ID: 1097046128

View in Genome Browser
Species Human (GRCh38)
Location 12:56189126-56189148
Sequence AGGGCGCAGCAGTGGGGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 517
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 479}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097046113_1097046128 15 Left 1097046113 12:56189088-56189110 CCGGGGCCCGCCGGGCAGTAGAG 0: 1
1: 0
2: 1
3: 9
4: 142
Right 1097046128 12:56189126-56189148 AGGGCGCAGCAGTGGGGGCGGGG 0: 1
1: 0
2: 5
3: 32
4: 479
1097046114_1097046128 9 Left 1097046114 12:56189094-56189116 CCCGCCGGGCAGTAGAGAAAAAC 0: 1
1: 1
2: 1
3: 9
4: 337
Right 1097046128 12:56189126-56189148 AGGGCGCAGCAGTGGGGGCGGGG 0: 1
1: 0
2: 5
3: 32
4: 479
1097046115_1097046128 8 Left 1097046115 12:56189095-56189117 CCGCCGGGCAGTAGAGAAAAACA 0: 1
1: 0
2: 0
3: 10
4: 115
Right 1097046128 12:56189126-56189148 AGGGCGCAGCAGTGGGGGCGGGG 0: 1
1: 0
2: 5
3: 32
4: 479
1097046116_1097046128 5 Left 1097046116 12:56189098-56189120 CCGGGCAGTAGAGAAAAACAAGG 0: 1
1: 0
2: 1
3: 26
4: 313
Right 1097046128 12:56189126-56189148 AGGGCGCAGCAGTGGGGGCGGGG 0: 1
1: 0
2: 5
3: 32
4: 479

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097046128 Original CRISPR AGGGCGCAGCAGTGGGGGCG GGG Intronic
900023313 1:199946-199968 AGGGCGCAGCGGAGGGCGAGCGG - Intergenic
900032583 1:381810-381832 AGGCCACACCAGTGGGTGCGGGG + Intergenic
900053341 1:610872-610894 AGGCCACACCAGTGGGTGCGGGG + Intergenic
900087188 1:904284-904306 AGGACGCAGCAGAGGGTGGGGGG + Intergenic
900101803 1:965098-965120 CCGGCGCAGCAGTGTGGGTGTGG + Exonic
900103472 1:972473-972495 AGGGGGCAGCAGACCGGGCGTGG + Intronic
900192045 1:1355990-1356012 AGGGTGAATCAGTGGGGGAGGGG + Intronic
900192281 1:1356567-1356589 AGGGGGAATCAGTGGGGGAGGGG + Intronic
900226659 1:1536278-1536300 AGGGCACAGCAGCGGGGGGAAGG - Intronic
900244740 1:1631816-1631838 ACTGCCCAGCAGTGGGGGCTTGG + Intergenic
900308621 1:2022987-2023009 AGGCAGCAGCAGCGGGGTCGGGG - Intronic
900361304 1:2290280-2290302 AGGGAGCAGCTGTGAGGGTGTGG + Intronic
900405255 1:2490152-2490174 TGGGGGCAGCACTGGGGGCTGGG + Intronic
900741124 1:4331557-4331579 AGGGCTCAGCGGGGAGGGCGTGG - Intergenic
900996928 1:6127880-6127902 GGGGCACAGCAGGGAGGGCGGGG + Intronic
901058704 1:6461745-6461767 TGGGCGCAGCAGCGGGGCCTGGG + Exonic
901457431 1:9371296-9371318 AGGGGGCAGCAGGGGAGGAGTGG + Intergenic
901460840 1:9390715-9390737 AGTGTGGGGCAGTGGGGGCGTGG - Intergenic
901628950 1:10638950-10638972 AGGAGGCTGCAGTGGGCGCGGGG + Exonic
901631731 1:10651330-10651352 AGGGGGCTGGGGTGGGGGCGGGG + Intronic
901676583 1:10889040-10889062 CGGGCGCAGCAGGGGGTGCCAGG + Intergenic
902410045 1:16207098-16207120 AGGGCGCAGAGGAGGGGCCGGGG - Exonic
902504487 1:16930351-16930373 AGGGCGCAGCAGGGAGGGCCAGG + Intronic
902884666 1:19396105-19396127 AGGGTGCAGGAGTAGAGGCGGGG - Intronic
903284079 1:22266382-22266404 AGGGCAGAGCAGGGGAGGCGGGG + Intergenic
903332043 1:22601342-22601364 AGGGGGCAGCGGTGGCGGTGGGG + Exonic
903461869 1:23526003-23526025 AGGGGGCAGGAGTGGGGGAAGGG - Intronic
903648796 1:24910794-24910816 GGGAGGCAGCAGTGGGGGCCTGG - Intronic
904813721 1:33180821-33180843 ATGGCGGGGCCGTGGGGGCGGGG - Intronic
904831290 1:33307873-33307895 GTGGGGCAGCAGTGGGGGTGAGG - Intronic
904832172 1:33312257-33312279 AGGGCTCAGCACTGGGGAGGTGG - Intronic
904978197 1:34474585-34474607 AGGGCACAGCAGGGCAGGCGAGG + Intergenic
905249024 1:36636283-36636305 TGGGAGCAGCAGGGAGGGCGGGG - Intergenic
905308524 1:37034556-37034578 AGGGCGCAGGGGAGGGGGCTGGG - Intergenic
905378765 1:37544705-37544727 ACGGCGCTGGAGTGGCGGCGGGG - Intronic
905518368 1:38578662-38578684 AGCGCGCAGCCGAGGGCGCGGGG - Intergenic
905629860 1:39512407-39512429 ATGGAGCAGCGGTGAGGGCGGGG + Intronic
905667899 1:39773783-39773805 ATGGAGCAGCGGTGAGGGCGGGG - Intronic
905741259 1:40373645-40373667 AGTGCGGCGCGGTGGGGGCGGGG + Intronic
905977029 1:42183280-42183302 AGGGTGGAGCGGAGGGGGCGGGG + Intronic
906204508 1:43979661-43979683 GGGGCGCCGGAGTGGGGGCGGGG - Intronic
906240383 1:44239009-44239031 AGGGGGCAGCAGTGGGGAGAGGG - Intronic
907364013 1:53945445-53945467 AGGGAGCAACAGTGGAGGGGTGG - Intronic
907664053 1:56418589-56418611 TGGGGGTGGCAGTGGGGGCGCGG - Intergenic
907938115 1:59060957-59060979 TGGGAGCAGCAGTGGGAGCATGG - Intergenic
913485174 1:119327358-119327380 AGGGGGGCGCGGTGGGGGCGGGG - Intergenic
915315909 1:155029184-155029206 AGGGGGCTGCAGTGGGTGAGTGG + Intronic
915528474 1:156490207-156490229 GGGGCCCAGGAGTAGGGGCGTGG - Intronic
916138737 1:161675418-161675440 AGGGAGCAGCAGTGGGAGGATGG + Intronic
919220680 1:194624916-194624938 ATGGAGCCCCAGTGGGGGCGGGG + Intergenic
919606386 1:199689471-199689493 AGGAAGCAGAAGTGGGAGCGAGG - Intergenic
