ID: 1097058666

View in Genome Browser
Species Human (GRCh38)
Location 12:56266627-56266649
Sequence ATGTCCCTCTAGAGAACCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097058664_1097058666 7 Left 1097058664 12:56266597-56266619 CCTTTCATATATACATTTATCCT 0: 11
1: 368
2: 730
3: 669
4: 1227
Right 1097058666 12:56266627-56266649 ATGTCCCTCTAGAGAACCTAAGG 0: 1
1: 0
2: 2
3: 8
4: 72
1097058663_1097058666 8 Left 1097058663 12:56266596-56266618 CCCTTTCATATATACATTTATCC 0: 10
1: 208
2: 555
3: 703
4: 1183
Right 1097058666 12:56266627-56266649 ATGTCCCTCTAGAGAACCTAAGG 0: 1
1: 0
2: 2
3: 8
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097058666 Original CRISPR ATGTCCCTCTAGAGAACCTA AGG Intergenic
911952241 1:104189279-104189301 TTGTCCCTCTCGAGAAATTAAGG - Intergenic
915846220 1:159268319-159268341 ATGTCCTTCAGGAGAACATAGGG + Intergenic
917642106 1:176992893-176992915 ATGTGACTCTATAGAAGCTAGGG + Intronic
919580000 1:199359501-199359523 ATGTTCCTGAAGAGAACATAGGG - Intergenic
920932623 1:210402694-210402716 ATGTGCCTATGGAGATCCTAGGG - Intronic
922759228 1:228115606-228115628 TTGTCCCTCTTGAGACTCTAAGG - Intergenic
1068183154 10:53548397-53548419 ATGACTGTCTAGAGAACCTTGGG - Intergenic
1068829842 10:61481010-61481032 ATGGCCCTGAAGAGAACATATGG + Intergenic
1069294272 10:66824781-66824803 ATCGCCGTCTAAAGAACCTAAGG + Intronic
1070570359 10:77636553-77636575 ATGTTCCACTAGAGCACCTAAGG + Intronic
1071460248 10:85887181-85887203 AGGTCCCTATAGACCACCTAGGG + Intronic
1071492773 10:86147222-86147244 ATGTCACTCTGGAGGACCTCAGG - Intronic
1075917656 10:126183101-126183123 ATGTTCCTTACGAGAACCTAAGG + Intronic
1077775823 11:5270435-5270457 TTGTCTCCCTAGAGAAACTAAGG - Intronic
1078906043 11:15688675-15688697 AAGTCCCTAGAGAGAACCAAAGG - Intergenic
1085191972 11:74634498-74634520 ATGTCAATTTAGAGAACCAATGG + Intronic
1092689443 12:11091283-11091305 ATGCCCCTCTCGTGAATCTATGG + Exonic
1092692802 12:11133299-11133321 ATGCCCCTCTTGTGAATCTATGG + Exonic
1097058666 12:56266627-56266649 ATGTCCCTCTAGAGAACCTAAGG + Intergenic
1098360322 12:69648200-69648222 ATCTCCCTCCAGAGAACCTAGGG - Intronic
1098360330 12:69648223-69648245 ACCTCCCTCCAGAGACCCTAGGG - Intronic
1100883619 12:99045239-99045261 ATGTGCCTCCATAGAACCTGAGG - Intronic
1103781110 12:123399323-123399345 AAGTCCCTTTAGAAAACCCAGGG + Intronic
1110668765 13:78150726-78150748 CTGTCCCTCTAGAGAACCCTGGG + Intergenic
1112222451 13:97504855-97504877 ATTGCCCACTAGAGAACCTCTGG + Intergenic
1120572648 14:86140863-86140885 ATGTCCATCTTGAGAACCCAAGG + Intergenic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1126564881 15:50084699-50084721 AGTTCCTTCTAGAGATCCTAGGG + Intronic
1127212129 15:56784158-56784180 ATGACCATCTAGAGACCCCAAGG - Intronic
1128185741 15:65642173-65642195 ATGTGCATCTAGAGAGCCTGGGG - Intronic
1132234336 15:100207780-100207802 ATGTCCATCAGGAGAAACTAAGG + Intronic
1147399511 17:40171734-40171756 CTGTCCTTCTACAGAACCTGAGG + Exonic
1149986330 17:61350073-61350095 ATGTGCCTCTAAGGAACTTAGGG + Intronic
1155168952 18:23252984-23253006 ATGTCCTTCTTGAGATCCGAGGG - Exonic
1166141985 19:40810170-40810192 ATCTCCCTGTAGGGAAACTAAGG - Intronic
1166185536 19:41136601-41136623 AAGTCCCTGTAGGGAAACTAAGG + Intergenic
