ID: 1097056508

View in Genome Browser
Species Human (GRCh38)
Location 12:56253220-56253242
Sequence CAGACTGCTCACATCAACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 124}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097056508_1097056511 3 Left 1097056508 12:56253220-56253242 CCATGGTTGATGTGAGCAGTCTG 0: 1
1: 1
2: 0
3: 15
4: 124
Right 1097056511 12:56253246-56253268 AGATCTGGGCAGCCCAGAAGTGG 0: 1
1: 0
2: 3
3: 22
4: 251
1097056508_1097056518 26 Left 1097056508 12:56253220-56253242 CCATGGTTGATGTGAGCAGTCTG 0: 1
1: 1
2: 0
3: 15
4: 124
Right 1097056518 12:56253269-56253291 AGTCGGGGCCCTGACTCACCGGG 0: 1
1: 0
2: 0
3: 8
4: 96
1097056508_1097056512 9 Left 1097056508 12:56253220-56253242 CCATGGTTGATGTGAGCAGTCTG 0: 1
1: 1
2: 0
3: 15
4: 124
Right 1097056512 12:56253252-56253274 GGGCAGCCCAGAAGTGGAGTCGG 0: 1
1: 0
2: 0
3: 30
4: 281
1097056508_1097056514 11 Left 1097056508 12:56253220-56253242 CCATGGTTGATGTGAGCAGTCTG 0: 1
1: 1
2: 0
3: 15
4: 124
Right 1097056514 12:56253254-56253276 GCAGCCCAGAAGTGGAGTCGGGG 0: 1
1: 0
2: 0
3: 16
4: 170
1097056508_1097056517 25 Left 1097056508 12:56253220-56253242 CCATGGTTGATGTGAGCAGTCTG 0: 1
1: 1
2: 0
3: 15
4: 124
Right 1097056517 12:56253268-56253290 GAGTCGGGGCCCTGACTCACCGG 0: 1
1: 0
2: 1
3: 6
4: 114
1097056508_1097056513 10 Left 1097056508 12:56253220-56253242 CCATGGTTGATGTGAGCAGTCTG 0: 1
1: 1
2: 0
3: 15
4: 124
Right 1097056513 12:56253253-56253275 GGCAGCCCAGAAGTGGAGTCGGG 0: 1
1: 0
2: 2
3: 20
4: 248
1097056508_1097056519 29 Left 1097056508 12:56253220-56253242 CCATGGTTGATGTGAGCAGTCTG 0: 1
1: 1
2: 0
3: 15
4: 124
Right 1097056519 12:56253272-56253294 CGGGGCCCTGACTCACCGGGCGG 0: 1
1: 0
2: 0
3: 10
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097056508 Original CRISPR CAGACTGCTCACATCAACCA TGG (reversed) Intronic
908717863 1:67089128-67089150 CCAAATGCACACATCAACCAAGG + Intergenic
908806314 1:67936882-67936904 CAGACTGAAGACCTCAACCAGGG + Intergenic
909946235 1:81666738-81666760 CAGACTTCTGAGATTAACCATGG - Intronic
912509681 1:110180432-110180454 CAGCCAGCTCAGCTCAACCATGG - Intronic
920280940 1:204843164-204843186 CAGGCTGGTGACATCATCCAGGG + Intronic
921410904 1:214835615-214835637 CAGACTCCTCAGAAGAACCATGG - Intergenic
923407699 1:233679322-233679344 CAGACCTCTCAGATCAGCCATGG + Intergenic
1063158116 10:3398303-3398325 CAGCCTGCTCACCTGCACCATGG - Intergenic
1064018276 10:11789587-11789609 CATCCTGCTCACATCATCCAAGG - Intergenic
1076719443 10:132386851-132386873 CAGACACCTCAAATCCACCAGGG - Intergenic
1076719552 10:132387174-132387196 CAGACACCTCAAATCCACCAGGG - Intergenic
1077388874 11:2290102-2290124 CAGACTCCGCACATCCACCCAGG - Intergenic
1077574996 11:3376198-3376220 CAGACTGCTCACAGCAACCATGG - Intronic
1080185999 11:29487320-29487342 CAGATGGTTCAAATCAACCATGG - Intergenic