919880179 1:201895886-201895908 GGTGGGCAGCAGTGGGTGCGTGG + Intergenic
919914202 1:202129993-202130015 AGGGTGGTGCAGTGGGGGCTGGG - Exonic
919917032 1:202144997-202145019 AGGGCGCGGCAGTCGGGGACAGG - Intergenic
920080306 1:203368265-203368287 AAGGCGCGGGGGTGGGGGCGGGG + Intergenic
920271169 1:204765019-204765041 TGGGAGTAGCAGTGGGGGAGGGG + Intergenic
920978074 1:210804440-210804462 AAGACACAGCAGTGGGGGCTAGG + Intronic
920986855 1:210898663-210898685 AGGGGGCAGGCGTGGCGGCGGGG + Intronic
922730904 1:227948265-227948287 GGGGCGCTGCAGTGGGAGCTTGG + Intergenic
923506466 1:234609792-234609814 CGGGCGCGGCGGTGGGGGCTCGG + Intergenic
923517640 1:234710587-234710609 TGGGCGGGGCAGTGGGGGAGGGG + Intergenic
923647481 1:235838971-235838993 AGGGCGCAGGGGTGGGGGATAGG - Intronic
924294177 1:242568848-242568870 TGGGAGCAGCGATGGGGGCGTGG - Intergenic
924527192 1:244863490-244863512 AGGGCGCCGCGGTGAGGGTGGGG - Intronic
924646083 1:245878355-245878377 ATGGGGCAGCAAGGGGGGCGAGG + Intronic
1062890728 10:1057359-1057381 AGGCCGAAGCAAAGGGGGCGGGG - Intronic
1063606357 10:7526282-7526304 AGGGCCCAGCAGCGGGGCTGAGG - Intergenic
1065528099 10:26642956-26642978 ATGGGGCCGCTGTGGGGGCGGGG + Intergenic
1065983784 10:30930047-30930069 AGGGCTGAGGAGTGTGGGCGCGG - Intronic
1066220694 10:33334908-33334930 AGGCCGCAGGAGGGGAGGCGGGG - Intronic
1066963892 10:42243426-42243448 AAGTCGCGGCAGCGGGGGCGGGG - Intergenic
1066986899 10:42475971-42475993 GGGCCCCAGCGGTGGGGGCGGGG + Intergenic
1067432287 10:46252396-46252418 AAGGCACAACAGTGGGGCCGGGG + Intergenic
1067711853 10:48656324-48656346 AGGGTGCAGCAGCCGGGTCGGGG + Intergenic
1067781276 10:49209214-49209236 AGGGCCCAGGAGTGGGGTTGGGG - Intergenic
1069634736 10:69918218-69918240 AGGGGGCAGCAGGGGGCGGGGGG - Intronic
1069705941 10:70459057-70459079 AGGGTGAAGCAGTGGGTGGGCGG - Intergenic
1069771759 10:70904888-70904910 GGGGAGAAGCAGTGGGGACGTGG + Intergenic
1070312583 10:75284359-75284381 AGGGAGCAGCAGGCGGGGAGGGG + Intergenic
1070918573 10:80170056-80170078 AGGGGTCAGGAGTGGGGGTGGGG - Intronic
1071527419 10:86366525-86366547 AGGGCGCAGGGGCGGGCGCGCGG - Intergenic
1072520898 10:96229218-96229240 AGGGGGCAGCAGGTGGGGGGAGG - Intronic
1072707101 10:97688480-97688502 AGGGGGCAGGAGTGGAGGCAGGG + Intergenic
1072717454 10:97761171-97761193 AGGGCCCAGCACTGGGGGTTGGG + Intergenic
1072887114 10:99287482-99287504 TGGGAGCAGCAGTGGGTGTGAGG + Intergenic
1073041997 10:100614313-100614335 AGGGTGAAGGAGTGGGAGCGGGG - Intergenic
1074121583 10:110497765-110497787 GGGGCGGGGCAGCGGGGGCGAGG - Intergenic
1074443217 10:113496902-113496924 AGGAAGTACCAGTGGGGGCGGGG - Intergenic
1075645209 10:124092448-124092470 AGGGGACAGCAGTGGGGGCGGGG + Intronic
1076356422 10:129857016-129857038 AGAGCCCAGCAGTGGGGGAAGGG + Intronic
1076624499 10:131813076-131813098 AGGAAACAGCAGTGGGGGTGTGG - Intergenic
1076707865 10:132311617-132311639 GGCGCACTGCAGTGGGGGCGAGG - Intronic
1076801436 10:132832391-132832413 AGGCCACAGCATTGGGGGGGGGG - Intronic
1076830566 10:132992328-132992350 AGGAGGCAGCAGCGGGGGCGGGG + Intergenic
1077094314 11:792858-792880 AGGGCGCATTGGTGAGGGCGGGG - Exonic
1077106644 11:845156-845178 AGAGCACAGGTGTGGGGGCGAGG - Intronic
1077328945 11:1975634-1975656 AGGGCGCAGCAGGCAGGGCTGGG - Intronic
1077358570 11:2129800-2129822 TGGGGGCACAAGTGGGGGCGAGG + Intronic
1077553697 11:3215757-3215779 TGGGCTCAGCAGTGGGTGCCGGG + Intergenic
1078099395 11:8320808-8320830 GTGGGGCAGCAGGGGGGGCGGGG + Intergenic
1078659573 11:13276634-13276656 AGGGTGGAGTGGTGGGGGCGGGG - Intronic
1079318793 11:19432612-19432634 AGAGCGAGGCAGTGGGGGAGTGG + Intronic
1079689887 11:23405635-23405657 AGGACGCAGCGCTGGGGGCAGGG + Intergenic
1079867647 11:25756388-25756410 AGGCCACTGCAGTGGGGGCTCGG - Intergenic
1080385850 11:31810711-31810733 CCGGCGTAGCAGTGGGGGAGGGG + Intronic
1081173284 11:39894073-39894095 CGGGGGCAGCAGTGGGCGAGAGG - Intergenic
1081570414 11:44287133-44287155 AGGGCGGAGCAGTGGAGGACGGG - Intronic
1081705417 11:45180173-45180195 AGGGCGCAGGAATTGGGGCCTGG - Intronic
1083292196 11:61696430-61696452 GGGGAGGAGCAGTGGGGCCGGGG + Intronic
1083299363 11:61732259-61732281 AGGGCGCTGCAGAGTGGGTGTGG - Intronic
1083642696 11:64153938-64153960 AGGGGGCAGCTGCAGGGGCGTGG - Intronic
1083912635 11:65719238-65719260 TGGGAGCTGCAGTGGGGGCGGGG - Exonic
1084086176 11:66856411-66856433 AGGGCGGGGCGGCGGGGGCGGGG + Intronic
1084209782 11:67615579-67615601 AGAGGGCAGCAGTGGGGGCCTGG + Intergenic
1084383293 11:68826997-68827019 AGGGAGGAGGAGTGGGGGTGAGG + Intronic
1084519615 11:69655429-69655451 AGGGCTCAACAGTGGGGCCGGGG + Intronic
1084575398 11:69985542-69985564 CGGGCGCAGCCCTGGGCGCGGGG - Intergenic
