ID: 1097051689

View in Genome Browser
Species Human (GRCh38)
Location 12:56227018-56227040
Sequence AGATATCTGCAGCCCATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 341}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097051689_1097051693 -2 Left 1097051689 12:56227018-56227040 CCAGCCATGGGCTGCAGATATCT 0: 1
1: 0
2: 0
3: 15
4: 341
Right 1097051693 12:56227039-56227061 CTTAGTCCAGTGGAGCAGCAGGG 0: 1
1: 0
2: 1
3: 9
4: 160
1097051689_1097051695 14 Left 1097051689 12:56227018-56227040 CCAGCCATGGGCTGCAGATATCT 0: 1
1: 0
2: 0
3: 15
4: 341
Right 1097051695 12:56227055-56227077 AGCAGGGTTCAGTAGAGATATGG 0: 1
1: 0
2: 1
3: 12
4: 195
1097051689_1097051692 -3 Left 1097051689 12:56227018-56227040 CCAGCCATGGGCTGCAGATATCT 0: 1
1: 0
2: 0
3: 15
4: 341
Right 1097051692 12:56227038-56227060 TCTTAGTCCAGTGGAGCAGCAGG 0: 1
1: 0
2: 1
3: 18
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097051689 Original CRISPR AGATATCTGCAGCCCATGGC TGG (reversed) Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
903766341 1:25737276-25737298 TGATTACTGCAGCCAATGGCTGG - Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
907400556 1:54222437-54222459 AGATAGCTGCAGGGCATGGAAGG - Intronic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911275309 1:95852810-95852832 AGATACATGGAGCCCTTGGCAGG - Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
919730492 1:200910878-200910900 AGTTACCTGCAGCCCAAGACCGG - Intronic
921178410 1:212612873-212612895 AGATCTCTCCAGCCCAGGGCTGG - Intronic
923925012 1:238616501-238616523 AGAGATTTGCAGGCCATAGCAGG - Intergenic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1066690739 10:38025390-38025412 GGAGATATGCAGCCCTTGGCAGG + Intronic
1067093877 10:43285916-43285938 GGCTGGCTGCAGCCCATGGCAGG + Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069962361 10:72086691-72086713 GGAGATCAGCAGCCCATCGCGGG + Intronic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071452786 10:85814178-85814200 TTGTATATGCAGCCCATGGCAGG - Intronic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1074479937 10:113810028-113810050 AGGTATCTGGAGTACATGGCAGG + Intergenic
1074914167 10:117939593-117939615 TGATCTCTGCAGCTCATAGCTGG + Intergenic
1076695032 10:132243219-132243241 AGATATCCACAGCCCAAGGCTGG + Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1077850296 11:6069716-6069738 AGATAGATGCATCCCATGGGTGG + Intergenic
1079146409 11:17856213-17856235 ATATCTCTGCTGCCCATGGCTGG + Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081072774 11:38631093-38631115 AGATGTCTGCAGAAGATGGCAGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG + Intergenic
1088786407 11:113186144-113186166 ACCAATCTGCAGCCCAGGGCTGG - Intronic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1091566105 12:1649287-1649309 TGCTCTCTGCAGCCCCTGGCAGG + Intergenic
1091724409 12:2835384-2835406 CATTATCTGCAGCCCAGGGCTGG + Intronic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092171144 12:6374788-6374810 AGACCTCTGCAGCCCATACCAGG - Exonic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097051689 12:56227018-56227040 AGATATCTGCAGCCCATGGCTGG - Intronic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099365921 12:81765357-81765379 AGTTATCTGCAGAATATGGCAGG - Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1102711560 12:114932567-114932589 AGATATCATCATCCCTTGGCCGG + Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1107319912 13:39175427-39175449 AGATATATGCAGCCAACTGCAGG + Intergenic
1107387986 13:39933254-39933276 AGATGTCAGCAGCCCAGAGCTGG + Intergenic
1109232884 13:59780722-59780744 AGATCTCTGCGGCCCATTGCTGG + Intronic
1109879265 13:68450499-68450521 AAATATCTGCAGTGCATGTCAGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1113553103 13:111208601-111208623 AGAGCACTGCAGACCATGGCCGG + Intronic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1114423154 14:22601529-22601551 AGAGACCTGCCCCCCATGGCAGG - Intronic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117070206 14:52049395-52049417 ACCTGTCTGCAGCCCTTGGCCGG + Intronic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118243148 14:64081312-64081334 AGATGTCTGCTCCCCATGGCTGG - Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1119766973 14:77196321-77196343 AGAGAGCTGCAGGCCATGGGCGG - Intronic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120169404 14:81233959-81233981 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1120315521 14:82887596-82887618 AGGTATTTGAAGCTCATGGCTGG + Intergenic
