ID: 1097051983

View in Genome Browser
Species Human (GRCh38)
Location 12:56229157-56229179
Sequence TTACTAACAGGGTTGCTGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097051983_1097051989 -4 Left 1097051983 12:56229157-56229179 CCTTCCAGCAACCCTGTTAGTAA 0: 1
1: 0
2: 2
3: 14
4: 189
Right 1097051989 12:56229176-56229198 GTAACGGCAAAGAAACCCGGAGG 0: 1
1: 0
2: 1
3: 4
4: 21
1097051983_1097051988 -7 Left 1097051983 12:56229157-56229179 CCTTCCAGCAACCCTGTTAGTAA 0: 1
1: 0
2: 2
3: 14
4: 189
Right 1097051988 12:56229173-56229195 TTAGTAACGGCAAAGAAACCCGG 0: 1
1: 0
2: 1
3: 6
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097051983 Original CRISPR TTACTAACAGGGTTGCTGGA AGG (reversed) Exonic
900530682 1:3151492-3151514 TTACTAACAGGCTTCCCAGAGGG + Intronic
901272735 1:7965624-7965646 TTAGTAAGTGGGTGGCTGGATGG + Intronic
905833756 1:41098441-41098463 CTACTCACAGGGTTGTTGTAAGG - Intronic
906641012 1:47440342-47440364 ACACTGACAGGGTTGCTGGCCGG - Exonic
908466082 1:64396996-64397018 TCACTCACAGGGTTGTTGGTAGG + Intergenic
909877427 1:80825740-80825762 TAACTAACATGGTTCCTGTAAGG - Intergenic
911418309 1:97605458-97605480 TTACTCACAGGGTAGCAGGACGG - Intronic
911640385 1:100282239-100282261 TTACTATCAAGGTGGCTGGGTGG + Intronic
915742584 1:158130318-158130340 TTGCTAACAGGGGTGGTGGTAGG + Intergenic
917861250 1:179146740-179146762 TTCCTCACAGGGTGGCAGGATGG - Intronic
918164419 1:181930809-181930831 TTATTGACACAGTTGCTGGATGG + Intergenic
918654834 1:187011785-187011807 TTACCATCAGGGTTGATGGTGGG - Intergenic
918690613 1:187474571-187474593 CTACAATCAGGGTTGCTGAAGGG + Intergenic
921261287 1:213387193-213387215 TCTGTAGCAGGGTTGCTGGAGGG + Intergenic
1063049132 10:2426703-2426725 TTCCTAACAGGGTTGCTTGGAGG + Intergenic
1063671991 10:8106400-8106422 TATCTCACAGGGTTCCTGGAAGG + Intergenic
1064489669 10:15839868-15839890 TTACTAAAATGTTTTCTGGAGGG + Intronic
1067573052 10:47385611-47385633 TTCTTCACAGGGTGGCTGGAAGG + Intergenic
1069282447 10:66671845-66671867 TTACTCCCAGGGTTGCTGTGAGG + Intronic
1069506132 10:68999609-68999631 TTACTCACATGGTTGTTGGCAGG + Intronic
1069734777 10:70646758-70646780 ATCCTAACAGTGTTTCTGGAGGG - Intergenic
1070130075 10:73649707-73649729 TTAGTAACAGGGTCTCTGCAGGG - Intronic
1070560167 10:77560310-77560332 ATATTAAAAGGGTTGCTGCATGG + Intronic
1072880576 10:99223233-99223255 TTCCTCATAGGGTTGATGGAAGG + Intronic
1073482075 10:103792231-103792253 TTCCTAACAGCATTGTTGGAAGG + Intronic
1078049482 11:7949571-7949593 TGACTATCAGTGTTGCTGGAAGG + Intergenic
1078066416 11:8081748-8081770 TATCTGCCAGGGTTGCTGGAAGG + Intronic
1078530938 11:12136404-12136426 TGTCTTACAGGGTTGCTGGGAGG + Intronic
1080902773 11:36511108-36511130 TACCTCACAGGGTTGTTGGAAGG + Intronic
1083791742 11:64990139-64990161 TTAATGACATGGTTGCTGAATGG - Intronic
1085703678 11:78767303-78767325 TTCCTCACAGTGTTGCTGGATGG + Intronic
1088706840 11:112471507-112471529 TAACAAAGAGGGCTGCTGGAGGG + Intergenic
1090979010 11:131700610-131700632 TTCCTGAAAGGGTTGCTGTAAGG - Intronic
