ID: 1097053164

View in Genome Browser
Species Human (GRCh38)
Location 12:56235637-56235659
Sequence CCTCTTCCTGCTCTTTGTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 344}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097053161_1097053164 0 Left 1097053161 12:56235614-56235636 CCGGGGCTGTCAGTGCTCGGAGG 0: 1
1: 0
2: 0
3: 19
4: 161
Right 1097053164 12:56235637-56235659 CCTCTTCCTGCTCTTTGTGCTGG 0: 1
1: 0
2: 3
3: 30
4: 344
1097053158_1097053164 7 Left 1097053158 12:56235607-56235629 CCTGGGCCCGGGGCTGTCAGTGC 0: 1
1: 0
2: 1
3: 25
4: 340
Right 1097053164 12:56235637-56235659 CCTCTTCCTGCTCTTTGTGCTGG 0: 1
1: 0
2: 3
3: 30
4: 344
1097053160_1097053164 1 Left 1097053160 12:56235613-56235635 CCCGGGGCTGTCAGTGCTCGGAG 0: 1
1: 0
2: 2
3: 17
4: 186
Right 1097053164 12:56235637-56235659 CCTCTTCCTGCTCTTTGTGCTGG 0: 1
1: 0
2: 3
3: 30
4: 344
1097053155_1097053164 18 Left 1097053155 12:56235596-56235618 CCAGAGAAGGACCTGGGCCCGGG 0: 1
1: 0
2: 3
3: 21
4: 312
Right 1097053164 12:56235637-56235659 CCTCTTCCTGCTCTTTGTGCTGG 0: 1
1: 0
2: 3
3: 30
4: 344
1097053151_1097053164 30 Left 1097053151 12:56235584-56235606 CCTGGCGGACTACCAGAGAAGGA 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1097053164 12:56235637-56235659 CCTCTTCCTGCTCTTTGTGCTGG 0: 1
1: 0
2: 3
3: 30
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097053164 Original CRISPR CCTCTTCCTGCTCTTTGTGC TGG Exonic
902364211 1:15960527-15960549 CCTTTTCCTGGTCTTTTTTCAGG - Intronic
902431822 1:16369158-16369180 CATCTTCCTCCTCTTTGTCCTGG + Intronic
902842152 1:19081622-19081644 ATTCTTCCTGCTCTTGCTGCCGG - Intronic
902962954 1:19977639-19977661 CCTCTTCCTCATGTTTCTGCTGG + Intronic
903995350 1:27301989-27302011 GGGCTTCGTGCTCTTTGTGCAGG - Intronic
904256559 1:29258483-29258505 CCTCTTCCTCCTCTCTTTCCAGG + Exonic
904412041 1:30330403-30330425 CCTCTTCCTGCCATGAGTGCAGG - Intergenic
906081575 1:43092767-43092789 CCTGTTACTGGTCTATGTGCAGG + Intergenic
906221848 1:44086713-44086735 CCTCTGCCTTCTCTCTGGGCTGG - Intergenic
906343982 1:45003904-45003926 CCGCTTCCTGCGCTTTGTCACGG - Exonic
907052071 1:51336276-51336298 TCTATTCCTGCTCCTTGGGCAGG + Intronic
907304260 1:53505066-53505088 GCTCTGCCTGCTCTGTGTCCAGG - Intergenic
907309340 1:53530305-53530327 CCTATTTCAGCTCTCTGTGCTGG - Intronic
907352880 1:53847931-53847953 CCTCTTCCTCCTAAATGTGCAGG - Intergenic
909406875 1:75300742-75300764 TCTCTTCCTTCATTTTGTGCAGG - Intronic
909815289 1:79984945-79984967 CCTCTTCCAACCCTTTGTTCGGG - Intergenic
910440887 1:87250646-87250668 CCTTTTTCTGCTCTTTGGCCAGG - Intergenic
914244584 1:145876246-145876268 CCTCTTCCTACAATCTGTGCAGG - Exonic
914980605 1:152411316-152411338 CAACCTGCTGCTCTTTGTGCTGG - Intronic
915214516 1:154330907-154330929 CCTGTTCCTCCTCATTCTGCAGG + Exonic
915748212 1:158181382-158181404 TTTCTTCCTTCTCTTTATGCTGG + Intronic
917406686 1:174714074-174714096 CTTTTTCCTGCTCTTTGTAGTGG + Intronic
919253804 1:195096209-195096231 CCTCTCCCTGCTCCTGGTGCCGG + Intergenic
920218101 1:204375772-204375794 CCTCTTCCTACTTTTTCTCCTGG + Intronic
920728882 1:208463801-208463823 CCTCTGCCTCCTCTTTTTTCAGG - Intergenic
921063938 1:211609580-211609602 CCTCTCCCTGTTCCTGGTGCAGG + Intergenic
921945409 1:220882773-220882795 CCTCCTCCTGCTGCTTCTGCTGG + Intronic
1062763579 10:45509-45531 CCTTTTCCTGCTCTTAGAACAGG + Intergenic
1063624187 10:7674012-7674034 CCTCTTCCTCTTCTTTTTGATGG + Intergenic
1064536820 10:16365860-16365882 CCACATCCAGCTCTTTGTGTAGG + Intergenic
