ID: 1097047426

View in Genome Browser
Species Human (GRCh38)
Location 12:56197621-56197643
Sequence CTGACTAAACACATCTATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 128}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097047417_1097047426 26 Left 1097047417 12:56197572-56197594 CCTGGCCCCTAGCTTCTTGTTCT 0: 1
1: 1
2: 2
3: 36
4: 388
Right 1097047426 12:56197621-56197643 CTGACTAAACACATCTATGTGGG 0: 1
1: 0
2: 1
3: 8
4: 128
1097047422_1097047426 -8 Left 1097047422 12:56197606-56197628 CCATGTTTCCATTTCCTGACTAA 0: 1
1: 0
2: 5
3: 37
4: 337
Right 1097047426 12:56197621-56197643 CTGACTAAACACATCTATGTGGG 0: 1
1: 0
2: 1
3: 8
4: 128
1097047418_1097047426 21 Left 1097047418 12:56197577-56197599 CCCCTAGCTTCTTGTTCTTAAGC 0: 1
1: 0
2: 0
3: 6
4: 166
Right 1097047426 12:56197621-56197643 CTGACTAAACACATCTATGTGGG 0: 1
1: 0
2: 1
3: 8
4: 128
1097047420_1097047426 19 Left 1097047420 12:56197579-56197601 CCTAGCTTCTTGTTCTTAAGCTC 0: 1
1: 0
2: 1
3: 15
4: 181
Right 1097047426 12:56197621-56197643 CTGACTAAACACATCTATGTGGG 0: 1
1: 0
2: 1
3: 8
4: 128
1097047419_1097047426 20 Left 1097047419 12:56197578-56197600 CCCTAGCTTCTTGTTCTTAAGCT 0: 1
1: 0
2: 2
3: 20
4: 233
Right 1097047426 12:56197621-56197643 CTGACTAAACACATCTATGTGGG 0: 1
1: 0
2: 1
3: 8
4: 128
1097047421_1097047426 -3 Left 1097047421 12:56197601-56197623 CCAGACCATGTTTCCATTTCCTG 0: 1
1: 0
2: 0
3: 17
4: 290
Right 1097047426 12:56197621-56197643 CTGACTAAACACATCTATGTGGG 0: 1
1: 0
2: 1
3: 8
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097047426 Original CRISPR CTGACTAAACACATCTATGT GGG Intergenic
901282996 1:8053746-8053768 TTGACTAAACACATATTTATTGG - Intergenic
902322238 1:15676042-15676064 CTGATTCAACACAATTATGTTGG - Intergenic
902881856 1:19376819-19376841 CTGAGTAAATAAATCGATGTTGG + Intronic
903736348 1:25532081-25532103 CTGCCTAAACACAGCTGTGTGGG + Intergenic
905246111 1:36615117-36615139 CTTTGTACACACATCTATGTCGG - Intergenic
911003453 1:93192368-93192390 CTGAGTATATACTTCTATGTAGG - Intronic
916396825 1:164399720-164399742 GTGACAAAAAACATCTATTTGGG + Intergenic
918415557 1:184302955-184302977 CTGAATAAACAACTCTAGGTTGG + Intergenic
920407105 1:205723682-205723704 CTGATTAAATAGATCTAAGTGGG - Intronic
923979681 1:239308084-239308106 TTGCTTAAACAGATCTATGTTGG - Intergenic
924487946 1:244505647-244505669 CTGACTAATAACATGTATGCTGG - Intronic
924835932 1:247647434-247647456 CTCACAAAACACATCAAAGTGGG - Intergenic
1067049465 10:43004192-43004214 CTGAATAAATAAATCAATGTGGG - Intergenic
1070525326 10:77291457-77291479 CTGCCTAAACTGATTTATGTGGG - Intronic
1071061871 10:81579807-81579829 GTGCATAAACACATATATGTAGG - Intergenic
1074012371 10:109495549-109495571 CTCAATAAAAACATCAATGTAGG + Intergenic
1075342123 10:121655516-121655538 TTGAACAAACACATCTCTGTGGG - Intergenic