1091453870 12:590824-590846 TTACTATCAAGGTTACTGGGAGG + Intronic
1091453884 12:590948-590970 TTACTATCAAGGTTACTGGGAGG + Intronic
1091779125 12:3202779-3202801 TTCCTACTAGGGTGGCTGGAGGG - Intronic
1092903282 12:13079856-13079878 TGACCACCAGGGCTGCTGGATGG - Exonic
1092980104 12:13786309-13786331 ATATTAACAGGGTTACTGGGTGG - Intronic
1093795409 12:23304309-23304331 GTACTCACAGTGTTTCTGGAAGG - Intergenic
1094579893 12:31724904-31724926 TGACCAGCAGGGTTTCTGGATGG - Intronic
1095339902 12:41077264-41077286 TCACTCACAGGGATGCTGGCAGG - Intergenic
1096446921 12:51701729-51701751 TTGCTCACAGGGTTACTGTAAGG + Intronic
1096490738 12:52011452-52011474 TGACTGCCAGGGTTGCTGGGAGG - Intronic
1096965782 12:55626375-55626397 TCACTCACATGGTTGCTGGCAGG + Intergenic
1097051983 12:56229157-56229179 TTACTAACAGGGTTGCTGGAAGG - Exonic
1099961933 12:89405190-89405212 GAACTAACATGGTTGATGGAAGG + Intergenic
1101560274 12:105850713-105850735 TTCCTCACAGGGTGGCAGGAAGG - Intergenic
1101703832 12:107201332-107201354 TTCCTCACAGGGTTGTTGAAAGG - Intergenic
1102563907 12:113782190-113782212 TATCTCACAGGGTTGCTGGGAGG - Intergenic
1102763785 12:115413362-115413384 TAACTCAAAGGATTGCTGGAAGG + Intergenic
1102788616 12:115624568-115624590 GCCCTAACAGGGTTGCTGTAGGG + Intergenic
1102825491 12:115944860-115944882 TTACTAACACGGTTCCTGAAGGG - Intergenic
1104968389 12:132520159-132520181 GTACAAGGAGGGTTGCTGGAGGG - Intronic
1110204770 13:72899439-72899461 TTCATACCAGGGATGCTGGATGG + Intronic
1111772161 13:92610748-92610770 TTCCTCACAGGGTGGCAGGAAGG + Intronic
1111960552 13:94805302-94805324 TTCCTGACAGCGTTGCTGAATGG + Intergenic
1113922393 13:113920418-113920440 ATACTTACATGGCTGCTGGATGG + Intergenic
1114647184 14:24262342-24262364 TTCCTAACAGGCATGATGGATGG - Exonic
1118418492 14:65572357-65572379 TTACTCACAGGGCTGCTATAGGG - Intronic
1118476011 14:66117812-66117834 TTACTCACCGGCTTCCTGGATGG + Intergenic
1121197151 14:92084239-92084261 TTACTCACAGGGCTGCTGTGAGG + Intronic
1121865841 14:97361791-97361813 TTAATTAAAGGTTTGCTGGATGG + Intergenic
1122153911 14:99738978-99739000 TTAGTAACAGGGTATCTGCAGGG - Intronic
1122510210 14:102260369-102260391 TGCCTGACAGGGTTGTTGGAAGG + Intronic
1125580970 15:40785498-40785520 CTACACACAGGGCTGCTGGAAGG + Intronic
1127077249 15:55338800-55338822 TTGCTCACATGGTTGCTGGTGGG - Intronic
1127641689 15:60921794-60921816 TCACTAACAGGGCTGCTGTGAGG + Intronic
1128554044 15:68618034-68618056 GCACTAACTGGGTTCCTGGAGGG - Intronic
1129724160 15:77893229-77893251 AAACTAACAGGGTTGGGGGAAGG + Intergenic
1130581578 15:85141940-85141962 TTACTCACGTGGTTGCTGGGAGG - Intergenic
1132100769 15:99021432-99021454 TTAAAGTCAGGGTTGCTGGAAGG + Intergenic
1135989736 16:27210655-27210677 AGAACAACAGGGTTGCTGGATGG - Intronic
1137385120 16:48034350-48034372 TTCCTAAGAGGGTTGCAAGAAGG + Intergenic
1138624461 16:58238005-58238027 TTACTCCCAGGTTTGTTGGAAGG + Intronic
1139266310 16:65642334-65642356 TTCCTCACAAGGATGCTGGAAGG + Intergenic
1139266496 16:65644594-65644616 TTCCTCACAGGGATGCTGGAAGG - Intergenic