1081423988 11:42904779-42904801 CTCACAGCTCACATCCACCAAGG + Intergenic
1081828511 11:46083407-46083429 CAGACTACTCAGATAAACAAAGG + Intronic
1084525543 11:69695607-69695629 CAGAATGCCCGCATCACCCACGG + Intergenic
1087136223 11:94723056-94723078 CAAACTCCTCACATAAAGCAGGG - Intronic
1087515784 11:99159073-99159095 CAGATTTCTCACATAAAGCATGG + Intronic
1093705643 12:22272376-22272398 CAAACTGCCCACACCAACCAAGG + Intronic
1093990438 12:25583977-25583999 GAGACTGCTTCCATCATCCAGGG + Intronic
1097015500 12:55983879-55983901 CAAACTCCTCACCTCAAGCAAGG + Intronic
1097056508 12:56253220-56253242 CAGACTGCTCACATCAACCATGG - Intronic
1100076031 12:90785058-90785080 CAGACAGCTAACAAGAACCAGGG + Intergenic
1101579322 12:106027582-106027604 CAGTCTCCTCACATAAAACATGG - Intergenic
1106469684 13:30043327-30043349 CAGTCTGCTCACAAAAACAAGGG - Intergenic
1106704447 13:32265627-32265649 CACACCACTCACATCAGCCAAGG - Intronic
1108066355 13:46581589-46581611 CAGATTCCTCACATCTAACACGG - Intronic
1110190973 13:72728097-72728119 CTGACTGCTCCCATTCACCAGGG - Intronic
1113143048 13:107175817-107175839 AAGACTGCTAACTTCAACCAAGG - Intronic
1116559888 14:46364395-46364417 CAGAGTGCTCAGACCAACCCTGG + Intergenic
1118818818 14:69331486-69331508 CAGACTGATGACATCAATGATGG - Exonic
1122333366 14:100944817-100944839 GAGACTGATTAAATCAACCATGG - Intergenic
1123105084 14:105837519-105837541 CAGGCTGCCCACATCATCAAAGG + Intergenic
1126695326 15:51321089-51321111 CAGCCTGCTTACTTCATCCAGGG + Intronic
1130011707 15:80157507-80157529 CAGACTGCTCAGAACATGCAAGG - Intronic
1131013449 15:89038535-89038557 CAGCCTGCTGACCTCAGCCAGGG - Intergenic
1132520282 16:384103-384125 CGGACTGCACCCAGCAACCAAGG + Intronic
1136673292 16:31876892-31876914 CAGCCTGCTCACCCCATCCATGG + Intronic
1139447232 16:67005372-67005394 CAGACTGCTCACTACCACCGAGG + Exonic
1141880133 16:86852596-86852618 CAGACTGCTAACACCAACATGGG + Intergenic
1144848564 17:18232685-18232707 CAGACTGCTGTCATCAAGCAGGG - Exonic
1145417640 17:22734719-22734741 CAGACTGCTCAATTCAAAGAAGG - Intergenic
1149209185 17:54284815-54284837 CAGACTGATAACATCAATGAAGG + Intergenic
1150876070 17:68971704-68971726 CCGACTCCTCACATGAACCCTGG - Intergenic
1151534440 17:74730686-74730708 CAGTCTGCTCTCAGCAGCCAGGG + Intronic
1152531924 17:80923750-80923772 CAGGCTGCTCACATCACCATGGG + Intronic
1154054237 18:10995862-10995884 CATACTGCTCACATGAATCTAGG + Intronic
1156600806 18:38603833-38603855 CAGTCTGCTCACAGCAAGAATGG - Intergenic
1158551327 18:58438542-58438564 CTGACTGCTCACATCAGACAAGG - Intergenic
1159135933 18:64337096-64337118 CAGAGTGCTCATATCTAGCAGGG + Intergenic
1163543480 19:17926235-17926257 CAGAATGACCACATCAAACAGGG - Intergenic
1163884536 19:19954162-19954184 CAGCCTGCTCACCCCAGCCATGG - Intergenic
1163908672 19:20169469-20169491 CAGCCTGCTCACCCCACCCATGG + Intronic
1163957729 19:20659903-20659925 AAGACTGCTCACCCCAGCCACGG - Intronic