1065810216 10:29436116-29436138 CCTATTCCTGGTCTTTTTGGAGG - Intergenic
1068422322 10:56810397-56810419 CCTCTTTCTGCTCTTATTGTGGG + Intergenic
1068976851 10:63019613-63019635 TCTCTCCCTGCCCTTTGGGCAGG + Intergenic
1069756554 10:70777320-70777342 CCTCCTTCTGCTCCTTCTGCTGG + Exonic
1069776040 10:70927742-70927764 CCACTTCCTGTTCTGGGTGCTGG + Intergenic
1072368166 10:94735511-94735533 CCTCTCCCTTCTCTCTGTGAGGG + Exonic
1073137096 10:101226114-101226136 CTTCTTGCCGCTCTTCGTGCCGG - Intergenic
1073511898 10:104047720-104047742 CCTCTTCCTGCTCTGTTACCTGG + Exonic
1073669751 10:105574323-105574345 CTTCTTCCTCCTGTGTGTGCAGG - Intergenic
1074002724 10:109388612-109388634 CCACTTCCTGCTCCTTGTGATGG - Intergenic
1074180916 10:111062074-111062096 TCTCTTTCTCCTTTTTGTGCTGG - Intergenic
1075086621 10:119418242-119418264 ACTCTGCCTGCTCTGTGAGCTGG - Intronic
1075641403 10:124067090-124067112 CCACATCCTGCACTTAGTGCTGG + Intronic
1075796036 10:125120256-125120278 CATCTTCCTGCTCATCCTGCTGG - Intronic
1076293419 10:129365470-129365492 CCTCCTGCTGATCTGTGTGCAGG - Intergenic
1077337247 11:2010900-2010922 GCCCTTCCTGCTGTCTGTGCCGG + Intergenic
1078668583 11:13345810-13345832 CCTGTTCCTGCTCTTGGATCAGG + Intronic
1078757772 11:14227506-14227528 CCTCCTCCTGCTCTCTGTCAGGG + Intronic
1079414087 11:20216654-20216676 CCTCTAAATGCTCATTGTGCTGG + Intergenic
1080751960 11:35158937-35158959 CCTCTTCCTGCCTTCTGTCCTGG + Intronic
1081810384 11:45910931-45910953 CCTCTTCCTGCTCCAGTTGCTGG - Exonic
1082717679 11:56634957-56634979 CCTCTTCTCCCTCTTTGTGTTGG + Intergenic
1083484811 11:62976710-62976732 CCTCTTCCTCCTCCTTGTGTGGG + Exonic
1084550877 11:69840960-69840982 CTTCTCTCTGCTCTTTGTTCAGG - Intergenic
1084693822 11:70742226-70742248 CCCCTTCCTCCTCCTTCTGCTGG + Intronic
1087076501 11:94130944-94130966 AGTTTTCCTGCTCTTTGCGCAGG + Intronic
1087175707 11:95092929-95092951 CCTCTTCCTCCCCTGTGTGCGGG - Intronic
1088804365 11:113338648-113338670 CCTCCTCCTGCTCCCAGTGCAGG - Intronic
1089256706 11:117198046-117198068 CCTCTTCCTGCTTTTCCTGCAGG + Intergenic
1090359655 11:126163537-126163559 CCTCTGCCTACTCTCTCTGCAGG - Intergenic
1202820231 11_KI270721v1_random:66082-66104 GCCCTTCCTGCTGTCTGTGCCGG + Intergenic
1091398472 12:168915-168937 CCTCTTCCTCCCCTTTCTGCTGG + Intronic
1091597329 12:1886855-1886877 CCTCTTCCTGCTCTTGTGTCGGG + Intronic
1091648410 12:2291025-2291047 CCAATTCCAGCTCTGTGTGCAGG + Intronic
1091716825 12:2783578-2783600 CCTCTTCCTGCTGGCTGTGTGGG + Intergenic
1092009570 12:5098214-5098236 CTTCTTCCTGCTCCATGTGCTGG - Intergenic
1092429426 12:8396975-8396997 TCTCTTCCTCCTCCTTGAGCAGG - Intergenic
1092978794 12:13772664-13772686 CCTCTTCTTGCTCTTAGTTCAGG - Intronic
1094093724 12:26679439-26679461 CCATTTCCTGCTCTTGGTGATGG - Intronic
1096253728 12:50050698-50050720 CCTCTTCCTCCCCTTCCTGCAGG + Intergenic
1097053164 12:56235637-56235659 CCTCTTCCTGCTCTTTGTGCTGG + Exonic
1097170068 12:57107743-57107765 CCTCATCCTGATCTTCCTGCAGG - Exonic
1097328134 12:58302506-58302528 CCTCTTCCTGTGTTTTGTGATGG - Intergenic
1097422835 12:59402048-59402070 CCTCCTACTGTTCTATGTGCCGG - Intergenic
1099448287 12:82777927-82777949 CCTCTGCCTGCTCTCTTTGTGGG + Intronic
1102058622 12:109915438-109915460 CCTCTTCCTCCTCCTCCTGCTGG - Exonic
1102260906 12:111442773-111442795 CCTCTTCCTGCTCTCTCACCAGG + Intronic
1103283808 12:119783682-119783704 CGTCTACCTGCACTTTCTGCTGG + Intronic
1103565623 12:121814084-121814106 TCTCTCCCTGCTCTCTCTGCAGG + Exonic
