTGGAATTTGG - Intronic
966048106 3:175578018-175578040 AGATTGGTAGATTTGGAATTAGG + Intronic
966379470 3:179329246-179329268 AGGTTGTTACATAGGGGAAATGG - Intronic
967256714 3:187600588-187600610 AAGTGGTTGCATTTGAAATAAGG + Intergenic
967780895 3:193438175-193438197 AGATAGTTACATTTGAAAAATGG + Intronic
972108134 4:35519571-35519593 AGGTTGATACATGTGCATTAGGG + Intergenic
973049452 4:45576878-45576900 AAGTTGTTTCCATTGGAATATGG + Intergenic
974059936 4:57023189-57023211 AGTTTGTAATATTTGGAATAAGG + Intronic
975172016 4:71243136-71243158 ATGTTGCTTCATTTGGAAAATGG + Intronic
977562366 4:98545428-98545450 AGATAGTTACATTTTGAATTAGG - Intronic
977943806 4:102887165-102887187 AAATTGTTAGATTTTGAATATGG + Intronic
979311493 4:119209341-119209363 AGAATGATTCATTTGGAATAAGG - Intronic
981554743 4:145980606-145980628 AGGGTGTGGCTTTTGGAATAAGG + Intergenic
981953200 4:150436363-150436385 AGGTTGTCCCAAATGGAATAAGG - Intronic
983691800 4:170479900-170479922 AGGTTGTAACCAGTGGAATAAGG - Intergenic
984252544 4:177351572-177351594 AGTTTGTTACATTTCTAAGAGGG + Intronic
984800946 4:183716786-183716808 ATGTTGATACATTTTGGATAAGG - Intergenic
987442118 5:17968548-17968570 AGGTTCTTAAATGTGGAAGAGGG - Intergenic
988452812 5:31360262-31360284 GGGATGATACATTTGGAATTTGG - Intergenic
990090091 5:52033897-52033919 AATTTGTTACATTTGGACAATGG + Intronic
992461069 5:76960716-76960738 AGGATCTTACATTTGGTACAAGG + Intronic
992599297 5:78381777-78381799 AGGTTGTTTCATTTGGTTAAGGG + Intronic
993726797 5:91378442-91378464 AGGTTTTTAAAATAGGAATAGGG - Intronic
994148924 5:96425745-96425767 ATGTTGTTACATTTGCAACATGG - Intronic
995107263 5:108388857-108388879 ATGTTATTACATTTGGGAGAAGG - Intergenic
996041048 5:118811585-118811607 AAATTGTTACCTTTGGAGTAAGG + Intergenic
997372201 5:133369283-133369305 AAGTTGTTACATTTGGCAGCTGG + Intronic
999768585 5:154757715-154757737 AGGTTGCTTCATTTGGAGGAGGG + Intronic
1000739766 5:164953555-164953577 AGGTTGTTACATTAATAATATGG - Intergenic
1003280617 6:4688066-4688088 AGGTTTTAAAATTTGGAATTTGG - Intergenic
1005368957 6:25109962-25109984 ATGTCGTGCCATTTGGAATATGG - Intergenic
1007272380 6:40648232-40648254 CTGTTGTTACATTTGCACTAAGG - Intergenic
1008644649 6:53501317-53501339 AGGTTGTCATATCTGGAATAAGG + Intronic
1011116081 6:83893923-83893945 AGGTAGTGACAATTGGAAGAAGG + Intronic
1012080126 6:94747350-94747372 AGGTTTTTATATCTGAAATACGG - Intergenic
1012818021 6:104049178-104049200 AGATTGTTATATTTGGTATGTGG - Intergenic
1013191541 6:107807919-107807941 AGGTTGTTAAATTTTGTAAACGG - Intronic
1014103310 6:117535737-117535759 ACGCTGTTACATTTGAAATGTGG - Intronic
1016242479 6:141946967-141946989 AGGGAGTAACATCTGGAATAAGG + Intergenic
1021537597 7:21722949-21722971 AGGCTGATACATTTGGAAACTGG - Intronic
1022993039 7:35726956-35726978 ATGTTGTTACCTTTGTAATTTGG + Intergenic
1026271026 7:68836988-68837010 AGGTTGTTTCATCTGTAAAATGG - Intergenic
1027649462 7:80847592-80847614 AGTTTGTTACGTTTGGAAAGGGG - Intronic
1028265060 7:88713558-88713580 AGGTTGTTACATTGGGAGTAGGG - Intergenic
1028555104 7:92114980-92115002 TAGTTGTTATATTTGAAATATGG - Intronic
1030927218 7:115473476-115473498 ATGTTGTTACATTTTCAACAAGG + Intergenic
1037152873 8:15659020-15659042 AAGTCTTTACATTTGTAATAGGG + Intronic
1038398917 8:27268123-27268145 AGGTTCTGGCACTTGGAATAAGG - Intergenic
1043911306 8:85867662-85867684 ATGTTGATACATTTTGGATAAGG - Intergenic
1043983054 8:86662651-86662673 AGTTTGCTACATTTGCAGTAGGG + Intronic
1044522132 8:93210977-93210999 AGGCTGTTTCATTTAGAAAAGGG - Intergenic
1047048555 8:121082877-121082899 AGGTGGTTACATTTTGGAAAGGG - Intergenic
1047053259 8:121137175-121137197 AGGTTGTTACAAATGCATTAAGG + Intergenic
1051671407 9:19514362-19514384 AAGTTGGTACATATGGCATATGG - Exonic
1051874454 9:21776641-21776663 AGGTTGGTAGATTTGGTAAAGGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1058422884 9:104849817-104849839 ATGTTGATACATGTGGAATCTGG - Intronic
1059204191 9:112448451-112448473 AACTTGTTACATTTTAAATATGG + Intronic
1059558468 9:115306929-115306951 AGGTTATTACATGTGTGATACGG - Intronic
1061020638 9:128012191-128012213 AGGTTGTCACATGTTGAATTTGG - Intergenic
1061222369 9:129259626-129259648 AGGTTCTTAAATGTGGAAGAGGG - Intergenic
1188244448 X:27823299-27823321 AAGATGTTACATAAGGAATATGG + Intergenic
1188656322 X:32701181-32701203 AGTCTGCTACATTTTGAATAAGG + Intronic
1188975729 X:36673028-36673050 AGGTTAATACACTTGGAACAAGG - Intergenic
1192138699 X:68630154-68630176 ATGTTGTGACCTTTGGAATCTGG - Intergenic
1192147084 X:68689139-68689161 ATGTTGTGACCTTTGGAATCTGG + Intronic
1194979939 X:100430032-100430054 AAGTTGTGAGATTTGGAATATGG + Intergenic
1201990333 Y:20016792-20016814 AGGTTATTACATCTGGATTCAGG - Intergenic