1139354685 16:66360618-66360640 TTCCTCCCAGGGTTGCTGAAAGG - Intergenic
1139430578 16:66909008-66909030 TACCTCACAGGGTTGCTGGGAGG + Intronic
1203142842 16_KI270728v1_random:1780073-1780095 CTATTAACAGGATGGCTGGATGG - Intergenic
1145776510 17:27532720-27532742 TTTCCAACAGGCTTTCTGGAAGG + Intronic
1146478354 17:33181377-33181399 TTATTACTAGGGTTGCTGAAAGG - Intronic
1147214541 17:38891462-38891484 TTCCTCACAGGGCTGCTGGGAGG - Intronic
1147885491 17:43681524-43681546 TGTCTCACAGGGTTGCTGGGAGG + Intergenic
1149304454 17:55334777-55334799 TCCCTCACAGGGTTGCTGAAAGG - Intergenic
1150214438 17:63458823-63458845 TAACTCACAGGGTTGCTAGGAGG + Intergenic
1151077814 17:71294413-71294435 TTATTAACATGGTTGTTGCAAGG - Intergenic
1151700496 17:75740264-75740286 ATCCTAGCATGGTTGCTGGAGGG + Intronic
1152891808 17:82886205-82886227 TTCCTCACAGCGTTGCTGGGAGG - Intronic
1156377629 18:36529032-36529054 CTACAAAGAGGGTTTCTGGAGGG + Intronic
1158204999 18:54983536-54983558 GTAGTAACAGGGTTGCTGTGAGG - Intergenic
1158752431 18:60278739-60278761 CTACTAACAGGGTGACTGCAGGG + Intergenic
1158895649 18:61910287-61910309 TCACTCACATGGCTGCTGGAAGG + Intergenic
1159716137 18:71825775-71825797 TCAGTAACAGGGTTACTGGGAGG - Intergenic
1160181539 18:76640939-76640961 TTGCTAAGAAGGTTGATGGAGGG + Intergenic
1160251372 18:77206190-77206212 TTACTAAGAGGTTTCCTGAAAGG + Intergenic
1162477328 19:10908348-10908370 TGCCTGAGAGGGTTGCTGGAAGG + Intronic
1164999438 19:32749047-32749069 TTAGTGATAGGGTTGGTGGATGG + Intronic
1166895554 19:46019869-46019891 TGACTCACAGGGTTGCTGTGAGG - Intronic
925313658 2:2905958-2905980 TACCTAGCAGGGTTCCTGGAAGG + Intergenic
929925272 2:46202282-46202304 TGCCTTGCAGGGTTGCTGGAGGG + Intergenic
930738939 2:54809507-54809529 TGACTAACAGCATGGCTGGAGGG + Intronic
931674207 2:64677686-64677708 TTCCTCACAGGGTGGCTGGGAGG - Intronic
931976869 2:67652943-67652965 AAACTATCAGGGTGGCTGGAGGG - Intergenic
932697373 2:73968241-73968263 TTTCTAGCTGGGTGGCTGGAAGG - Intergenic
934955380 2:98613497-98613519 TTCCTCACAGGGTGGCGGGATGG + Intronic
935322104 2:101898994-101899016 TTCCTAACCTGGTTGCTGTAGGG - Intergenic
935350644 2:102149561-102149583 TTAAGAACAGGGGTGCTGGTGGG - Intronic
938051947 2:128181808-128181830 TATCTCACAGGGTTGCTGGGAGG - Intronic
938610639 2:132944446-132944468 TACCTAACACGGTTGTTGGAAGG - Intronic
939866153 2:147475014-147475036 TTATTGACAGGGTTTCTGCAGGG - Intergenic
940738878 2:157484404-157484426 CTTCTAACAGGGTTACTGAAAGG + Intronic
945826410 2:214725233-214725255 TTGCTCACAGGGGTCCTGGAAGG + Intergenic
947386412 2:229595162-229595184 TTACCAAAAGGGTTGCTGTAAGG - Intronic
947502076 2:230678247-230678269 TCACTCACAGGGTTGTTGGCAGG + Intergenic
1168803461 20:659174-659196 TTAAGGAGAGGGTTGCTGGAAGG - Intronic
1174220466 20:48950374-48950396 CTAATAACATGGTTGCTTGAGGG - Intronic
1174678341 20:52379377-52379399 TTACTCTCAGGGTTGTTGGCAGG + Intergenic
1175157944 20:56985890-56985912 TTACAAGCAGGGATGCTAGAGGG - Intergenic
1176906403 21:14506859-14506881 TTAATACCAGGGATGCTGGGAGG + Intronic