1103827180 12:123748987-123749009 CCTCTTCCTACTCGTTTTGATGG - Intronic
1103923365 12:124410881-124410903 CCTCTCCCAGCTCTTTGCGGAGG - Intronic
1103988855 12:124785035-124785057 CCTCTTCCTGCTGCTTCTGGAGG + Intronic
1105042264 12:132969786-132969808 CCTCTGCCTGCTTTTTATTCTGG - Intergenic
1105284502 13:18993387-18993409 CCTCTTTCTGCTTTCTGTTCTGG - Intergenic
1106112261 13:26787311-26787333 GCACTTCCTGCTCTGTGTGTTGG + Intergenic
1106357840 13:29001126-29001148 GCTCTTCTTGCCCTTTTTGCTGG + Intronic
1106465605 13:30011766-30011788 TCTCTTCCAGCTCTTCGTGGAGG + Intergenic
1107293155 13:38880411-38880433 CTTCTTCCGGCTCTTGGTGGTGG - Exonic
1108561232 13:51646221-51646243 CTTCTGCCTGTTCTTTGTCCAGG + Intronic
1112188337 13:97149860-97149882 CCTCTCCCTCCTCTCTCTGCAGG + Intergenic
1113812042 13:113148920-113148942 CCTCCTCCTGCTCCGTGTTCCGG - Exonic
1114533358 14:23408759-23408781 CATCTTCCTGCTGTTAGTACTGG + Intergenic
1114643893 14:24242749-24242771 CCGCTTCCTGCACTCTCTGCCGG + Intergenic
1115398305 14:32933567-32933589 CCACTTCCTCCTCTTTCTTCCGG - Intergenic
1116233921 14:42253627-42253649 CCTCCTCCTCCTCCTTGTTCTGG - Intergenic
1118714274 14:68548200-68548222 CCTCTACCTCCCCTTAGTGCTGG + Intronic
1120771518 14:88385426-88385448 CCTCTCCCTGCTCTTCCCGCAGG + Intronic
1121310375 14:92932461-92932483 CCTCCTCCTCCTCTTTCTGCTGG - Exonic
1122047908 14:99036422-99036444 CCTTCTCCAGCTCTTTGTTCTGG + Intergenic
1122938448 14:104970568-104970590 CCTCTGCCTGCTCCTAGGGCTGG + Intronic
1123536217 15:21187194-21187216 CCTAGCCCTGCTCTCTGTGCTGG - Intergenic
1123932037 15:25176626-25176648 CCTCTTCCTGTTCCTTGAGATGG + Intergenic
1124163465 15:27295905-27295927 CCTCTCTCTGCTCTATGAGCTGG + Intronic
1126377543 15:48011344-48011366 TCTCTTCCTCCTCTTTCTGATGG + Intergenic
1127773073 15:62245871-62245893 CCTCTTCCTGCTCTTGGTTCAGG + Intergenic
1127773118 15:62246170-62246192 CCTCTTCCTGCTCTTCGTTCAGG + Intergenic
1127773170 15:62246488-62246510 CCTCTTCCTGCTCTTGGTTCAGG + Intergenic
1129030098 15:72611707-72611729 CCTCTAGCTGCTGTTTCTGCTGG - Intergenic
1129343449 15:74901418-74901440 CCTATTTCTGCTGTTTGGGCTGG + Exonic
1129542199 15:76359557-76359579 GCTCTTCCTGCTCTGTTTTCAGG - Intronic
1132249123 15:100320382-100320404 GCTCTGCCTTCTCTCTGTGCAGG - Intronic
1132504028 16:297852-297874 CCTCCACCTGCTCCTTGGGCCGG + Exonic
1132786417 16:1659244-1659266 CCTCTTCCTGCAGCCTGTGCTGG + Intronic
1132920129 16:2384686-2384708 CTTGTTCCTGATCTTTGTGGGGG + Intergenic
1133202122 16:4210083-4210105 CCTCTTCCAGCACTTTCTGTGGG - Intronic
1135080630 16:19431627-19431649 CAACTTCCTGCTCTTGGTGCTGG + Intronic
1135177395 16:20242788-20242810 CCTCTTCCTGTTCCTCGTTCTGG - Intergenic
1135497965 16:22969164-22969186 CCTCTCCCTGCCTTTTCTGCAGG - Intergenic
1135860772 16:26053986-26054008 CCTTTTCCTTGTCTTTGTGGTGG - Intronic
1136057417 16:27700705-27700727 CTTCTTCCTGCTCCTTGATCAGG - Intronic
1136080213 16:27847384-27847406 GCTCTTCCTGCTCTAAGTTCTGG - Intronic
1136396322 16:29994424-29994446 CCTCTCTCTGCTCTTTCTTCTGG + Exonic
1136491081 16:30608973-30608995 CCTCTTTCTGCTCTTACGGCAGG - Intronic
1138140507 16:54564395-54564417 GCTGTTACTACTCTTTGTGCGGG + Intergenic
1141086618 16:81100271-81100293 CCTCTTCCAGCTTTTGGTGTTGG - Intergenic
1141341719 16:83209860-83209882 CATCTTCCTGGACTTGGTGCCGG - Intronic
1142379628 16:89723906-89723928 CCTCTTGCTCCTCTGTGAGCAGG + Intronic
1142774263 17:2123878-2123900 TCTCTTCCTGCTCTGTTTTCAGG - Intronic