1084973921 11:72786059-72786081 AGGGTGCAGCAGGCCGGGCGCGG + Intronic
1085041873 11:73331450-73331472 GGGGCCCAGGAGTGGGGGAGGGG - Intronic
1088256827 11:107911069-107911091 AGGGGGCAGCAATGGTGGGGAGG - Intronic
1088701742 11:112419313-112419335 AGGGTCCAGCAGTGGGGTCCAGG - Intergenic
1088797677 11:113277518-113277540 AGGGCCCAGCAGTGAGGGGCAGG + Exonic
1088916434 11:114231399-114231421 AGGGCTGAGCAGTTGGGGTGGGG - Intronic
1089297819 11:117480574-117480596 AGGGTGCGGCAGTGGAGGGGAGG + Intronic
1089556677 11:119319107-119319129 AGGACGCAGGAGTGGAGGCAGGG + Intronic
1090173469 11:124625815-124625837 AGGGCCCAGCACTGGGGCTGAGG + Exonic
1090352871 11:126118764-126118786 AGGTCGCAGGTGTGGGGGTGAGG + Intergenic
1090973622 11:131663564-131663586 AGGGAGCAGCAGTGAGTGCGAGG + Intronic
1202811924 11_KI270721v1_random:30813-30835 AGGGCGCAGCAGGCAGGGCTGGG - Intergenic
1091377012 12:31484-31506 AGGGCGCAGCGGAGGGCGAGCGG - Intergenic
1091449460 12:563327-563349 AGGGCGCAGGGGTGTGGGCAGGG - Exonic
1096191593 12:49623503-49623525 AGGCCGCAGCCGGGAGGGCGGGG - Exonic
1096510542 12:52125549-52125571 AGGGAGAAACAGTGGGGACGGGG - Intergenic
1096522825 12:52193663-52193685 AGGGGGCAGCAGTGGCGTCTGGG + Intergenic
1096530920 12:52242455-52242477 AGGGAGCAGGAGTGGGTGCTGGG + Intronic
1096811527 12:54173450-54173472 CGGGCGCAGCAGAGCGGGCGCGG + Intronic
1097046128 12:56189126-56189148 AGGGCGCAGCAGTGGGGGCGGGG + Intronic
1098357826 12:69627724-69627746 CAGGGGCAGGAGTGGGGGCGGGG - Intergenic
1101935576 12:109053517-109053539 TGGGGTCAGCAGTGGGGGAGGGG - Intronic
1103565695 12:121814326-121814348 TGGGGGCAGCGGTGGGGGCATGG - Exonic
1103828183 12:123757032-123757054 TGGGCGGGGCAGTGGGGGGGCGG - Intronic
1104892531 12:132147444-132147466 ATGGCCCCGTAGTGGGGGCGGGG + Intronic
1104965649 12:132507778-132507800 AGTGCCCTGCAGTGGGGGCCAGG - Intronic
1104980134 12:132570032-132570054 AGGGCGCGGCATGGGGCGCGGGG - Exonic
1105011984 12:132762018-132762040 CGGGCGCGGCAGGCGGGGCGCGG + Intergenic
1108747279 13:53408801-53408823 AGGGCCCAGAAGTGGGGTCGTGG + Intergenic
1109630174 13:65034603-65034625 TGGGAGCAGCAATGGCGGCGTGG - Intergenic
1111796864 13:92932588-92932610 AAGGAGCAGCAGTGGGGTGGAGG - Intergenic
1113794761 13:113050702-113050724 CGGGAGGAGCAGGGGGGGCGGGG + Intronic
1113920816 13:113908359-113908381 TGGGAGCAGAAGTGGGGGTGGGG - Intergenic
1116437670 14:44912532-44912554 AGGGCTGAGAAGTGCGGGCGTGG + Intergenic
1117460755 14:55942605-55942627 GGGGTGCAGAAGTGGGGGAGTGG - Intergenic
1119903621 14:78282371-78282393 AGGGAGAAGCACTGGGGGAGGGG - Intronic
1121667861 14:95686331-95686353 CGGGGCCGGCAGTGGGGGCGGGG - Intergenic
1121797908 14:96750959-96750981 AGGCCCCAGCAGTGGGGCAGAGG - Intergenic
1122232477 14:100313645-100313667 AGGGGGCAGGAGTGGGGGCGGGG + Intergenic
1122695007 14:103548236-103548258 TGGGGGCAGCAGTGGGGTTGGGG - Intergenic
1122885141 14:104707538-104707560 AGGGAGCAGGGGTGGGGGTGGGG - Exonic
1122947839 14:105021290-105021312 CGGGCGCAGGGGCGGGGGCGGGG - Intergenic
1122956436 14:105073651-105073673 TGGGGGCTGCAGTGGGGGCCTGG + Intergenic
1123040622 14:105488829-105488851 AGGGAGCTGCAGTGGGGTCCTGG + Intronic
1123898057 15:24848219-24848241 CGGGGGCGGCGGTGGGGGCGGGG + Intronic
1124393162 15:29278118-29278140 AGGGAGCTGCAGTGGGGTGGGGG - Intronic
1124596931 15:31098899-31098921 AGGTCTCAGCAGCGGGGGAGGGG + Intronic
1124600838 15:31131821-31131843 AGGGGGCAGCAGGGGGGTGGGGG - Intronic
1124942711 15:34232957-34232979 AAGGCGCGGGGGTGGGGGCGGGG + Intronic
1126766943 15:52019208-52019230 AGGGCGAGGAAGAGGGGGCGGGG - Exonic
1128052736 15:64677912-64677934 TGGGTGCAGAGGTGGGGGCGGGG + Intronic
1128323565 15:66708429-66708451 AGGGCGCAGCCATGTGGGAGTGG + Intronic
1129250905 15:74308505-74308527 AGGGCGGAGTCGAGGGGGCGGGG + Intronic
1129471655 15:75758803-75758825 GGGGGGCAGGAGTGGGGGGGCGG + Intergenic
1129743204 15:78000243-78000265 AAGGCCCAGCAGTGTGGGAGGGG + Intronic
1129842276 15:78751197-78751219 AAGGCCCAGCAGTGTGGGAGGGG - Intergenic
1131174392 15:90201114-90201136 GGGTCTGAGCAGTGGGGGCGGGG + Intronic
1131268894 15:90934884-90934906 AGAGCGCAGCAGCGAGAGCGCGG + Intronic
1132449908 15:101961510-101961532 AGGGCGCAGCGGAGGGCGAGCGG + Intergenic
1132745687 16:1435304-1435326 TGGGCCCTGCAGTGGGGACGAGG - Intronic
1132838574 16:1967108-1967130 AGGGGGCAGCTGTGGGGGTTAGG - Intronic
1132887568 16:2189382-2189404 GGGGCGGGGCAGCGGGGGCGGGG - Intronic
1133024489 16:2982043-2982065 ATGGAGCAGCAGTGTGGGGGAGG + Intergenic
1133223172 16:4327905-4327927 AGGGCCCAGGGGTTGGGGCGAGG - Intronic
1134094834 16:11412463-11412485 AGGTCTCAGCAGTGAGGGAGGGG - Intronic
1136496973 16:30650845-30650867 AGAGGGCGGGAGTGGGGGCGGGG + Intronic