1178502500 21:33137508-33137530 TACCTAATAGGGTTGCTGGGAGG - Intergenic
1178792132 21:35710357-35710379 GTGCTCACAGGGTTGATGGACGG - Intronic
1182136548 22:27909691-27909713 TTAATAAAAGGATTGCTGGGAGG - Intronic
1182548212 22:31087570-31087592 TCACTAACAGGGTCCCTAGAGGG - Intronic
1184507525 22:44913457-44913479 TTCCTCACAGGGCTGCTGGGAGG - Intronic
949929651 3:9068792-9068814 TTACTAGAAGGGCTCCTGGAAGG - Intronic
951056488 3:18152238-18152260 TAACTAACAGGGTTGTTGGAAGG + Intronic
955463342 3:59209584-59209606 TTACTTCCTAGGTTGCTGGAGGG + Intergenic
955749794 3:62176238-62176260 TTACTAACAGTTTGGATGGAGGG + Intronic
959982114 3:112528379-112528401 TTACTAACAGGGTCACAGGGGGG - Intergenic
961427506 3:126859611-126859633 TACCTTACAGGGTTGCTGCAAGG - Intronic
962111605 3:132456242-132456264 TTATTAGCAAGTTTGCTGGATGG + Exonic
962294798 3:134173530-134173552 TTCCTCACAGGGTGGCAGGATGG + Intronic
962991833 3:140584596-140584618 ATACTTTCATGGTTGCTGGAAGG - Intergenic
964784249 3:160376831-160376853 TTACTCACATGGTTGTTGGCAGG - Intronic
967298879 3:187992637-187992659 TAACTAACAGGGTTACAGAAAGG + Intergenic
967416752 3:189227341-189227363 TTCCTACCAGAGTTCCTGGAGGG + Intronic
967424288 3:189308450-189308472 ATACTAACAGCTTTGCTGGATGG + Intronic
969304098 4:6315497-6315519 TCACTCACAGGTTTGCTGGTTGG - Intergenic
969521246 4:7678916-7678938 TTCCTCACAGGGTTGCTGTGAGG + Intronic
972258043 4:37380105-37380127 CAACTCACAGGGTTGCTGTAAGG - Intronic
972336216 4:38109026-38109048 TCACTAGCAGGGGTGCTGGCGGG + Intronic
972342576 4:38165305-38165327 TTTCTAGCAGTGTTGCTAGAAGG - Intergenic
979722630 4:123919790-123919812 TTTTTAACAGGGTTTATGGAAGG + Intergenic
986533082 5:8759511-8759533 TTACTTACATGGATGGTGGAAGG - Intergenic
986613155 5:9590017-9590039 TTACTACCTGGGTGGCTTGAAGG + Intergenic
987074184 5:14365331-14365353 TTATTAACTGGCTTGATGGAGGG + Intronic
989442250 5:41486662-41486684 TTGCTAACAGGGTCTCTGGTAGG - Intronic
989462725 5:41719458-41719480 TTCCTCACAGGGCTGCTGAAAGG - Intergenic
990548709 5:56850736-56850758 GACCTCACAGGGTTGCTGGAAGG + Intronic
993001980 5:82389632-82389654 TACCTCACAGGGTTGTTGGAAGG - Intergenic
996128250 5:119751341-119751363 TGACTAACAGTTTAGCTGGAGGG + Intergenic
997424402 5:133793435-133793457 TATCTCACAGGGTTGCTGAAAGG - Intergenic
997638943 5:135435859-135435881 TTACTTAAAGGGTCTCTGGAGGG + Intergenic
1000260488 5:159583703-159583725 TTACTCACATGGTTGTTGGCAGG - Intergenic
1001333850 5:170782189-170782211 TTCCTTACAGGATTGCTGTAAGG - Intronic
1001351749 5:170974622-170974644 CAACTCAGAGGGTTGCTGGAAGG - Intronic
1001451971 5:171833504-171833526 TTACTTACATGGTTGTTGGTGGG - Intergenic
1002411768 5:179084805-179084827 TCACTCACATGGTTGCTAGAAGG - Intergenic
1002546301 5:179947627-179947649 TTAATAAGAGGGTTGTTGCAAGG + Intronic
1002895757 6:1379189-1379211 TGCCTAACAGTGTTGCTGGGAGG - Intergenic
1003074175 6:2969217-2969239 TTACTCACACGTTTGCTGAAAGG - Intronic
1003415686 6:5905899-5905921 TTACTCACACGGTTGTTGGCAGG + Intergenic
1006292321 6:33148049-33148071 TTACTTACAGTGTTTCTGTATGG - Intergenic