1122769359 14:104091159-104091181 AGATGTCCGCATCCCAGGGCCGG - Intronic
1123782193 15:23639650-23639672 AGAAATCTACAGACCATGCCAGG - Intergenic
1124130931 15:26985132-26985154 TTATGGCTGCAGCCCATGGCAGG + Intronic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1127911014 15:63416331-63416353 AAATAACTGTAGCCCGTGGCTGG + Intergenic
1131158720 15:90090714-90090736 AGAAGTCTGCAGGCCATGGCAGG + Intronic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1138088126 16:54152562-54152584 AGACACGTGCAGCCCAGGGCGGG + Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1141625568 16:85259369-85259391 AGGTGCCTGGAGCCCATGGCAGG - Intergenic
1142813457 17:2407513-2407535 AGAGATCAGCAGCCTATGCCAGG + Intronic
1143088462 17:4434213-4434235 ATGGATCTGCAGCCCCTGGCTGG - Intronic
1144568032 17:16376372-16376394 AGAGATCTGTTGCACATGGCTGG + Intergenic
1145833064 17:27932961-27932983 AGATATTTGCAGTCCAGAGCTGG - Intergenic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1147578942 17:41617856-41617878 AGCCATCTGCAGCCCAGGGCTGG + Intergenic
1149467793 17:56893422-56893444 AGTTAGCTGCAGCCCAGGGCTGG + Intronic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1151280127 17:73067480-73067502 AGAAATCTAGAGACCATGGCTGG - Intronic
1152640400 17:81447047-81447069 GGATACCTGCGCCCCATGGCTGG + Exonic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153368746 18:4289052-4289074 ATAAATCTTCAGCCCAGGGCAGG + Intronic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156372763 18:36485999-36486021 AGATATGTGCAGCCTAATGCAGG - Intronic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1158205462 18:54987720-54987742 AGATATCTGCAGCTCAAGAATGG - Intergenic
1159036827 18:63285605-63285627 ACATATGTTCAGTCCATGGCTGG - Intronic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1159942112 18:74416213-74416235 TGACACCTGCAGCCCATGCCCGG - Intergenic
1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164349264 19:27314483-27314505 GGATATTTGCAGCCCTTGGAGGG + Intergenic
1165326264 19:35116159-35116181 AGCAACCTGCCGCCCATGGCTGG + Intronic
1165721784 19:38084084-38084106 AGAGTTCAGCAGCCCAGGGCTGG + Intronic
1166197600 19:41217349-41217371 AGAAGCCAGCAGCCCATGGCCGG + Intergenic
1167085624 19:47307747-47307769 ACAGGTCTGCAGCCCAGGGCTGG - Intronic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
925380304 2:3420233-3420255 AGATGCCTGCAGCCCAGGGACGG + Intronic
925407185 2:3613381-3613403 AGGTACCTGCAGCCCTGGGCCGG + Exonic
927442355 2:23128154-23128176 AGATTCCTGCAGACCCTGGCTGG - Intergenic
933083498 2:78024220-78024242 AGATTTCAGCAGTCCATGGTGGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
937048156 2:118864007-118864029 AGAGATTGGCAGCCCATGGAGGG - Intergenic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939534385 2:143408417-143408439 AGATATATGCAGCCTAAAGCTGG - Intronic
939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG + Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939826366 2:147020197-147020219 TGTTATGTGCAGCCCCTGGCTGG + Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
941904431 2:170707314-170707336 TGACATCTGCCTCCCATGGCAGG - Intergenic
942845922 2:180425193-180425215 AGACATGTACAGCCCATGGGAGG + Intergenic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943861148 2:192864066-192864088 AGATTTCTGCAGCAGATGCCAGG - Intergenic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945642175 2:212443808-212443830 ACTTATCTGCAGAACATGGCAGG - Intronic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
947596477 2:231415213-231415235 AGCTAACAGCAGCCCCTGGCTGG + Intergenic
1170008729 20:11697411-11697433 AGTTATCAGCAGCCAATGACTGG - Intergenic