1142853475 17:2716781-2716803 CCTCCTCCTTATCTTTATGCAGG - Intergenic
1143631985 17:8144838-8144860 GCTCTTCCTTCTGTGTGTGCAGG + Exonic
1144535425 17:16084354-16084376 CATCTTCCTTCTCTTTGTCCTGG - Intronic
1144802566 17:17940576-17940598 CTTATTCCTGCTCTTTGTTCAGG - Intronic
1147749226 17:42718379-42718401 CCATTTCCTTCTCTTTGTTCTGG - Intronic
1147904938 17:43816533-43816555 CCTCTTCCTGCTCTGCCAGCTGG - Intronic
1148049154 17:44760669-44760691 CCTATACCTCCTGTTTGTGCCGG - Intronic
1148221724 17:45867390-45867412 CTTCTTCCTGCGCTGTGTGATGG - Intergenic
1149414102 17:56440454-56440476 CCTATTGCTGATATTTGTGCTGG + Intronic
1149993835 17:61396908-61396930 CCGCTTCCTCCTCTGTGTGCAGG - Intergenic
1150124765 17:62628714-62628736 TCTCTTCCTGCTCCTTATTCAGG + Intronic
1151172661 17:72260462-72260484 CTTATTACTGCTCTTTGTCCAGG - Intergenic
1151403592 17:73872299-73872321 CCTCTCCCTCCTCTTTGCACTGG + Intergenic
1151773025 17:76177355-76177377 CTTCTGCTTGCTCTTGGTGCTGG + Intronic
1152126434 17:78450101-78450123 CCTCTTCCAGCTCCATCTGCAGG + Intronic
1152424158 17:80210005-80210027 CCCCTGCCTGCTCTCTGTGAAGG + Exonic
1152830265 17:82492974-82492996 ACTCTGCCAGCTCTTTGTGGCGG + Intergenic
1152946183 17:83198829-83198851 CCACTTCCTACTCTGTGGGCAGG + Intergenic
1152956488 18:45840-45862 CCTTTTCCTGCTCTTAGAACAGG + Intergenic
1153685952 18:7545515-7545537 CCTCCTCCTGTTCTGTGTGTGGG + Intergenic
1153781099 18:8495735-8495757 CCTCTCCCTGCCCTCTCTGCAGG + Intergenic
1153789146 18:8561986-8562008 CGCTGTCCTGCTCTTTGTGCAGG - Intergenic
1153955065 18:10089077-10089099 CCTCTTCCTGCACACTCTGCAGG - Intergenic
1154023550 18:10685898-10685920 CCTCCTCCTGCCCTTTCTGCAGG + Intronic
1154297476 18:13163099-13163121 CCTCTGTCTGCCGTTTGTGCTGG - Intergenic
1156800643 18:41109289-41109311 CCTCTTCCTCCTCACTGAGCAGG + Intergenic
1159995803 18:74962678-74962700 CCTCTTCCCTCTCCTGGTGCTGG + Intronic
1160804873 19:988238-988260 CCTCCTCCTGTTCTCTGTGTAGG + Intronic
1161421293 19:4177138-4177160 CCTCTTCCTGCTCTTCCCACAGG - Exonic
1162032997 19:7925412-7925434 GCTCTGCCTGCTCGTGGTGCTGG - Exonic
1162435429 19:10654964-10654986 CCCCCTCCTCCTCTTTGTCCCGG + Intronic
1163999187 19:21081818-21081840 CTTCTTTCTGGTCTTTGAGCAGG - Intergenic
1164567658 19:29339469-29339491 CCTCTTCCTTCTCTTGGTTGAGG - Intergenic
1166645643 19:44529749-44529771 GGACTTCCCGCTCTTTGTGCTGG - Intronic
1167049375 19:47069149-47069171 CCTCCTCCTGCTGCTTCTGCTGG + Exonic
1168146519 19:54422421-54422443 GCTCTTCTTGCTCTCTGTGCCGG + Intronic
1168224310 19:54983246-54983268 CCTCTTCCTCCTCCTTCTCCAGG - Exonic
1168409777 19:56132419-56132441 CCTCTTCTGACTCTTTGTACAGG + Intergenic
925207127 2:2016278-2016300 CATCTTCTTGCTCTGTGTTCTGG - Intronic
925828220 2:7871422-7871444 CCTCTTCCAGCTTTTGGTGGGGG - Intergenic
928088431 2:28359845-28359867 CCCCTCCCTCCTCTGTGTGCAGG - Intergenic
929019373 2:37536331-37536353 CCTCTTCCTGCCCTGTTTGAAGG + Intergenic
929544164 2:42844848-42844870 CCTCTTCTTTCTCTCTGGGCCGG + Intergenic
930798250 2:55415522-55415544 CCTCTTCCTGTTCTGTGGCCTGG - Intronic
931700591 2:64905772-64905794 CCACTGCCTTCTCTTAGTGCAGG - Intergenic
934949423 2:98566239-98566261 CCTCTTCAGGCTCTAAGTGCTGG + Intronic
935355717 2:102197668-102197690 GATCTTCCTGCTCTTTCTGCTGG + Intronic
936073876 2:109389290-109389312 CCTCTTCCTCCTGTTTGCACAGG - Intronic
936384895 2:112020514-112020536 CCTCTTCCTTCTTCTTGTGTAGG + Intronic
937226311 2:120371955-120371977 CCTCTTGCTGAACTTTGTGATGG - Intergenic