1076083224 10:127602465-127602487 CTGTCCAAGCACATCTATATAGG - Intergenic
1078579434 11:12527119-12527141 CTTACTAAACCCAGCTATGCTGG - Intronic
1079795880 11:24802400-24802422 CTGTATAGACACATTTATGTTGG + Intronic
1086796791 11:91115124-91115146 CATACTAAACCCTTCTATGTGGG - Intergenic
1088749756 11:112833826-112833848 CTGAGTCAATACATCTGTGTTGG + Intergenic
1088891243 11:114046332-114046354 ATGACTATACACACCTGTGTGGG + Intergenic
1089717841 11:120380800-120380822 CTGAATAAACAGATAAATGTGGG - Intronic
1090368966 11:126233518-126233540 CTGCCTTAACACAACCATGTAGG - Intronic
1091767428 12:3130688-3130710 CTGACTCTGCACATCTCTGTGGG - Intronic
1093528747 12:20135918-20135940 TTGCCTGAACACATCTATGGGGG + Intergenic
1094491129 12:30961413-30961435 CTGACTAACCACATGATTGTGGG - Intronic
1097047426 12:56197621-56197643 CTGACTAAACACATCTATGTGGG + Intergenic
1098915862 12:76256256-76256278 CTGAATAAAGACATCTCTTTTGG + Intergenic
1102841042 12:116122512-116122534 ATCACTTAACAAATCTATGTTGG + Intronic
1106116463 13:26821784-26821806 CTGCCTACACGCATCTAGGTTGG - Intergenic
1107084274 13:36408831-36408853 CTGATAAAACACATGTATTTGGG - Intergenic
1112976367 13:105323527-105323549 CAGATCATACACATCTATGTAGG - Intergenic
1114388917 14:22284520-22284542 CTGAGTTAACACAACTATGGAGG - Intergenic
1116056925 14:39875557-39875579 CTGACTACATACATCTCTTTAGG - Intergenic
1119117830 14:72043503-72043525 CTGAATATAGAAATCTATGTTGG + Intronic
1120062095 14:79996033-79996055 CTGTCATCACACATCTATGTGGG - Intergenic
1123964839 15:25444584-25444606 CTGACATAACACATATGTGTTGG - Intergenic
1125430255 15:39586754-39586776 CTGACTTAACATATCTGGGTAGG - Intronic
1127744637 15:61954310-61954332 CTGATGAAAAAAATCTATGTGGG - Intronic
1128528769 15:68430648-68430670 CTGTCTAAACACACCTAAATGGG + Intronic
1129969259 15:79762943-79762965 CTGACCACATACATCTAAGTGGG - Intergenic
1135069669 16:19340883-19340905 CTGACCAAACAGCTGTATGTTGG - Intergenic
1138132168 16:54489668-54489690 TTGACTGAACACATCTGTGCTGG - Intergenic
1143645872 17:8229765-8229787 CTGACTCAACACATCTTGTTGGG + Intronic
1151029515 17:70720325-70720347 CTTACCAATTACATCTATGTTGG - Intergenic
1152432277 17:80255452-80255474 CGGACCAAACAATTCTATGTTGG + Intergenic
1156154412 18:34284565-34284587 ATGTCTAAACACCTGTATGTAGG + Intergenic
1158758460 18:60355275-60355297 CTGACTCACTACATCTGTGTGGG - Intergenic
1159942999 18:74422894-74422916 ATGACTAAACACATCCTTTTAGG - Intergenic
1162052606 19:8043776-8043798 CTGACTAAATACATCTATTCAGG + Intronic
1164830435 19:31315948-31315970 GTGACTAAACCCTTCTCTGTGGG - Intronic
926676339 2:15625140-15625162 CTGAGTAAACACAGCAATGATGG + Intronic
928860140 2:35847428-35847450 ATGATTAATCACATCTATGAAGG + Intergenic
928901811 2:36326461-36326483 CTGTTTAAAGACATCTGTGTGGG + Intergenic
933101025 2:78257811-78257833 TTGACTAAACATATCTTGGTTGG - Intergenic