1137655145 16:50153171-50153193 AGGGCGGGGCGGTGGGGGGGGGG + Intronic
1140456578 16:75109260-75109282 AGGGAGCAGCAGTGCAGGCCTGG + Exonic
1140759724 16:78099889-78099911 AGGGGGCCGCAGTGGGGCCGCGG + Intronic
1141418859 16:83899003-83899025 AGGGCGGGGCGGTGGGGGCGAGG - Intergenic
1141970347 16:87477756-87477778 AGGGGGATGCGGTGGGGGCGTGG - Intronic
1142120222 16:88383352-88383374 AGGGCGCAGGAGCGGGAGCCGGG - Intergenic
1142130687 16:88430352-88430374 GCGGCGCAGCAGAGGGGTCGGGG + Exonic
1142261036 16:89042540-89042562 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261046 16:89042573-89042595 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261056 16:89042606-89042628 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261066 16:89042639-89042661 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261076 16:89042672-89042694 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1143075884 17:4342902-4342924 GGGGCGCTGCAGTGGGAGAGAGG - Intronic
1143164585 17:4891584-4891606 TGGGCGTGGCAGTGGGTGCGGGG - Exonic
1143323369 17:6082272-6082294 AGGGAACACTAGTGGGGGCGCGG + Intronic
1145108534 17:20141051-20141073 AGGGGGCAGCAGGGAGGGAGGGG - Intronic
1145265143 17:21376468-21376490 AGGCGGCAGCAGTGGCGGTGTGG - Exonic
1145268076 17:21390042-21390064 ATGGGGCAGGAGTGGGGGCCTGG - Intronic
1146508023 17:33422339-33422361 AGGGTGGAGCTGTGGGGACGGGG - Intronic
1147752552 17:42745055-42745077 ACGGCGCAGGGGTGGGGCCGCGG - Intergenic
1147792492 17:43022173-43022195 GCAGCGCAGCAGTGGCGGCGAGG + Exonic
1148060123 17:44830298-44830320 TGCGCGCTGCGGTGGGGGCGGGG + Intronic
1148337453 17:46851385-46851407 AGGGCGGGGCAATGGGGGAGGGG + Intronic
1148820437 17:50356729-50356751 GGGGTGCAGCAGTGGCGGCATGG - Exonic
1148836567 17:50468838-50468860 TGGGGGCAGCAGCGGCGGCGGGG + Exonic
1150133522 17:62681743-62681765 AGGCCGCAGGAATGGGGGCAGGG - Intronic
1151749281 17:76027461-76027483 AGGGCACAGCCCTGAGGGCGGGG + Intergenic
1152068776 17:78125115-78125137 GGGGCGCAGCAGCGGCGGCATGG + Intronic
1152199822 17:78938820-78938842 AGAGGGCAGCAGTGGAGGTGAGG - Intergenic
1152352460 17:79791325-79791347 ACTTCACAGCAGTGGGGGCGGGG - Intergenic
1152617349 17:81344084-81344106 AGGGGGGAGCAGGAGGGGCGAGG + Intergenic
1152627484 17:81394181-81394203 CGGGAGCGGGAGTGGGGGCGGGG + Intergenic
1152655863 17:81518999-81519021 CGGGCACAGCAGGGCGGGCGTGG + Intronic
1152782386 17:82232045-82232067 AGGGCGCTGCACCGGGGGAGGGG - Intronic
1154210846 18:12377369-12377391 ACGGAGCAGCGTTGGGGGCGCGG + Intergenic
1154304049 18:13217981-13218003 GGGGCGCGGCAGGGGGCGCGCGG - Intronic
1154954818 18:21242880-21242902 AGGGCGCCGCGGAGGTGGCGGGG + Intronic
1157552432 18:48590817-48590839 AGGTCTCAGTGGTGGGGGCGGGG - Intronic
1157872985 18:51247446-51247468 AGGGTGGGGCAGTGGGGGCGGGG - Intergenic
1160025355 18:75211558-75211580 CGGGCGCAGCAGCGGGCGCTCGG - Intronic
1160578515 18:79870468-79870490 AGCGCGCAGCTCTGGGGGCACGG - Intronic
1160635348 19:71037-71059 AGGGCGCAGCGGAGGGCGAGCGG - Intergenic
1160659566 19:291654-291676 GGGGAGCAGCGGGGGGGGCGGGG + Intergenic
1160788446 19:912359-912381 CGGGCCCGGGAGTGGGGGCGCGG + Intronic
1160788516 19:912542-912564 CGGACCCAGGAGTGGGGGCGTGG + Intronic
1160824050 19:1071268-1071290 ATGGCGCAGCCGTCGGGGCGCGG - Intronic
1160969718 19:1762220-1762242 CGGGCGCAGCTGGGGGCGCGCGG - Intronic
1160991770 19:1863137-1863159 AGGGCGCGGCGCCGGGGGCGCGG + Exonic
1161431187 19:4233313-4233335 TGGGGGCGGCAGTGGGGGCGGGG + Intronic
1161482248 19:4516998-4517020 AGGCAGCTGCGGTGGGGGCGGGG - Intronic
1161510803 19:4670086-4670108 GGCGCGGAGCATTGGGGGCGGGG - Intronic
1161723400 19:5915627-5915649 AGGGAGCAGCAGTCCGGGTGCGG - Exonic
1161860282 19:6792737-6792759 GTGGGGCAGCAGTGGGGGCGAGG + Intronic
1161994387 19:7703605-7703627 AGGGAGCAGCTGTGGGGATGGGG - Intergenic
1162079102 19:8208531-8208553 GGGCAGCAGCAGTGGGGGCTGGG - Intronic
1162079353 19:8209295-8209317 GGGGCGGGGCCGTGGGGGCGGGG - Intronic
1162336427 19:10063497-10063519 AGAGCTCAGCAGTGAGGGCTGGG + Intergenic
1163159725 19:15457469-15457491 CGGGCGCAGCGCTGCGGGCGCGG - Exonic
1163426676 19:17244361-17244383 GGGGCCCAGCGGTGGGGGTGGGG - Intronic
1163428944 19:17255399-17255421 AGGTGGCAGCAGCGGGGACGAGG - Exonic
1163660026 19:18571484-18571506 AGGACGCAGGAGTCGGGGCTGGG - Intergenic
1165067960 19:33240066-33240088 AGGGAGGAGCAGTGGAGGCGGGG + Intergenic
1165079130 19:33297800-33297822 GTGGCGCAGCAAGGGGGGCGAGG + Intergenic
1165311283 19:35030663-35030685 AGGGGGGAGGAGGGGGGGCGCGG - Intronic
1165858520 19:38894467-38894489 TGGGCGCAGCACCAGGGGCGGGG + Intronic
1165946489 19:39445935-39445957 CGAGCGCAGCAGTGACGGCGAGG + Exonic