937978244 2:127594295-127594317 CCTCTTCCCTCTCACTGTGCTGG - Intronic
938736597 2:134191673-134191695 CCTCCTCCTCCTCTTTCTCCTGG + Intronic
941012538 2:160317513-160317535 CCTCTTCCAGCTCATGGGGCTGG + Intronic
942973035 2:181980264-181980286 CCTCTCCCTGCTTTTTGTTTTGG - Intronic
943051746 2:182921535-182921557 CCTCTTGGTGCTCTTGGTGCAGG - Intronic
945221723 2:207490445-207490467 CCTCTTACTGCACATTGTGAAGG + Intergenic
945314991 2:208361096-208361118 CCACTGCCTGCTGTGTGTGCTGG - Intronic
945978671 2:216290811-216290833 CCCCATCCTTCTCATTGTGCAGG - Intronic
946211452 2:218150462-218150484 CACCTTCCTGCTCCTGGTGCTGG + Intergenic
948374702 2:237513682-237513704 CCTCTTCATGTTCATTGTGGGGG + Intronic
948858042 2:240739657-240739679 CCTCTTCCAGCTCCTGGTGGTGG - Intronic
1169210930 20:3765946-3765968 CCTCTTCCTGCACCCTGGGCTGG - Intronic
1171412131 20:24954292-24954314 CCTCTGCCTGCTCTGTCTGGAGG - Intronic
1172732722 20:37101479-37101501 CCTCTTCCTCCCCCTTGTACTGG - Intronic
1173318786 20:41968993-41969015 CCTCTCCCTCCTCTTTCTGGTGG - Intergenic
1173969388 20:47139996-47140018 ACTTTTCCTTCTCTGTGTGCTGG + Intronic
1176308180 21:5135298-5135320 CTTCTGCCTCCGCTTTGTGCAGG - Intronic
1177806053 21:25875773-25875795 CCTCTTCCTGTTCATTCTGTGGG - Intergenic
1178595691 21:33950423-33950445 CCTCTCCCTGCCCTTTTAGCTGG - Intergenic
1179848880 21:44126734-44126756 CTTCTGCCTCCGCTTTGTGCAGG + Intronic
1179903383 21:44406614-44406636 CCTCTTCCTGCTGGCTGTGTGGG + Exonic
1181406953 22:22691836-22691858 CCCCTTCCTGCTCCTGGTACAGG - Intergenic
1181414940 22:22752600-22752622 CTTCTTCCTGCTCCTGGTTCAGG - Intronic
1184774759 22:46617608-46617630 CCGCTTCTTCCTCTGTGTGCTGG - Intronic
1184998201 22:48226012-48226034 CCTATTTCTGGGCTTTGTGCAGG - Intergenic
1185392889 22:50572113-50572135 CCTCTCCCTGCAGTTTGTCCTGG - Exonic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
950566571 3:13772964-13772986 CCTGTCTCTGCTCTTTCTGCTGG + Intergenic
951407332 3:22316912-22316934 CCCCTTCCTGCACTTGGTGAAGG - Intronic
952827458 3:37536232-37536254 AGCCTTCCTACTCTTTGTGCTGG + Intronic
953040190 3:39249507-39249529 TCTCTTCCTGCTCTCAGTGGAGG - Intergenic
953533532 3:43759195-43759217 TCTCTTCCTGCTGTTTTTCCTGG + Intergenic
954034557 3:47844246-47844268 CCTCTTCCTCGTCTTTCTCCAGG - Intronic
954538412 3:51378304-51378326 CCTCTTCTTCCTCATTGCGCAGG - Intronic
955075963 3:55613619-55613641 TCTCTTCCTCCTGTTTGTGTGGG + Intronic
955277061 3:57556651-57556673 GCTCTTCCTGCTCTTCTTGGCGG - Exonic
955455910 3:59121695-59121717 ACTCTTACTGCTCTCTCTGCCGG - Intergenic
958719035 3:97822281-97822303 CCTCTTCCTCTTCCTTGTCCCGG - Exonic
958818172 3:98941253-98941275 CCTCCTCCCTGTCTTTGTGCTGG + Intergenic
960157302 3:114309001-114309023 CCTCTTCCGGCCGTGTGTGCTGG + Exonic
960944404 3:122956406-122956428 CCTCTTCCTAATCTCTGTGCTGG - Intronic
961325091 3:126104963-126104985 CCTCGTCCTGCTCTCTCAGCAGG - Intronic
961430079 3:126875204-126875226 CCTCTTCCTGCTCTGGATTCTGG - Intronic
961464107 3:127071126-127071148 CCACTTCCAGCACTTTCTGCTGG + Intergenic
961916310 3:130378675-130378697 CCTCTTGCTGTTCTATCTGCCGG + Intronic
962926050 3:139994221-139994243 TATCTTCCTGCACTTTCTGCAGG + Intronic
964445414 3:156752686-156752708 CCTCTTCCTCCTCCTTCTGGAGG - Intergenic
964577417 3:158188481-158188503 CCTCTTCCTGCTCTATCATCTGG + Intronic
966411731 3:179652734-179652756 CCCAATCCTGCTCTTTGTGTTGG + Exonic
966740071 3:183224490-183224512 TCTTTTCCTGCCCTTTGTCCAGG + Intronic
966876467 3:184324895-184324917 CCTCTTCCAGCTCTTCCTTCAGG - Exonic