1170420591 20:16189203-16189225 AGAATTCTGCAGCCCATGCCAGG + Intergenic
1170703861 20:18727691-18727713 AGAAATCTACAGCTCAGGGCTGG - Intronic
1170979238 20:21195638-21195660 ACCTATCTGCAGCCCAAGGTAGG - Intronic
1171233387 20:23505541-23505563 AGATAAAAGCAGCCCTTGGCTGG - Intergenic
1172503983 20:35447460-35447482 AGGTATTTGCAGCCCAGGGAAGG - Intronic
1173219321 20:41118370-41118392 AGATATCAGCAGGCCAGTGCTGG + Intronic
1176056115 20:63150246-63150268 AGAAATCTGCTGCCGTTGGCTGG - Intergenic
1176422631 21:6528195-6528217 AGCTTTCTGCAGACCATGGCAGG - Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178921711 21:36743198-36743220 AGCCATCTGCAGCCCCAGGCTGG - Intronic
1179698124 21:43136511-43136533 AGCTTTCTGCAGACCATGGCAGG - Intergenic
1180100938 21:45585154-45585176 AGGGAGCTGCAGCCCATGGCTGG - Intergenic
1180573297 22:16749419-16749441 AGAGGTCTGCTGACCATGGCAGG + Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1182361727 22:29750485-29750507 GGAGATCTGCAGCCCAAGGTGGG + Intronic
1182392173 22:30007585-30007607 CAGTATCTGCAGACCATGGCAGG + Intronic
1182547932 22:31086261-31086283 AGCTATCTTCAGCCTAGGGCAGG + Intronic
1184520191 22:44989119-44989141 AACTCTCCGCAGCCCATGGCAGG + Intronic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
950004128 3:9680547-9680569 ATCTTCCTGCAGCCCATGGCCGG + Intronic
950638195 3:14330772-14330794 AGAGAACTGCAGTCCAAGGCAGG + Intergenic
950808522 3:15629356-15629378 AGATCTCTGGAGCCCATGCCTGG - Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952849767 3:37718326-37718348 TGAACTCTGCAGACCATGGCTGG - Intronic
952976739 3:38703000-38703022 AGATATGTGCAGATCAAGGCAGG - Intronic
954824649 3:53361958-53361980 ACAAATCTGCAGGCCATAGCAGG + Intergenic
954886990 3:53883428-53883450 AGTTATCTTCAGCACATGGTAGG + Intergenic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
961820704 3:129574364-129574386 GGGCCTCTGCAGCCCATGGCTGG - Exonic
962804172 3:138915453-138915475 AGTGATCTGGAGCCCAGGGCTGG - Intergenic
964076742 3:152701051-152701073 AAATATCTCCAGGCCATGTCAGG - Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
967734483 3:192937580-192937602 AGATATCTGGAGGCCGAGGCGGG - Intergenic
968984490 4:3867667-3867689 AGGACTCTGCAGCCCTTGGCTGG + Intergenic
969689747 4:8697977-8697999 AGGTACCTCCATCCCATGGCTGG + Intergenic
970872637 4:20833989-20834011 CGAGATCTGCAGCCCTGGGCTGG - Intronic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973143678 4:46798576-46798598 AGCTTTCTGCAGATCATGGCAGG - Intronic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
976179259 4:82383594-82383616 AGATACATTCAGCCCATAGCAGG + Intergenic
977430763 4:96928182-96928204 AGGTATCTGCAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980387950 4:132111211-132111233 AGTTATCTGCAGAATATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
981370677 4:143955467-143955489 AGGTTTCTGAAGCCCATGGGAGG - Intergenic
982342542 4:154317366-154317388 AGATATCAGCAGCCTGTGTCTGG + Intronic
982436665 4:155388368-155388390 GGATGTCTGGAGCCCATGGCCGG - Intergenic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982674146 4:158356637-158356659 TCATATCTGAAGCCCTTGGCGGG - Intronic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983051362 4:163051323-163051345 AGTTATCTGCTTCCCAGGGCTGG + Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
985945332 5:3177816-3177838 TAATATCTGCAGTCCATTGCGGG - Intergenic
985964351 5:3328530-3328552 AGCTGTCTGCAGCCCAGGGGAGG + Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
986913657 5:12588895-12588917 AGCTATCTGCAGCTCATGTAGGG - Intergenic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987577066 5:19743575-19743597 AAAGATCTGCAGACAATGGCAGG - Intronic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
989859286 5:46346188-46346210 GGATATCTGGAGCCCTTGGAGGG - Intergenic
990352733 5:54934966-54934988 AGAAATCTGCCGCCCCTGCCTGG - Intergenic
991033542 5:62105893-62105915 AGTTATCTGCAGAAAATGGCAGG - Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
992403169 5:76429966-76429988 AGATATCTGTAGCCTGTGGGTGG + Intronic