925197685 2:1939981-1940003 GTGTCCCTCCAGAGAATCTGTGG + Intronic
925505279 2:4555421-4555443 ATTACCCTCAATAGAACCTATGG + Intergenic
926297465 2:11579108-11579130 ATGTGCCTCTACAGACCCTCTGG - Intronic
1169907473 20:10618145-10618167 ATGTCCCAGTACAGAACCAAGGG - Intronic
1170544969 20:17428098-17428120 ATGTTCCTCTGGAGAGCCCATGG + Intronic
951086890 3:18522038-18522060 CTGTCCCTCTAGAGAACCCTGGG + Intergenic
958927232 3:100172098-100172120 CTGTCCCTGTATAGAACCTGAGG + Intronic
959827803 3:110820250-110820272 ATGTTCTTCTAAAAAACCTATGG + Intergenic
962072555 3:132046635-132046657 TTGTTCCTCTAGAGAAGATAAGG + Intronic
962118315 3:132535343-132535365 ATGCCAGGCTAGAGAACCTATGG - Intronic
964014854 3:151932640-151932662 ATTTCCCTCTAAAAAACCTAGGG + Intergenic
966442375 3:179960091-179960113 CTGTCCATCTACAGAACCTAGGG + Intronic
967768357 3:193307264-193307286 ATATCCCTCTGGAGGACCTCAGG - Intronic
978505061 4:109447874-109447896 ATTCCCTTCTAGAGAATCTAAGG + Intronic
986746006 5:10745869-10745891 ATTTCCCTCTAGGAAACCTGGGG - Intronic
987438997 5:17932702-17932724 ATGTCCCACTGGAGAAACTGAGG + Intergenic
989785944 5:45329703-45329725 ATGTCCCACTGTAGAACCTTAGG + Intronic
990833068 5:59982471-59982493 ATGTGCCCCTAGACAATCTAAGG - Intronic
994178842 5:96741913-96741935 GTGTCCCTCTAGTGATCCTCAGG - Intronic
997428988 5:133824469-133824491 ATATCCCTCTAGAGATTCCAGGG + Intergenic
1001537184 5:172506329-172506351 ATGTCCCACTAGAGTATTTAGGG - Intergenic
1003262562 6:4533531-4533553 GTGTCCCTTTAGACAACATATGG - Intergenic
1003669376 6:8141974-8141996 ACTTCCCTCCAAAGAACCTAAGG - Intergenic
1004273902 6:14218915-14218937 GTGTACCTCTAGAGAACCGTGGG - Intergenic
1005167192 6:22938238-22938260 AATTCCTGCTAGAGAACCTAAGG - Intergenic
1009278518 6:61717050-61717072 AAGTCTCTCAAGAAAACCTAAGG - Intronic
1009890566 6:69675784-69675806 ACATCACTCTGGAGAACCTAAGG + Exonic
1018650741 6:165989273-165989295 ATGTCGCTGAAGTGAACCTAAGG + Intergenic
1025028258 7:55535544-55535566 ATGCACCTCTAGAGAACCCTAGG + Intronic
1026973682 7:74483119-74483141 ATGTCCATCTAGGGAAACCACGG - Intronic
1029382657 7:100223682-100223704 AGGTCCCGCTTGAGCACCTAGGG + Exonic
1046658104 8:116918720-116918742 ATGTCTCTCTAGGAAAACTAAGG + Intergenic
1048265274 8:132980120-132980142 TTGTCACTCTAGAGATCCCAAGG - Intronic
1050252137 9:3756265-3756287 ATGTGGCTCTAGAGAACGGAAGG - Intergenic
1052414895 9:28165684-28165706 ATTTCCCTCTAGAGAAGCTAAGG + Intronic
1053860889 9:42385362-42385384 ATGGCCCTCTCGAGATCATAAGG - Intergenic
1054162542 9:61684143-61684165 ATGTCCCTTTGCAGATCCTATGG - Intergenic
1059838246 9:118181723-118181745 ATTTGCCACAAGAGAACCTAGGG - Intergenic
1061674890 9:132210073-132210095 ATGTCCATCTTGACAACCCAGGG + Intronic
1186345616 X:8689312-8689334 ATGTCCTTCTAGAGCAACAATGG + Intronic
1191243312 X:58206381-58206403 CTCTCCCTCTAGAATACCTATGG - Intergenic
1192925091 X:75747649-75747671 ATATCTTGCTAGAGAACCTAGGG - Intergenic
1192981410 X:76348034-76348056 ATGCACTTCTAGAGAACATATGG + Intergenic
1194875511 X:99182723-99182745 CAGTCCCTCTAAAGAATCTAGGG + Intergenic
1196682823 X:118486224-118486246 ATGTTCCTCAAGATAACCTATGG - Intergenic
1196742602 X:119038644-119038666 ATGTTCCTCAAGATAACCTATGG - Intergenic
1202084420 Y:21120969-21120991 ATGTCACTCTACACAAACTATGG - Intergenic