967608805 3:191480770-191480792 GCTCTGCCTCCTCTTTCTGCAGG - Intergenic
967929567 3:194681005-194681027 CCTCCTCCTGCCATTTGTCCCGG - Intergenic
968357843 3:198122390-198122412 CCTTTTCCTGCTCTTAGAACAGG - Intergenic
968536503 4:1133897-1133919 GCTCTTCCTGTCCTCTGTGCAGG - Intergenic
968855955 4:3122158-3122180 CCTCTCCATGCTCTTGGGGCTGG + Intronic
969113470 4:4857640-4857662 CCTCTTCCTCTTCTTTGAGACGG - Intergenic
969167113 4:5325375-5325397 TCTCTTTTTGCTCTGTGTGCTGG + Intronic
969601797 4:8181248-8181270 CCCTTTCCTGGTGTTTGTGCTGG - Intergenic
971075953 4:23149976-23149998 CTTCTTTCTGATCTCTGTGCAGG - Intergenic
972666354 4:41168843-41168865 CCTCTTCCTTACCTTTGTGTGGG - Intronic
972726126 4:41747432-41747454 CCCTTTCCAGCTCTTTGAGCTGG + Exonic
972793325 4:42393459-42393481 CCTCTTCCTGCCCTGTGTTTCGG - Intergenic
972962523 4:44471657-44471679 ACTCTTCCTCCTCTTTCTACTGG - Intergenic
975954534 4:79821895-79821917 CTTCTTCCTGCTCTTTGCTATGG - Intergenic
976296225 4:83474795-83474817 CCTCTTCCTGCTCTAATTACAGG - Intronic
977895758 4:102363174-102363196 CCTCTTCCTGCTTATGCTGCAGG + Intronic
979878008 4:125917676-125917698 CCCCTTCCTTCTCTGTTTGCAGG - Intergenic
981690036 4:147498250-147498272 ACTTTTCCTGCTTTTTGTTCTGG + Intronic
981834288 4:149037188-149037210 CCTCTTCCTTCTCTATGCTCTGG + Intergenic
982232546 4:153222523-153222545 TGTTTTCATGCTCTTTGTGCGGG + Intronic
982353028 4:154436975-154436997 CCTCTTCCTTCTTTTGGTGTGGG + Intronic
982477203 4:155868152-155868174 CCTCTTCTCACTCTTTGTGGGGG + Intronic
985037125 4:185851709-185851731 CCTCTGCCTGCTTTTTATTCTGG - Intronic
985429430 4:189864774-189864796 TCTATTCCAGCTCTTTGTCCTGG - Intergenic
985478047 5:90935-90957 CCTGTTCCTGCCCTCTGTGCTGG - Intergenic
985717646 5:1471655-1471677 CCTCCTCCTGCTCTCTGACCAGG - Intronic
986021549 5:3809048-3809070 CCTCCTCCTCCACTTTGGGCTGG + Intergenic
986345735 5:6833658-6833680 CCTCTTCCTGCCCTGTGAGGCGG - Intergenic
988578134 5:32445605-32445627 CCACTTGCTGCTCTTCCTGCAGG - Intergenic
988706606 5:33732143-33732165 CCTCTTCTGGCTCCTGGTGCTGG - Intronic
991042283 5:62188323-62188345 CCCCTTCCTGCTCTGTGCTCAGG - Intergenic
991136609 5:63189631-63189653 CCTCATGCTTCTCTTTGTGGTGG - Intergenic
992328243 5:75685238-75685260 CCTGTTTCTGCTCTTGGTGCAGG - Exonic
992993309 5:82307529-82307551 CCTGTTGCTCCTCTTTGGGCAGG - Intronic
994666033 5:102706345-102706367 CCTCTTCCTGATTACTGTGCTGG + Intergenic
997826047 5:137107771-137107793 CATCTTCCTGTTCTTGATGCTGG - Intronic
997956879 5:138285745-138285767 CCCCTTCCTGCACTTTGCTCTGG + Exonic
998175980 5:139902383-139902405 CCTCTTCCTGCTATTTGCTAAGG + Intronic
999254268 5:150201118-150201140 CCTCATCCTGCTCATGCTGCTGG + Exonic
999265373 5:150263908-150263930 CCTCTGGCTGCTGTTTGTGCAGG + Intronic
999422864 5:151459843-151459865 CCTCTGCCTGCACTGTCTGCTGG + Intronic
999856254 5:155597627-155597649 CCTCTTCCTGCTGTTTGCAATGG + Intergenic
1000895309 5:166848081-166848103 AATCTTCCTGCTCTTGGTTCTGG - Intergenic
1001025688 5:168222551-168222573 CCTCTCTCTCCTCTTTGTCCTGG + Intronic
1001399767 5:171439483-171439505 CCTCTTCTTGCCGTTGGTGCTGG + Intronic
1001484095 5:172107155-172107177 CCTGTTTCTCCTCTCTGTGCTGG - Intronic
1001720498 5:173853001-173853023 TCTCTGCCATCTCTTTGTGCTGG - Intergenic
1001825069 5:174737852-174737874 CATTTTCCTGCTCTTTGTAAGGG - Intergenic
1002408534 5:179055010-179055032 CCTTTCCCTGCCCTTTGTGGGGG + Intergenic
1002566780 5:180116604-180116626 CCCCTTCCAGCTCTGGGTGCTGG - Intronic