992500675 5:77339579-77339601 ATATACCTGCACCCCAAGGCAGG + Intronic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG + Intronic
997001363 5:129766069-129766091 AGGTATCTGCAGACAATGGAAGG - Exonic
998043455 5:138968167-138968189 AGGTACCTGCAACCCAGGGCAGG - Intronic
998065595 5:139155745-139155767 GGATATCTGCAGACCATAGCAGG + Intronic
998511104 5:142714654-142714676 AGATATTTGAAGCTCATGTCAGG - Intergenic
998540598 5:142977938-142977960 AGGTTTCATCAGCCCATGGCTGG + Intronic
1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG + Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003147141 6:3518130-3518152 AGACAGCTGCAGCCCCAGGCTGG - Intergenic
1003192227 6:3884435-3884457 AGGTCTCTGTAGCACATGGCTGG - Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006343609 6:33461962-33461984 AGATGTCTACAGCATATGGCTGG - Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010818629 6:80388372-80388394 AGTTATCTGCAGATAATGGCAGG - Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1012959634 6:105608914-105608936 AGAGATCTCCTGCCCAAGGCAGG - Intergenic
1013745737 6:113344032-113344054 GAATCTCTGCAGCCCATTGCAGG - Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1017233933 6:152100091-152100113 AGGTAGCTGCAGCCTGTGGCAGG - Exonic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1018935772 6:168273408-168273430 AGATTTCTGCAGCCCACAGAAGG + Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1022974630 7:35545917-35545939 AGAAATCTGAAGCCCATAGAAGG - Intergenic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1027625098 7:80534591-80534613 AGCTATCTGCAAGCCATGGATGG - Intronic
1027685793 7:81277926-81277948 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1027963821 7:84980823-84980845 AGAAAGCTGCAGCTCCTGGCAGG - Intergenic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030736864 7:113059352-113059374 AGATATGTTCAAACCATGGCAGG - Intergenic
1031235453 7:119169426-119169448 AGATTGCAGCAGCCCATGGTAGG + Intergenic
1031676555 7:124618320-124618342 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1033425053 7:141236425-141236447 AGATAGATGCAGCCCTTGGGAGG + Intronic
1035054368 7:156024263-156024285 AGCTGTCGGCAGCCCCTGGCCGG - Intergenic
1037191203 8:16128180-16128202 GGATCTCTGCAGCACACGGCTGG - Intronic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1037899851 8:22681561-22681583 TGGTACCTGCAGCCCAGGGCTGG + Intergenic
1039826979 8:41182982-41183004 AGATAAATGCAGCCCAGAGCAGG - Intergenic
1040575421 8:48647380-48647402 AGATTCCTGCAGCCTATGGGTGG + Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044773980 8:95668669-95668691 AGATAACTGAAGCCCAAGCCAGG + Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1049540879 8:143208218-143208240 AGAGAGGTGCAGCCCAGGGCAGG - Intergenic
1050251025 9:3745160-3745182 AGATATCTTGATCCCATGTCTGG - Intergenic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1055438205 9:76313584-76313606 AGCTATCAGGAGCCCAAGGCTGG + Intronic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1057805443 9:98216543-98216565 AGGTGTGTTCAGCCCATGGCAGG + Intronic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1061940662 9:133882143-133882165 AGAGCTCTGCAGGGCATGGCTGG - Intronic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1187417576 X:19106298-19106320 AGAAATGTGCAGCTCGTGGCTGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1190527882 X:51346279-51346301 AGTTATATGCAGAGCATGGCAGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192549370 X:72041859-72041881 AATTCTCTGCAGGCCATGGCTGG + Intergenic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193447152 X:81618739-81618761 AGTTATCTGCAGGAGATGGCAGG - Intergenic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197386776 X:125812275-125812297 AGATATCTGCAGTAGATTGCAGG + Intergenic
1198434510 X:136603114-136603136 AGACATCTCCTGCCCATGGAAGG - Intergenic
1198839562 X:140841767-140841789 AGAGATCTGCCTGCCATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1201804922 Y:18002542-18002564 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1202512761 Y:25597608-25597630 AGTTATCTGCAGAAAATGGCAGG - Intergenic