ID: 1097051256

View in Genome Browser
Species Human (GRCh38)
Location 12:56224560-56224582
Sequence GGCGGAGCCGACGTAGACAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 46}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097051256_1097051263 14 Left 1097051256 12:56224560-56224582 CCCCTGTCTACGTCGGCTCCGCC 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1097051263 12:56224597-56224619 GACTAAAAGAGCATCCCGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 55
1097051256_1097051262 10 Left 1097051256 12:56224560-56224582 CCCCTGTCTACGTCGGCTCCGCC 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1097051262 12:56224593-56224615 TTGAGACTAAAAGAGCATCCCGG 0: 1
1: 0
2: 0
3: 13
4: 165
1097051256_1097051264 15 Left 1097051256 12:56224560-56224582 CCCCTGTCTACGTCGGCTCCGCC 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1097051264 12:56224598-56224620 ACTAAAAGAGCATCCCGGCAGGG 0: 1
1: 0
2: 0
3: 4
4: 95
1097051256_1097051265 16 Left 1097051256 12:56224560-56224582 CCCCTGTCTACGTCGGCTCCGCC 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1097051265 12:56224599-56224621 CTAAAAGAGCATCCCGGCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 73
1097051256_1097051266 17 Left 1097051256 12:56224560-56224582 CCCCTGTCTACGTCGGCTCCGCC 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1097051266 12:56224600-56224622 TAAAAGAGCATCCCGGCAGGGGG 0: 1
1: 0
2: 0
3: 10
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097051256 Original CRISPR GGCGGAGCCGACGTAGACAG GGG (reversed) Exonic