1003522361 6:6868914-6868936 CCCCTTCCTGCTCTTTCTTTGGG - Intergenic
1004050718 6:12076047-12076069 TCTCTTCTTGCTTTTTTTGCAGG + Intronic
1005818100 6:29574027-29574049 CATCATCCTGCTGTCTGTGCTGG + Intronic
1006650288 6:35545435-35545457 CCTCTGCCTGCTCCTTATGCTGG + Intergenic
1006794316 6:36722129-36722151 CCTCTTCCAGCTCCTGGTGGGGG - Exonic
1007180425 6:39925747-39925769 CCTCGCCCGGCTCTTTGTGAAGG - Exonic
1008719457 6:54330920-54330942 CTTGTTACTGGTCTTTGTGCAGG - Intronic
1009052370 6:58291747-58291769 TCTGTTCCTGCTCATTATGCAGG + Intergenic
1009238738 6:61158868-61158890 TCTGTTCCTGCTCATTATGCAGG - Intergenic
1009623399 6:66104648-66104670 ACTCTTCCTTCTCTTTGCCCTGG - Intergenic
1009887440 6:69640611-69640633 CCTCTTCCTGGTCTTTATCTTGG - Intergenic
1011392275 6:86867452-86867474 CCTATTCCTCCTCATTGGGCAGG + Intergenic
1011495128 6:87930024-87930046 CCTCTCCCATCTCTTTGTCCTGG - Intergenic
1011590989 6:88970745-88970767 ACTCTTGCTGCACTTTATGCAGG + Intergenic
1011691770 6:89876848-89876870 CATCTTCCTCCTATTTGTCCTGG - Intergenic
1012273584 6:97244544-97244566 CTTCTGCCTGCTCTTTATTCTGG - Intronic
1014838311 6:126185328-126185350 ACTCTTCATGCTCTTTTTTCAGG + Intergenic
1016434021 6:144017236-144017258 CCTCTTGCTGGTCTTATTGCTGG + Intronic
1018167126 6:161108529-161108551 CCTCTTCCTCCTCTGTGCCCGGG + Intronic
1018803018 6:167237898-167237920 TCTCTTTCTGCTCTTTGCTCTGG - Intergenic
1018807049 6:167269925-167269947 CTTTTTCCTGCTTTTTGTACAGG + Intergenic
1018807564 6:167273144-167273166 TCTCTTTCTGCTCTTTGCTCTGG + Intronic
1019551840 7:1606931-1606953 CCTCCTCCTCCTCTTCGTGCCGG + Intergenic
1019742579 7:2682211-2682233 CCTCCCCCCGCTCTTCGTGCTGG + Intronic
1020151848 7:5688096-5688118 GCTATTCCTGCTCTATGTCCTGG + Intronic
1020371150 7:7433192-7433214 CCCCTCCCTGCTCTTTCTGTAGG - Intronic
1021365405 7:19772645-19772667 CCTCTTGGTGCTCTCCGTGCTGG - Exonic
1021687942 7:23205942-23205964 TCTCTTCGAGCTCTTTCTGCCGG - Intergenic
1021938945 7:25660221-25660243 GCTCTTCCTGATCTCTGTGGGGG - Intergenic
1022528163 7:31051778-31051800 CCCCTTCCTGGTCTTTCTCCGGG + Intergenic
1023108850 7:36789890-36789912 CCTCTTTCTGCTTGTTGTGATGG + Intergenic
1024004952 7:45218386-45218408 CCTCTTCCTTGTCTTTATGTTGG + Intergenic
1028043420 7:86087912-86087934 CCTCTGCCTGCTTTTTATTCTGG - Intergenic
1028044143 7:86094021-86094043 CCTCTGCCTGCTTTTTATTCTGG - Intergenic
1028198522 7:87934495-87934517 CTTCTTGCTGCTCTGTGTCCTGG + Exonic
1029189312 7:98760598-98760620 CCTCTTCCTGGACTTTGTCCTGG + Intergenic
1029378227 7:100195305-100195327 CCTCTTGATGCTCTTGGAGCTGG - Exonic
1029458211 7:100681616-100681638 CCTCTTCCTGTGCTCTCTGCGGG + Exonic
1030809560 7:113957141-113957163 CCTGTTCCTCCTCATTGGGCAGG - Intronic
1033517022 7:142116945-142116967 CCTCTTGCTGCTTCTTGTGTTGG + Exonic
1033611783 7:142970294-142970316 CCTTTTCCTGCTCCTTTTGCTGG - Intergenic
1034294788 7:149962704-149962726 CCTCATCCTGGTGTTTGTGCTGG + Intergenic
1034811275 7:154134248-154134270 CCTCACCCTGGTGTTTGTGCTGG - Intronic
1035691019 8:1559853-1559875 CCTCTGCCTGCACCTTCTGCTGG + Intronic
1035811471 8:2495191-2495213 CCTCGTCCTTCCCTTTGGGCAGG + Intergenic
1036672487 8:10801185-10801207 CCCCTTCCTTCCCTTTCTGCAGG - Intronic
1036725284 8:11215113-11215135 CCTTTTCTTGATCTGTGTGCTGG + Intergenic
1037601133 8:20395179-20395201 TCTCTTCCTGCTCATTGCACTGG + Intergenic
1037652753 8:20853924-20853946 CCTGTTCCTTCTGTTTATGCAGG + Intergenic
1038520897 8:28231045-28231067 CGCCTTCCTGCTCCTTCTGCAGG + Intergenic