1009447779 6:63763637-63763659 TTCCTAACATGGTGGCAGGAAGG - Intronic
1010365797 6:75049808-75049830 ATACTTACAGGGAAGCTGGAGGG - Intergenic
1011797027 6:90967609-90967631 TCACTCACTTGGTTGCTGGAAGG + Intergenic
1011949002 6:92940902-92940924 TTACTCACATGGTTGATGGCAGG + Intergenic
1014657012 6:124119449-124119471 TTCCTCACAGGGTTGCTATAAGG + Intronic
1014890074 6:126833217-126833239 CTAGTAATAGGATTGCTGGATGG + Intergenic
1015580859 6:134723260-134723282 GTACTTACAGGGTTGTTGGGAGG + Intergenic
1018687487 6:166315305-166315327 TTACTAACTTGCGTGCTGGAAGG + Intergenic
1019151358 6:170008031-170008053 CTGCTAACTTGGTTGCTGGAGGG + Intergenic
1020714191 7:11649210-11649232 TCACTCACATGGTTGCTGGCAGG - Intronic
1022258044 7:28678844-28678866 TTATTAAGAGGGTTTCTGCAAGG - Intronic
1026066143 7:67074771-67074793 TTCCTTACAGGGTTGCTGTAAGG + Intronic
1026223014 7:68416735-68416757 GTACAAACAGGGATGCTGGGAGG - Intergenic
1026314096 7:69212831-69212853 TTCCTTTCAGGGTTGCTGTAAGG - Intergenic
1026710739 7:72737083-72737105 TTCCTTACAGGGTTGCTGTAAGG - Intronic
1028426862 7:90699417-90699439 TACCTAAGAGGGTTGCTGCAGGG - Intronic
1030255587 7:107506368-107506390 AAACTACCAGGGTGGCTGGAGGG + Intronic
1030303901 7:108001452-108001474 TTCCTATCTGGATTGCTGGAAGG + Intronic
1032508254 7:132452033-132452055 TTCCAAAAAGGGATGCTGGAAGG + Intronic
1033294512 7:140118948-140118970 TTGCTAAAAAGGTTGCTGGATGG + Intronic
1034406315 7:150904893-150904915 CTAATAACAGGGTTGCTGGATGG + Intergenic
1036674822 8:10821843-10821865 TGACTAAAAGGAATGCTGGAGGG + Intronic
1037084686 8:14834054-14834076 TTACTAACAGCATTGCAGTAAGG + Intronic
1041702727 8:60809545-60809567 TCACTAACAGGCTGACTGGAAGG - Intronic
1042054518 8:64749807-64749829 TTAAAAACAGGGTGGGTGGAAGG + Intronic
1044564702 8:93650294-93650316 TTACGAACAGTGGTGCTGTAAGG + Intergenic
1046208516 8:111037181-111037203 TTTCTCACAAGGTTGCTGGATGG + Intergenic
1047891282 8:129313870-129313892 TTACTCACATGGTTGTTGGAAGG - Intergenic
1050736141 9:8765477-8765499 TTATTCACATGGTTGCTGGCAGG - Intronic
1051937239 9:22458024-22458046 TGACTAACAGTTTGGCTGGATGG - Intergenic
1056169432 9:83969181-83969203 TTACAAACAGGGTTGGGGGGGGG - Exonic
1057931338 9:99196117-99196139 TTTCTCACAGGGTTGCTGTGAGG - Intergenic
1059150022 9:111940940-111940962 TTACTAACAGGGTTTCTTTTGGG + Intergenic
1059937126 9:119322509-119322531 TTGGTAACAGCGCTGCTGGAAGG - Intronic
1185549767 X:973662-973684 CTATTAACAGGATGGCTGGATGG + Intergenic
1189866498 X:45335437-45335459 TTATTACCATGGTTGCGGGAAGG + Intergenic
1194329020 X:92557943-92557965 TTCTTCACAGGGTGGCTGGATGG + Intronic
1195573552 X:106423910-106423932 TTATTGCCAGTGTTGCTGGATGG - Intergenic
1195871176 X:109487981-109488003 GTACTTACAAGATTGCTGGAAGG - Intergenic
1195916394 X:109940433-109940455 TCACTCACATGGTTGCTGGCAGG + Intergenic
1198276680 X:135100723-135100745 TTCTTAACAGGGTGGCAGGACGG - Intergenic
1199725038 X:150571484-150571506 TTTCTCAAAGGGTTGCTGGAGGG + Intronic
1200637728 Y:5677144-5677166 TTCTTCACAGGGTGGCTGGATGG + Intronic