1166042890 19:40213949-40213971 AGAGCGCAGCAGTGAACGCGTGG - Exonic
1166218915 19:41353184-41353206 AGGGCGCAGTGGTGGAGGGGAGG + Exonic
1166529376 19:43533525-43533547 AGGGCGCAGGGGTTCGGGCGCGG + Intronic
1166786504 19:45370384-45370406 AGGGAGCAGCAGTGATAGCGAGG - Intronic
1166873148 19:45882830-45882852 AGGCCGCAGGGGTGGGGGCTGGG + Intergenic
1166876675 19:45901918-45901940 CGGGGGCAGGAGTGGGGGCGGGG + Intronic
1167348374 19:48960933-48960955 AGGGCGCGGTGGTGGGGGTGAGG - Exonic
1167472041 19:49680701-49680723 AGTGCGCAGCAGAGGGGCAGGGG - Intronic
1167613167 19:50517126-50517148 AGGGCGGAGGAGTGGGAGGGAGG + Exonic
1167636811 19:50660052-50660074 AGGGGGCAGCAGAGGGGGAATGG + Intronic
1168150949 19:54448445-54448467 AGGGCGCAGGGGAGGGGGCACGG - Intergenic
924987770 2:287757-287779 GGGGCGCGGCCGGGGGGGCGCGG - Exonic
926063625 2:9820345-9820367 TGGGGGCGGGAGTGGGGGCGGGG + Intergenic
927471839 2:23383561-23383583 GGGGAGCAGGAGTGGGGGGGAGG - Intergenic
927751453 2:25673710-25673732 GGGGCGCGGCCGCGGGGGCGGGG - Intergenic
928094138 2:28393638-28393660 AGCGCGCAGCAGCCGGTGCGCGG + Exonic
928171866 2:29009518-29009540 AGGATGCAGAGGTGGGGGCGGGG + Intronic
928389410 2:30897688-30897710 AGGGCTCAGCAGAGGAGGCCGGG + Intergenic
928983206 2:37156874-37156896 AGGGGGCAGCCGAGGGAGCGCGG - Intronic
930033628 2:47072637-47072659 CGGGGGCCGCAGTGGGGGTGGGG - Intronic
930034942 2:47079435-47079457 GGGGGGCAGCAGGGGGGGCCAGG + Intronic
930071341 2:47369139-47369161 CCGGCGCTGCAGTTGGGGCGCGG - Exonic
930198132 2:48529513-48529535 AGGGCCAAGCTGTGGGGGTGGGG - Intronic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
932043020 2:68319662-68319684 AGGGCGCAGCACTGGAGCGGGGG - Exonic
932469561 2:71944988-71945010 ATGGAGCAGCGATGGGGGCGGGG + Intergenic
932741307 2:74293060-74293082 AGGGTGAAGCAGAGGGGGCAGGG + Intronic
933157823 2:78993858-78993880 AGGGCGCTACAGTGGGGGCCGGG - Intergenic
933206359 2:79512748-79512770 AGGGCGGAGCTCTGGAGGCGCGG - Intronic
933789642 2:85873452-85873474 ATGGGGCAGCAGTGGGGACAAGG + Intronic
934467089 2:94273024-94273046 AAGCCGCGGCAGCGGGGGCGGGG + Intergenic
936392511 2:112087980-112088002 AGGGTGCAGCAGAGGAGGCTGGG - Intronic
936566134 2:113584010-113584032 AGGGCGCAGCGGAGGGTGAGCGG + Intergenic
937283693 2:120736844-120736866 AGAGCCCAGCAGAGGGGGAGGGG - Intronic
937343059 2:121104251-121104273 AGGGTGCAGGAGTGGGCGAGAGG + Intergenic
937368876 2:121284580-121284602 AGGGCACTGCAGAGGGCGCGAGG + Intronic
937504191 2:122517837-122517859 GAGGGGCAGCAGTGGGGGAGGGG - Intergenic
937907355 2:127058765-127058787 AGGGCGCTGCAGTGGGGGTGGGG + Intronic
937914155 2:127090678-127090700 AGGGCACAGCTGTGGGTGGGGGG + Intronic
937915867 2:127098430-127098452 TGGAGGCAGCAGTGGGGGCTGGG + Intronic
942303680 2:174586170-174586192 AGGGAGCAGCAGCTGAGGCGGGG + Intronic
942457040 2:176145371-176145393 TGGGGGCAGCAGTGTGGGTGTGG + Intergenic
942614060 2:177771463-177771485 AGGGCTCGGAAGTGGAGGCGTGG - Intronic
944908392 2:204285427-204285449 AGGAAGCAGAAGTGGGGGCCTGG + Intergenic
945428813 2:209740153-209740175 AGGGAGTAGCAGTGGTGGCATGG + Intergenic
946464427 2:219898657-219898679 AGACCACAGCAGTGGGGGGGTGG + Intergenic
946909038 2:224442541-224442563 AGGGCGCGGCAGAGGTGTCGCGG - Intergenic
947611981 2:231530309-231530331 AGGGCGCGGCAGCTGGGCCGGGG - Intronic
948487550 2:238290329-238290351 AGGGCGCAGCAGCCGGGCCTGGG - Intergenic
948940246 2:241191706-241191728 AGGGGACAGCAGGGTGGGCGGGG - Intronic
949027919 2:241774924-241774946 AGGGCTCTGCCATGGGGGCGTGG + Intergenic
1168794004 20:598881-598903 AGGGTGCATCAGAGGGGGCCAGG + Intergenic
1168883370 20:1225940-1225962 GGGGCGGAGCAGTGGGCGAGGGG - Intergenic
1169662744 20:7998429-7998451 AGGTGGCAGCAGTGGGGATGTGG - Intronic
1172386478 20:34537503-34537525 TGGGGTCAGCAGTGGGGACGGGG + Intronic
1172604928 20:36207799-36207821 GGGGAGCAGCGGTGGGGGCGGGG - Intronic
1173032872 20:39378612-39378634 AAGGAGCAGCCGTGGGGGTGAGG - Intergenic
1173185552 20:40837216-40837238 AGGGAGCAGGGGTGGGGGCCAGG - Intergenic
1174113641 20:48212804-48212826 AGGGCTGAGCAGTGGAGGTGAGG - Intergenic
1175337410 20:58205495-58205517 CGGGCGCAGACGTGGGGACGTGG - Intergenic
1175337502 20:58205874-58205896 CGGGCGCAGACGTGGGGACGTGG - Intergenic
1175337511 20:58205913-58205935 CGGGCGCAGACGTGGGGACGTGG - Intergenic
1175544145 20:59767330-59767352 AGTGGGCAGCAGTGGGGGGCTGG - Exonic
1175939116 20:62529774-62529796 CGGGAGCAGCAGTGGGGCCGTGG - Intergenic
1175975210 20:62707565-62707587 AGGGAGCAGGGGAGGGGGCGGGG + Intergenic
1176130751 20:63495827-63495849 AGGGCACAGCAGGCGGGGCTGGG - Intronic
1176148046 20:63574144-63574166 AGGGCGGAGGGGCGGGGGCGCGG - Intronic