934031454 2:88051818-88051840 CTGATTTAACACATCTGTGTTGG - Intronic
936182127 2:110276022-110276044 GTGACTAAACACACAGATGTGGG + Intergenic
936230441 2:110695651-110695673 GTGACTAAACACACAGATGTGGG - Intergenic
936262001 2:110968000-110968022 CTGACTAATGATATCTCTGTTGG - Intronic
937637230 2:124169925-124169947 AGGACAAGACACATCTATGTGGG - Intronic
938755485 2:134375364-134375386 CTAAATAAATACATTTATGTTGG + Intronic
939075716 2:137600310-137600332 ATGACTAACCACATGTATGAAGG + Intronic
939333457 2:140793527-140793549 CTGACTAGAAATATATATGTGGG + Intronic
939580383 2:143939429-143939451 CTGGCATCACACATCTATGTGGG + Exonic
942142899 2:172995683-172995705 GTGACAAAACACTACTATGTGGG - Intronic
943024045 2:182607527-182607549 TTGACTATTCACATGTATGTGGG - Intergenic
944183268 2:196919689-196919711 CAGAGGAAACACATTTATGTTGG - Intronic
944209187 2:197188655-197188677 CTTAATGAAAACATCTATGTAGG - Intronic
945281478 2:208039575-208039597 CTTACTAAACACTTCTCTGTAGG - Intergenic
1168787847 20:555443-555465 CTGACTAAACACCTGTTAGTTGG - Intergenic
1169626746 20:7579672-7579694 CTGTATAAACACATCTAAATGGG - Intergenic
1170934432 20:20797283-20797305 CTGGCTAAGCATATGTATGTCGG + Intergenic
1174449658 20:50611389-50611411 CTGATTAAACACATGCACGTGGG + Intronic
1174676292 20:52360074-52360096 CAGACAAAACTCATCTATGATGG - Intergenic
1179398752 21:41064771-41064793 TGCACTAAACACATCTCTGTGGG - Intergenic
949623330 3:5840868-5840890 CTGAATAAAAATATCAATGTGGG + Intergenic
950903948 3:16520624-16520646 CTGACTACAGAAATCTTTGTGGG - Intergenic
951835525 3:26979452-26979474 CTGACTAAAAACATCTGCATTGG - Intergenic
951918503 3:27827200-27827222 CTGACAGAAAACATCTATCTGGG - Intergenic
952715427 3:36475421-36475443 CTGACTAAACACATAAATAATGG - Intronic
957016977 3:75077853-75077875 CTGAATAAAAACTTCTAAGTTGG + Intergenic
962380228 3:134892702-134892724 CTGACTCTAGACATCTCTGTAGG + Intronic
962481382 3:135801409-135801431 CTGACAAGACAACTCTATGTGGG + Intergenic
964321705 3:155505084-155505106 TTGACTAAACAGTGCTATGTGGG + Intronic
966944080 3:184765324-184765346 CTGACTCAACACTGCTCTGTTGG - Intergenic
969076042 4:4578594-4578616 CTGACTAAAGACAGCTGTCTGGG + Intergenic
970340378 4:15100149-15100171 CTTACTGAACAATTCTATGTAGG + Intergenic
970885340 4:20981693-20981715 CTGACTCAACAAGTATATGTGGG + Intronic
973645914 4:52951095-52951117 CAAACTAAACACATCTATTATGG - Intronic
980263537 4:130485401-130485423 AAGACTAAACACATCAATATCGG + Intergenic
980430764 4:132690453-132690475 CTGACAAAATACAAATATGTTGG - Intergenic
983190398 4:164748059-164748081 CTGGCTATAGACATCTCTGTTGG - Intergenic
989669631 5:43900563-43900585 ATGAATAATGACATCTATGTTGG + Intergenic
992333927 5:75745874-75745896 CTGACTAAATACATCCATGTGGG + Intergenic
993074469 5:83211233-83211255 CTGACCAAACTCATGAATGTGGG - Intronic
993920118 5:93791438-93791460 CTGTCTAAAAATAACTATGTAGG + Intronic