1039180510 8:34861011-34861033 CAGATTCCTGGTCTTTGTGCAGG - Intergenic
1040136730 8:43862987-43863009 CTTCTTCCTGGTTTTTGTCCGGG - Intergenic
1040514842 8:48126305-48126327 GCTCCTCCTCCTCTGTGTGCAGG + Intergenic
1040614516 8:49020831-49020853 CTTCTTCCTGCTTTTTATTCTGG + Intergenic
1041269119 8:56093677-56093699 CCTCCATCTGCTCTTTCTGCTGG + Intergenic
1041708203 8:60868796-60868818 CCTGTTCCTGCACTTACTGCTGG - Intergenic
1044898124 8:96914753-96914775 CCACTTCCTGTTCGGTGTGCTGG - Intronic
1046013395 8:108577067-108577089 CTTCTTCCCGCTCTTAGTGTTGG + Intergenic
1047959584 8:130001227-130001249 CCTCTTCCTGTGCTCTGTGGTGG - Intronic
1048303704 8:133268790-133268812 CCTCCTCCTCCTGTGTGTGCTGG - Intronic
1048504264 8:135006575-135006597 CCTCCTCCTCCTCTCTCTGCAGG - Intergenic
1049267221 8:141674693-141674715 GTTCTTCCTGCTTGTTGTGCTGG + Intergenic
1049922360 9:377138-377160 GCTCTTCCTGCACCTGGTGCTGG + Exonic
1050631024 9:7558898-7558920 CCTCTTCCTCCTCCTGGAGCTGG + Intergenic
1051112966 9:13661066-13661088 CATCTTCCTACTCTTAGTGTTGG + Intergenic
1052290877 9:26839225-26839247 CCTCTTCTTGCTTTTTATGATGG + Intergenic
1054296558 9:63335445-63335467 CCCCTTCCAGCTTTTTCTGCAGG + Intergenic
1054777576 9:69136806-69136828 CCTCTTCCTTCTCCTTCTCCAGG - Intronic
1054993731 9:71360862-71360884 CCTCTTCCTTCTTTTTTTTCTGG - Intronic
1056723136 9:89088738-89088760 CCTCTGCCTGCTCTCCGTGCAGG - Intronic
1056812646 9:89776421-89776443 CCCTTTCCTGCACATTGTGCCGG - Intergenic
1057074461 9:92129692-92129714 GCTATTCCTGCTCTTTTTGGGGG + Intergenic
1057084833 9:92199916-92199938 GCTATTCCTGCTCTTTTTGGGGG - Intergenic
1057262918 9:93596084-93596106 GCTCTTCCTCTTCTGTGTGCTGG + Intronic
1058755617 9:108080415-108080437 CCACTTGCTGGTTTTTGTGCTGG + Intergenic
1058978407 9:110146343-110146365 GCTGTTCCTGCTGATTGTGCTGG + Intronic
1059497503 9:114721572-114721594 CTTCTCCCTGCTCTGTGTGCTGG + Intergenic
1059666581 9:116451994-116452016 CCTCCTCCTTCTCTTTATTCAGG + Intronic
1059746262 9:117204584-117204606 CCTCTTCCAGCTCTTAAAGCTGG - Intronic
1059818100 9:117940774-117940796 CCTCTCACTGTTCTTTATGCAGG - Intergenic
1061133857 9:128722509-128722531 CACCTTCCTGCTCCTGGTGCTGG - Exonic
1061513198 9:131073223-131073245 CCTCTTCCTCTTCTTTCTACAGG + Exonic
1061810758 9:133161796-133161818 CCTCACCCTGCTGTTTGTGTGGG - Intronic
1061995610 9:134181312-134181334 CCTCTCCCTGCTCTCTCTGATGG - Intergenic
1062418141 9:136464011-136464033 CCTCTTCCTGCAGCTTCTGCAGG - Intronic
1185776889 X:2810316-2810338 CTCCTTCTTGTTCTTTGTGCAGG + Intronic
1185830099 X:3293283-3293305 CCTCCTCCTCCTCTTCTTGCAGG - Intergenic
1188912114 X:35862390-35862412 CTTCTTCCTGCTTTTTTTGAAGG - Intergenic
1189172833 X:38925987-38926009 CCACTTCCTGCTGTGTGTGCTGG + Intergenic
1192580935 X:72280660-72280682 CCTCTGCCTCCTCCTTGTTCCGG - Intronic
1194557832 X:95384065-95384087 GCTCTTCCTGCCCTTTCTACTGG - Intergenic
1194957258 X:100195654-100195676 CCTCTTCCAGGTCCATGTGCAGG - Intergenic
1196091160 X:111744799-111744821 CCTCCTCCTGCTCTTGATGTGGG + Exonic
1197965195 X:132052956-132052978 CCTCTTCCTACTTTTGGTGATGG - Intergenic
1198107421 X:133474823-133474845 CTTCTATCTGCTTTTTGTGCTGG + Intergenic
1198921518 X:141733875-141733897 ACTTTTCCTGGTCTTTGTGGAGG + Intergenic
1201247874 Y:12024226-12024248 CCTCCTCCTCCTCTTCTTGCAGG + Intergenic
1201293109 Y:12441150-12441172 CTCCTTCTTGTTCTTTGTGCAGG - Intergenic
1201719766 Y:17083710-17083732 ACACTTTCTGTTCTTTGTGCAGG + Intergenic