1176204025 20:63878533-63878555 GGGCTGCAGCAGTGGGGGCAGGG - Intronic
1176233903 20:64045361-64045383 AGGGGGTTGCAGTGGGGGTGAGG + Intronic
1176260745 20:64178307-64178329 AGGGTGGAGCAGTGGGAGAGCGG - Intronic
1178707928 21:34889849-34889871 AGGGCCCGGCAGGGAGGGCGTGG - Intronic
1178916529 21:36708298-36708320 GGGGCGCAGCAGTCAGGTCGAGG + Intronic
1179555529 21:42173150-42173172 AGAGGGCAGCAGTGGCGGTGTGG + Intergenic
1179893362 21:44348961-44348983 AGGGCGCAGCTGCGGGTGTGTGG + Intergenic
1179950977 21:44708717-44708739 AGGGAGCAGCATTCGGGGAGGGG - Intronic
1180038681 21:45264665-45264687 AGGGCGGGGCAGTCGGGGTGAGG + Exonic
1180038692 21:45264690-45264712 GGGGCGGGGCAGTCGGGGCGAGG + Exonic
1180041635 21:45283241-45283263 GGGGTGCTGCAGGGGGGGCGGGG + Intronic
1180079504 21:45480329-45480351 TGGGGGCAGCAGAGGGGCCGTGG + Intronic
1180101676 21:45590583-45590605 AGGGCCCAGGACGGGGGGCGGGG + Intergenic
1180657421 22:17434640-17434662 GGGGAGCAGCAGGGGGGGTGCGG - Intronic
1180696069 22:17752312-17752334 AGCGGGTAGCAGTGGGGGCACGG + Intronic
1181534511 22:23534561-23534583 AGGGCAGACCAGTGGGGGCGGGG - Intergenic
1182003405 22:26939611-26939633 AGGGGGCAGCAGGGGGGCTGGGG - Intergenic
1182522672 22:30893130-30893152 AGTGCGCAGCTGAGGGGGGGTGG - Exonic
1183278994 22:36922316-36922338 AGGGTGCAGCAGTGAGGACAGGG - Intronic
1183284513 22:36953595-36953617 AGGGTGCAGCAGTGAGGAGGGGG + Intergenic
1183312389 22:37117697-37117719 AGGGCTCAGGAGTGGTGGTGTGG - Intergenic
1183331132 22:37222214-37222236 AGGGAGCAGCCGTGGGGACAAGG + Intergenic
1183358928 22:37373458-37373480 CGGGGGCAGCGGCGGGGGCGGGG - Exonic
1183478639 22:38050809-38050831 GGGTGGCAGCAGTGGAGGCGAGG - Intergenic
1183744461 22:39685011-39685033 AGGGCTCCGCTGTGGGGGTGGGG + Intronic
1183748980 22:39708613-39708635 AGGGGGGACCCGTGGGGGCGAGG - Intergenic
1184429024 22:44430425-44430447 AGGGCTCAGGAGTGGAGGCCAGG - Intergenic
1184462458 22:44646916-44646938 AGGGCCCAGCAGTGCAGGTGGGG + Intergenic
1184521323 22:44995917-44995939 AGGGCACAGCGGAGGGGACGTGG + Intronic
1184800299 22:46754901-46754923 AGGGGGTGGCAGTGGGGGTGGGG - Intergenic
1185292046 22:50032104-50032126 ATGGCGCTGCAGGGGGGACGAGG + Exonic
950168064 3:10816343-10816365 CGGCTGCAGCAGCGGGGGCGCGG + Exonic
950911975 3:16604821-16604843 AGCGCGTGGGAGTGGGGGCGGGG + Intronic
953157796 3:40390849-40390871 AGGGGGCAGAAGTTGGGGCAGGG - Intronic
953182397 3:40608224-40608246 GGAGCACAGCAGTGGGGGCATGG + Intergenic
953345563 3:42172507-42172529 AGTGTGCAGCAATGGGGGAGGGG - Intronic
953449038 3:42991039-42991061 AGGTGGAAGCAGTGGGGGTGGGG + Intronic
953939309 3:47077371-47077393 AGGGCACAGCAGGCCGGGCGTGG - Intronic
954371054 3:50169783-50169805 AGGTGGCATCAGTGGGGGCCAGG - Intronic
954391235 3:50269131-50269153 AGGAGTCAGCAGTGAGGGCGAGG - Intronic
954443472 3:50534304-50534326 GGGGCTCAGCAGAGGGGGCTGGG - Intergenic
954755861 3:52839364-52839386 AGGCTGCAGCAGTGGGGGCTGGG + Exonic
955189494 3:56747275-56747297 AGTGAGCAGCAGTGTGGTCGAGG - Intronic
955239366 3:57165454-57165476 AGGGCCAGGCTGTGGGGGCGGGG - Intronic
960047562 3:113212227-113212249 CGGGCGAAGAAGTTGGGGCGAGG + Intronic
961041874 3:123683445-123683467 AGGGAGCAGAACTGGGGGCTGGG + Intronic
961119506 3:124361796-124361818 TGGTGGCAGCAGTGGGGGTGGGG + Intronic
961119515 3:124361827-124361849 TGGTGGCAGCAGTGGGGGTGGGG + Intronic
961565146 3:127758233-127758255 AGGGCGGGGCAGTGGGGGCAGGG - Intronic
961780443 3:129317394-129317416 AGGGCACAGGAGTGGGGCTGGGG + Intergenic
962872088 3:139506218-139506240 AGGGAGCAGCAGAGAGGGAGAGG + Intergenic
963312256 3:143721745-143721767 AAGGCTCAGCAGTGGTGGAGAGG + Intronic
968077740 3:195825555-195825577 AGGGAGCTGCAGGGGAGGCGAGG - Intergenic
968133904 3:196208305-196208327 AGGGCGGGGCTATGGGGGCGGGG - Intronic
968589365 4:1449888-1449910 AGGGGGCCGGAGTGGAGGCGGGG + Intergenic
968620181 4:1600433-1600455 TGGGGGCAGCAGTAGGGGAGGGG - Intergenic
968620446 4:1601401-1601423 AGGGCTGAGCAGTCAGGGCGTGG + Intergenic
970333271 4:15004618-15004640 CCGGCGCAGCAGTGGGGACTGGG + Intronic
971330383 4:25676805-25676827 AGGGTGCAGAAGTGGGAGGGAGG - Exonic
972781764 4:42292408-42292430 TGGGAGCAGCAGTGGGTGCCTGG + Intergenic
979624025 4:122826749-122826771 AGGGAGGAGAACTGGGGGCGCGG + Exonic
979955739 4:126951689-126951711 AAGTACCAGCAGTGGGGGCGAGG + Intergenic
981582328 4:146262158-146262180 AGGGAGGAGAAGTGGGGGAGAGG - Intronic
982582502 4:157196446-157196468 AAGGGGCAGCAGTGGGAGTGAGG - Intergenic
984200431 4:176713982-176714004 AGGAAGCAGCAGTGGAGACGGGG + Intronic
984206327 4:176792348-176792370 CGGGGGCAGGGGTGGGGGCGCGG + Exonic
984964546 4:185128611-185128633 AGAGCGCAGCAGAGGCGGGGAGG + Intergenic
985566395 5:620477-620499 AGGGCGCAGGGCTGGGGCCGTGG + Intronic