1163983839 19:20926648-20926670 CAGCCTGCTCACCCCAGCCATGG + Intronic
1163999662 19:21085694-21085716 CAGTCTGCTCACCCCAGCCATGG + Intronic
1164030644 19:21400644-21400666 CAGCCTGCTCACTCCAGCCATGG + Intronic
1164123617 19:22290194-22290216 CAGCCTGCTCACCCCAGCCATGG + Intronic
1164272147 19:23682583-23682605 CAGCCTGCTCACCCCAGCCATGG - Intronic
1164309621 19:24034287-24034309 CAGCCTGCTCACAATAGCCATGG + Intronic
1164839314 19:31380629-31380651 CAGCCTCCTCTCAGCAACCACGG - Intergenic
925085199 2:1102309-1102331 CAGCCTCCTCACAACAGCCAGGG - Intronic
928924525 2:36564455-36564477 CAGAGTGAACACATCAGCCAAGG + Intronic
937975417 2:127579439-127579461 CAGACTGCACACTTCGGCCAGGG + Intronic
940331150 2:152476145-152476167 CACACTGCTGACATCATCCAAGG - Intronic
944080519 2:195783118-195783140 CAGAAAACTCACATCAACCAAGG + Intronic
944320488 2:198335427-198335449 CAGGCTGCTCACATTGATCAGGG - Intronic
944650435 2:201824870-201824892 AAGACTGCTTACATCAAGTATGG - Intronic
944900247 2:204206583-204206605 CAGACTGCTCTCTTCCACCATGG + Intergenic
946101079 2:217324059-217324081 AAGACTTCTCACAGCAACAATGG - Intronic
948751416 2:240135564-240135586 CAGAACGCTCACATCAGACAAGG + Intronic
1173039416 20:39447151-39447173 GAGACTGCTCACCTGGACCATGG + Intergenic
1173892327 20:46522552-46522574 CACACTGCCCACAACATCCAAGG - Intergenic
1176293084 21:5056431-5056453 CAGGCTACTGACATCAATCATGG - Intergenic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1177736776 21:25100912-25100934 AACACTGCTTACATCAAGCATGG - Intergenic
1177779522 21:25607583-25607605 CAGACTGCTCGCCTCCACCGGGG + Intergenic
1179800146 21:43807938-43807960 CCGACTCCTCACAACAAACAGGG - Intergenic
1179864176 21:44207219-44207241 CAGGCTACTGACATCAATCATGG + Intergenic
1183669457 22:39263983-39264005 CAGTTTCCTCACATCTACCATGG + Intergenic
1183937727 22:41273171-41273193 TTGCCTGCTCACAGCAACCAGGG - Intronic
1184567200 22:45299156-45299178 CAGCCTGCTCACAGCCAACAGGG + Intergenic
1185085188 22:48737131-48737153 CAGAGTCCTCACATCAACAGAGG - Intronic
949494470 3:4619106-4619128 CAGACATCTCACAGCAACCCTGG - Intronic
950020882 3:9786994-9787016 TAGGCTGCTCACCTCCACCAGGG + Exonic
950716118 3:14848835-14848857 CTGACTTCTCACACCAGCCAGGG - Intronic
950933422 3:16813757-16813779 CAGATAGCTCACAGCAACGATGG + Intronic
951030247 3:17873424-17873446 TAAACTGCTCCCATCAACCTGGG - Intronic
954706714 3:52484873-52484895 CTGCCTGTTCCCATCAACCAAGG - Intronic
957183642 3:76914238-76914260 TAGATTGCACACATCTACCAAGG + Intronic
957452360 3:80395969-80395991 CAGACTGCTCTCAAAAACCTGGG - Intergenic
959015522 3:101129950-101129972 CACACTCCTCTCATAAACCAAGG + Intergenic
962239899 3:133743501-133743523 CAGAGTGTACACATCCACCAGGG - Intergenic
963519752 3:146349003-146349025 CAGACAGCTCACCTCCAACATGG + Intergenic
967046965 3:185746317-185746339 CTAACTGCTCACAGCGACCATGG + Intronic