994388906 5:99165900-99165922 CTGGCTAAAGAAATCTATATTGG + Intergenic
994388995 5:99167035-99167057 CTGACTACACAGATACATGTGGG + Intergenic
997230177 5:132236764-132236786 ATGACTATGCACATCTATGATGG - Intronic
997918848 5:137957752-137957774 CAGCCTAAACAAGTCTATGTAGG - Intronic
998166242 5:139845979-139846001 CTGACTACACACATCCTAGTGGG + Intergenic
998659518 5:144220597-144220619 CTTACTATATACATGTATGTAGG + Intronic
998975483 5:147641614-147641636 CTGATTCATCACATCTTTGTAGG + Intronic
1000182392 5:158824131-158824153 ATGAATAAACATATCTCTGTGGG - Intronic
1001798467 5:174522577-174522599 GTGTATATACACATCTATGTAGG + Intergenic
1004764371 6:18709071-18709093 CTGACTATAAACATCTCTGGTGG - Intergenic
1006737882 6:36287636-36287658 CTGGTTAAACAAATCTATGCTGG - Intronic
1007203373 6:40130036-40130058 CTGGCCATCCACATCTATGTGGG + Intergenic
1009836816 6:69011844-69011866 CTGACTAATGAAATCCATGTAGG - Intronic
1012511259 6:100004189-100004211 CTCACTTCACACATCTATGTAGG + Intergenic
1016039572 6:139418714-139418736 CTGACTACACAAAACTATTTTGG - Intergenic
1017357117 6:153522824-153522846 CTGACTATAAACATCAATTTTGG - Intergenic
1017586049 6:155924379-155924401 GTGACTAACCACATATATGATGG - Intergenic
1019120080 6:169795122-169795144 CTGACCAAACACAGAGATGTTGG - Intergenic
1020592682 7:10161607-10161629 GTGACAAAACAAATCTATGTAGG + Intergenic
1023022980 7:36027664-36027686 TGGACTTAACACATTTATGTGGG - Intergenic
1024890816 7:54200735-54200757 CTGACTCAACACATCTGTATTGG - Intergenic
1027537162 7:79417541-79417563 CTTTTCAAACACATCTATGTAGG + Intronic
1027926506 7:84471496-84471518 ATAACTAAACACGTCTATGCGGG + Intronic
1028038084 7:86011080-86011102 CTGATTAAATACATGTAGGTTGG + Intergenic
1035916804 8:3634046-3634068 CTGACTCAGCACATCTGGGTAGG + Intronic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1046676171 8:117111106-117111128 GTGATAAAACACATCTTTGTAGG + Intronic
1048415597 8:134224705-134224727 CTGACTAAGCACATTAATTTGGG + Intergenic
1049314945 8:141960534-141960556 GTAAATAAACACATTTATGTTGG - Intergenic
1049971793 9:828005-828027 CTAAGTAGACACATATATGTAGG - Intergenic
1055888869 9:81100891-81100913 GTGACTTCACACATGTATGTGGG + Intergenic
1058100519 9:100914146-100914168 CTGGCCATACACATTTATGTGGG + Intergenic
1059384476 9:113953661-113953683 ATCACTAAACAAATGTATGTGGG + Intronic
1060642050 9:125247070-125247092 CTTAATAAAGACATCTATGTGGG - Intergenic
1186019559 X:5238936-5238958 CAGACAAAACACATTTATGATGG + Intergenic
1186031134 X:5370177-5370199 CTGAATAAAGACAGATATGTTGG + Intergenic
1190061405 X:47214226-47214248 CTGACTAAACACGTCTGCATGGG + Intronic
1190984897 X:55491323-55491345 CTGAATAAACCAATCTAGGTAGG - Intergenic
1192217175 X:69168723-69168745 CTGAAGAAACTCTTCTATGTAGG - Intergenic
1199516679 X:148685068-148685090 CTGACTATAGACATTTCTGTAGG + Intronic