985709048 5:1417918-1417940 TGGGTGCTGCAGAGGGGGCGGGG + Intronic
985789005 5:1915469-1915491 TGGGGGCAGCAGTGGGAGTGGGG - Intergenic
986018001 5:3774935-3774957 AGAGCTCAGCAGTTGGGGCCTGG - Intergenic
986190791 5:5494721-5494743 GGGGCGGAGCTGCGGGGGCGGGG - Intergenic
986663803 5:10082582-10082604 AATGCGGAGGAGTGGGGGCGGGG - Intergenic
986731298 5:10636758-10636780 AGGGTGCAGCAGAGGGAGAGAGG + Intronic
991584188 5:68186120-68186142 AGCGCACGGCGGTGGGGGCGGGG - Intergenic
997436801 5:133881516-133881538 GGGGCACAGAAGTGGGGGCAGGG + Intergenic
997659139 5:135576734-135576756 TGGGGGCAGGAGTAGGGGCGGGG - Intronic
997816893 5:137027970-137027992 AGGGCACAGCAGTTTGGGGGTGG - Intronic
998128995 5:139641765-139641787 AGAGTGCAGCAGTGGGGCTGTGG - Intergenic
999856554 5:155601000-155601022 AGGGGGCAGCAGTGGTGATGGGG - Intergenic
1000014565 5:157266069-157266091 CGGGCGGAGCAGCGGGGCCGGGG + Exonic
1001083441 5:168683667-168683689 TGCGCGCTGCAGTGGGGACGAGG - Intronic
1001193906 5:169654500-169654522 AGGGTCCAGCACTTGGGGCGTGG - Intronic
1001533257 5:172479700-172479722 AGGGAGGAGCAGTGGTGGTGGGG + Intergenic
1002081958 5:176742701-176742723 AGGGAGGAGCAGTGGGGGTGAGG + Intergenic
1002096954 5:176837120-176837142 TGGGAGCAGCAATGGGGGTGAGG - Intronic
1002446712 5:179294626-179294648 GGGAAGCTGCAGTGGGGGCGGGG - Intronic
1002741237 5:181437058-181437080 AGGCCACACCAGTGGGTGCGGGG - Intergenic
1003219390 6:4144908-4144930 AGGCCACAGCAGTGAGGGTGAGG - Intergenic
1003425584 6:5996349-5996371 AGGGCGGGGCAGAAGGGGCGAGG - Intergenic
1004090327 6:12494346-12494368 AGGAGGCTGCAGTGGGGGCGGGG - Intergenic
1005915279 6:30345599-30345621 ACTGCGGAGCATTGGGGGCGCGG + Intronic
1006317034 6:33297338-33297360 AAGGGGCTGCAGTGGAGGCGTGG + Intronic
1006665196 6:35688592-35688614 GGGGCGCCGCAGTGGGGCCGAGG + Intronic
1007286233 6:40749469-40749491 AGGGGGCAGCAGGGGTGGCAGGG - Intergenic
1007341037 6:41191763-41191785 AGGAGGCAGCAGTGAGAGCGTGG + Exonic
1007974583 6:46087468-46087490 AGGGCAGAGCAGTAGGGGCAGGG - Intergenic
1008652940 6:53581563-53581585 AGGGGCCAGCAGTGGGGGATAGG + Intronic
1013162544 6:107559970-107559992 AGGGGGCAGCAGTGGGGGAGAGG + Intronic
1013430294 6:110049471-110049493 AGGGAGGCGCAGTGGGGGAGGGG + Intergenic
1013498198 6:110719984-110720006 AGGCCGAAGCAGGGGGGGGGTGG - Intronic
1014095812 6:117459731-117459753 AGGGGGCAGCAGTGGTGAAGTGG - Intronic
1017824587 6:158071908-158071930 AGGGCTCAGCGCTGGGGGAGGGG + Intronic
1017872933 6:158502212-158502234 TGGGGGCGGCAGAGGGGGCGGGG - Exonic
1018984541 6:168626239-168626261 AGGGAGCAGAAACGGGGGCGCGG - Intronic
1019319359 7:408648-408670 TGGGGACAGCAGTGGGGGTGGGG + Intergenic
1019408713 7:897506-897528 GGGGCCCAGCATTGGGGGGGTGG + Intergenic
1019411208 7:907580-907602 AGGGAGCAGAAGTGGGAGCGGGG - Intronic
1019704293 7:2490140-2490162 TGGGAGCAGCAGTTGGAGCGGGG - Intergenic
1019889729 7:3936840-3936862 AGGAGGCAGCAGTAGGGGTGGGG + Intronic
1020086355 7:5312811-5312833 AAGGGCCAGCCGTGGGGGCGGGG + Exonic
1021958859 7:25852743-25852765 TGGGCGCTGGGGTGGGGGCGGGG + Intergenic
1022101845 7:27173702-27173724 AGGGCGCAGCCGTCGGGCGGCGG + Exonic
1022505805 7:30908124-30908146 AGGGTTCAGAAGTGGGGGTGGGG + Intergenic
1023849510 7:44142210-44142232 AGGGCACAGCAGAGGGGCTGGGG + Intergenic
1025207953 7:57004261-57004283 AAGGGCCAGCCGTGGGGGCGGGG - Intergenic
1025663997 7:63572614-63572636 AAGGGCCAGCCGTGGGGGCGGGG + Intergenic
1027940640 7:84674628-84674650 AGGAAGCAGCAGTGGTGGAGTGG - Intergenic
1028762311 7:94509842-94509864 ACGGCGGAGCAGCGGCGGCGGGG + Exonic
1029406078 7:100374668-100374690 AGGCCTGAGGAGTGGGGGCGGGG - Intronic
1029680037 7:102102153-102102175 AGGGCACAGCAGAGGGGACTGGG - Intronic
1030083487 7:105797755-105797777 AGGGCGCACCAGGAGGGGAGAGG - Intronic
1031966373 7:128031016-128031038 AGGGGGAAGTGGTGGGGGCGGGG + Exonic
1032016894 7:128385804-128385826 AGGAGGCAACAGTGGGGGCTAGG + Intergenic
1033223622 7:139544439-139544461 AAGGCGAAGCGGTGGGTGCGTGG + Exonic
1034499245 7:151439567-151439589 AAGCCGCAGCAGTGGGGCGGAGG + Intronic
1034897340 7:154886014-154886036 CGCTGGCAGCAGTGGGGGCGAGG + Intronic
1035185567 7:157123300-157123322 AGGGGGCAGCAGGGAGGGGGCGG - Intergenic
1035385934 7:158472854-158472876 GGGAGGCAGCAGTGGCGGCGGGG + Intronic
1035388518 7:158490079-158490101 CGGGAGCAGCAGCGGGGCCGGGG + Intronic
1035399463 7:158555401-158555423 AGGGCAGAGCGGTGGGGGCGAGG - Intronic
1036701542 8:11016567-11016589 AGGGCGGCGCTGTCGGGGCGCGG - Intronic
1036768663 8:11564449-11564471 AGGGCGCAGAGGCGGGGACGCGG - Exonic
1036770891 8:11577754-11577776 AGGGCCCAGCAGTGGAGCTGGGG + Intergenic
1036816526 8:11906641-11906663 TGGGGGCAGAAGTGGGGGCCTGG + Intergenic