969882563 4:10187266-10187288 CAGACATCTCACATTCACCAGGG - Intergenic
979234923 4:118388780-118388802 CAGACGGCTCACATGAAACGAGG - Intergenic
980996446 4:139784159-139784181 TTGACTGCTCTCATCAACAAAGG - Intronic
989788443 5:45361246-45361268 CAGACTGGTCACTGCAACCTCGG + Intronic
990348076 5:54888660-54888682 CAAGCTGGTCACATCAACAATGG - Intergenic
995846012 5:116494538-116494560 CAGACTCCTCACCTCATGCATGG + Intronic
996434812 5:123422995-123423017 CGGACCGCTCACCGCAACCATGG - Exonic
998957890 5:147455241-147455263 CAGACTGGTCACATAATCCAAGG + Intronic
1003212526 6:4079647-4079669 CCGCCTGCTCACATCAAGCCAGG + Exonic
1005337095 6:24808149-24808171 CACACTGCTCATATCAGCCCTGG - Intronic
1006360953 6:33586778-33586800 CACAATGCTCACCTCCACCACGG - Intergenic
1006629680 6:35422153-35422175 CAGACTGCCAGCATCTACCATGG + Intronic
1007284699 6:40739149-40739171 CAGAGTGCTGACATCAACTATGG - Intergenic
1014680936 6:124429427-124429449 GAGACTTCTCACATCAGCCTAGG - Intronic
1020615636 7:10457264-10457286 CAGACTGCTCATGTCAACAATGG + Intergenic
1023520146 7:41041923-41041945 CACACTCCTCACATCCACTAAGG + Intergenic
1024255716 7:47538515-47538537 CAGACTGCTCCCCACATCCAAGG - Intronic
1025265624 7:57454528-57454550 CAGCCTGCTCACTCCAGCCATGG + Intronic
1025747186 7:64253411-64253433 CAGCCTGCTCACACCAGCAAAGG + Intronic
1025775646 7:64558509-64558531 CAGGCTGCTCACCCCAGCCATGG + Intronic
1025798551 7:64762341-64762363 CAGCCTACTCACCTCAGCCATGG + Intergenic
1025867971 7:65404109-65404131 CACACAGATCACATAAACCAAGG + Intergenic
1027856271 7:83515640-83515662 TAGACTGCTCACCTCAGCAATGG + Intronic
1031985403 7:128161363-128161385 CAGACAACTCACATCAACTGTGG - Intergenic
1036681545 8:10878020-10878042 GATACTGCTCACAGTAACCAAGG - Intergenic
1042438364 8:68794712-68794734 CAGACAGATCACTTGAACCAAGG - Intronic
1043142384 8:76605972-76605994 CACATTGCCCACAGCAACCATGG - Intergenic
1045278220 8:100725417-100725439 CAGACTGCTAACATCAAAAAGGG - Intergenic
1045278275 8:100726313-100726335 CAGACTGCTAACATCAAAGAGGG + Intergenic
1049341173 8:142113423-142113445 CAGAATTCCCACATCACCCACGG - Intergenic
1051294983 9:15585881-15585903 CAGAAGGCTCACTTGAACCAAGG + Intronic
1058387105 9:104449800-104449822 CAGACTGGTCAAATAAACCAGGG + Intergenic
1187419098 X:19119722-19119744 CACAATGATCACATCAGCCATGG + Intronic
1189554408 X:42127167-42127189 CAGAATGCTCACATGAATCTTGG - Intergenic
1189932791 X:46032905-46032927 GAGACTGCTCTCCTCAACCAAGG - Intergenic
1190593854 X:52033298-52033320 CTGACTCCTCATATAAACCAAGG + Intergenic
1190958899 X:55225938-55225960 CAGACAGCTCAGATCGATCAGGG + Intronic
1193927946 X:87513213-87513235 CAGAATGCTCAAATTAACTATGG + Intergenic
1195127636 X:101823463-101823485 GAGACTGCTCAGAGCAACAAGGG - Intergenic
1195937928 X:110143017-110143039 CAGGCTGCTCTCCCCAACCAAGG - Intronic
1197516770 X:127441894-127441916 CAGACTGCTCACAGAGACAAGGG - Intergenic