1037562707 8:20089010-20089032 TGGGGGCAGGGGTGGGGGCGGGG + Intergenic
1037988101 8:23302201-23302223 AGGGTGCGGCAGTGGGGCCATGG - Intronic
1038239414 8:25794848-25794870 AGGGCACACTGGTGGGGGCGGGG - Intergenic
1038268242 8:26052228-26052250 GGGGTGCGGCAGTGGTGGCGGGG + Intergenic
1038334459 8:26635071-26635093 AGGCCGCAGCAGTGGAGCAGAGG - Intronic
1038407150 8:27330625-27330647 AGGGGGCGGCAGAGGGGGAGGGG + Intronic
1038734480 8:30156559-30156581 GGGGCGACGGAGTGGGGGCGGGG + Intronic
1039434904 8:37553372-37553394 AGGTCTCAGCAGTGGGGCCTTGG - Intergenic
1039683993 8:39776321-39776343 AGGGAGCAGCAGTGCGGGAATGG + Intronic
1039873617 8:41567410-41567432 GGGGCGCAGCAGCCCGGGCGTGG - Intergenic
1040519112 8:48160087-48160109 AGTGTGCAGCACTGGGGGCCAGG - Intergenic
1041682591 8:60608456-60608478 AGGGAGCAGGACCGGGGGCGGGG - Intronic
1042721352 8:71830151-71830173 AGAGCCCAGCAGTGGAGGCAGGG - Intronic
1043542817 8:81281433-81281455 GGGGCGCCGCAGTGGGCGGGTGG + Intronic
1044761157 8:95519047-95519069 GGGGGGCGGCGGTGGGGGCGCGG + Intergenic
1045305506 8:100952999-100953021 TGGGCGCCGAGGTGGGGGCGAGG + Intronic
1045336154 8:101205756-101205778 AGGGCGCAGGCGTGCGAGCGGGG - Intronic
1045516271 8:102863543-102863565 GAGCCGCAGCAGTTGGGGCGAGG - Intronic
1046064333 8:109178581-109178603 AGGGGGTAGAAGTGGGGGCAAGG + Intergenic
1049379586 8:142305339-142305361 AGGGCGCAGGGGTGGGAGGGGGG + Intronic
1049400448 8:142424432-142424454 AGGACACAGCAGCGTGGGCGAGG + Intergenic
1049540627 8:143207255-143207277 AGGGCCCAGCAGGGGTGGCAGGG - Intergenic
1049595167 8:143480084-143480106 AGGTAGCAACAGTGGGGGCCGGG + Intronic
1049803855 8:144530222-144530244 AGGGCACAGCAGCGGCGGGGAGG - Exonic
1049804163 8:144531425-144531447 AGGGAGCAGCAGGTGGGGAGTGG + Intronic
1049804189 8:144531543-144531565 AGGGAGCAGCAGGTGGGGAGTGG + Intronic
1049804203 8:144531602-144531624 AGGGAGCAGCAGGTGGGGAGTGG + Intronic
1049804230 8:144531720-144531742 AGGGAGCAGCAGGTGGGGAGTGG + Intronic
1049804244 8:144531779-144531801 AGGGAGCAGCAGGTGGGGAGTGG + Intronic
1049804270 8:144531897-144531919 AGGGAGCAGCAGGTGGGGAGTGG + Intronic
1049804310 8:144532074-144532096 AGGGAGCAGCAGGTGGGGAGTGG + Intronic
1052998790 9:34565933-34565955 AGAGGGCAGCAGTTGGGGTGGGG + Intronic
1056659525 9:88534391-88534413 AGGGCGCGGGAGTGTGGGCGGGG + Intergenic
1056659610 9:88534647-88534669 AGGGCGCGGGAGTGTGGGCGGGG + Intergenic
1056659743 9:88535094-88535116 AGGGCGCAGGAGTGTGGGCGGGG + Exonic
1056807602 9:89740982-89741004 AGGGGGCAGGGGTGGGGACGGGG - Intergenic
1057305226 9:93908421-93908443 AGGGCCCTGAAGTGGGGGAGAGG + Intergenic
1057758552 9:97854847-97854869 GGGCGGCAGCAGTGGCGGCGTGG + Exonic
1058467512 9:105244458-105244480 ACGGCGCTGCACTGGGGGCGGGG + Intergenic
1058989217 9:110239035-110239057 AGGGCACAGCAATGGAGGGGAGG - Intergenic
1061019118 9:128002557-128002579 CAGGCAAAGCAGTGGGGGCGGGG - Intergenic
1061231677 9:129319249-129319271 GGGGTGCAGCAGAGGGGGCCAGG - Intergenic
1061832470 9:133304556-133304578 AGGGCGCTGCAGGGGGGCCCGGG - Intergenic
1061954707 9:133955601-133955623 AGGGGGGAGGAGTGGGGGTGTGG - Intronic
1062216151 9:135390834-135390856 AGGGGGCAGCCATGGGGGCAGGG + Intergenic
1062245727 9:135565176-135565198 AGAGCGGAGCAGAGGGGGCCGGG + Intronic
1062340287 9:136091020-136091042 AGGGCCCCGCACTGGGGGAGGGG + Intronic
1062399465 9:136366098-136366120 AGGGCCCAGCAGAGGGGTCCTGG - Intronic
1062423838 9:136497076-136497098 GGAGGGCAGCAGTGGCGGCGAGG + Exonic
1186426092 X:9465205-9465227 AGGGCGCTGCGGCGGCGGCGGGG - Exonic
1187153751 X:16705065-16705087 TGGGCATAGCAGTGGGGGAGAGG + Intronic
1188168601 X:26892905-26892927 AGGTGGCAGCAGCGGGGGGGGGG - Intergenic
1189239659 X:39515706-39515728 AAGGGGCTGCAGTGGGGGCAGGG - Intergenic
1189778301 X:44489883-44489905 AGTGCGCAGGGGTGGGGACGTGG - Intergenic
1190248447 X:48705797-48705819 AGGACCCAGCAGGGAGGGCGTGG - Intronic
1190712641 X:53081486-53081508 AAGGGGCAGAAGTGGGGGTGAGG + Intergenic
1190712742 X:53081747-53081769 AAGGGGCAGCAGTGGGGGATGGG + Intergenic
1190852290 X:54257343-54257365 TTGGCCCAGCAGTGGGGGCCAGG + Intronic
1192546508 X:72018763-72018785 AGGGCGCTGCAGTGCGGCTGCGG + Intergenic
1192795188 X:74420610-74420632 AGGTGGCACCAGTGGGGGCCGGG - Intergenic
1195884594 X:109625323-109625345 AGGGGACAAGAGTGGGGGCGAGG + Intronic
1198047132 X:132913969-132913991 AGGGAGCAGGAGAGGGGGAGAGG - Intronic
1199832938 X:151562802-151562824 AGGGGGCAGCGGGGGGGGCGGGG + Intergenic
1199967214 X:152830620-152830642 AAGGCGCAGGAGAGGCGGCGTGG + Intronic
1200310346 X:155071341-155071363 GGGGCGGGGCTGTGGGGGCGAGG - Exonic
1200310351 X:155071355-155071377 CGGGCGGGGCTGTGGGGGCGGGG - Exonic