ID: 1097061925

View in Genome Browser
Species Human (GRCh38)
Location 12:56291658-56291680
Sequence CCCAGATTCTCCCCTAATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097061922_1097061925 -8 Left 1097061922 12:56291643-56291665 CCTGAACTTCTACCTCCCAGATT 0: 1
1: 3
2: 25
3: 623
4: 5883
Right 1097061925 12:56291658-56291680 CCCAGATTCTCCCCTAATCCTGG 0: 1
1: 0
2: 0
3: 16
4: 156
1097061921_1097061925 -7 Left 1097061921 12:56291642-56291664 CCCTGAACTTCTACCTCCCAGAT 0: 1
1: 0
2: 1
3: 33
4: 457
Right 1097061925 12:56291658-56291680 CCCAGATTCTCCCCTAATCCTGG 0: 1
1: 0
2: 0
3: 16
4: 156
1097061920_1097061925 5 Left 1097061920 12:56291630-56291652 CCTCTGAATCATCCCTGAACTTC 0: 1
1: 1
2: 1
3: 19
4: 197
Right 1097061925 12:56291658-56291680 CCCAGATTCTCCCCTAATCCTGG 0: 1
1: 0
2: 0
3: 16
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097061925 Original CRISPR CCCAGATTCTCCCCTAATCC TGG Intronic
900529932 1:3148180-3148202 CCCAGCTTCTTCACTCATCCGGG - Intronic
900543649 1:3216642-3216664 CCCAGAGTCTCCCCAAACCTGGG + Intronic
900586163 1:3433292-3433314 CCCGGATTCTCCCCGCAGCCTGG - Intronic
901257316 1:7841349-7841371 ACCAGATTCTCCCCTTTCCCAGG + Intronic
903044594 1:20555164-20555186 CCCAGATCCCGTCCTAATCCTGG - Intergenic
903131008 1:21279471-21279493 CACAGATTCAGCCCTAATCCAGG + Intronic
903427358 1:23264076-23264098 CCAAGCTTCTCCCCTCATCTTGG + Intergenic
903745982 1:25586932-25586954 CCCAGACTGAGCCCTAATCCTGG + Intergenic
904598090 1:31659180-31659202 CCCAGATGCTCCACTCAGCCTGG - Intronic
907476389 1:54708786-54708808 CCCAGATACTGCCCCTATCCTGG + Intronic
911737877 1:101357529-101357551 GACAGCTTCTCCCCTACTCCTGG - Intergenic
915817038 1:158978880-158978902 CCCAGATTCTCACCTACTTGTGG - Intergenic
917629239 1:176876744-176876766 CCCAGATACTCTCGTCATCCTGG + Intronic
920543817 1:206799168-206799190 CCCCCCTTCTCCCCTAAACCTGG - Intronic
1063609222 10:7548903-7548925 CCCAGAAGCTCCCCTAATGAGGG + Intergenic
1073592850 10:104772753-104772775 CTCAGATTCTCACCTTTTCCTGG + Intronic
1075340416 10:121643317-121643339 CCAAGAATCTCCCCTGAGCCAGG - Intergenic
1080865734 11:36193292-36193314 CACAGCTTCTCTCCTAATTCAGG + Intronic
1083270522 11:61569952-61569974 CCCAGATGCTCCACTCACCCGGG + Intronic
1083783727 11:64931950-64931972 CTCAGTTTCTCCTCCAATCCCGG + Intronic
1084748130 11:71186266-71186288 CCCAGCCTCACCCCTACTCCTGG + Intronic
1084770577 11:71340496-71340518 CTCAGCTTCTGCCCTAATCCTGG + Intergenic
1086670447 11:89539959-89539981 CCCAGATTCTCAACTAATTATGG + Intergenic
1087150746 11:94857335-94857357 CCCAAATTCCACCCTTATCCCGG + Intronic
1087196361 11:95308055-95308077 CCCAGATTAAACCCTAATTCTGG + Intergenic
1089074041 11:115722946-115722968 CCCACTTTCTCCCCTACTCTTGG - Intergenic
1091286512 11:134411536-134411558 ACCAGCTCTTCCCCTAATCCCGG + Intronic
1092262893 12:6961968-6961990 CCCAGCTCCTCCCCTCATCCAGG + Intergenic
1093867600 12:24247466-24247488 CCCAAGTTCTCTCCTATTCCTGG - Intergenic
1095371664 12:41474736-41474758 CACCAATTCTGCCCTAATCCAGG - Intronic
1096209531 12:49753544-49753566 CCCAGATTCTCTCTCAATACAGG - Intronic
1097061925 12:56291658-56291680 CCCAGATTCTCCCCTAATCCTGG + Intronic
1097328964 12:58312442-58312464 GCCAGAATCTCCCCTACTCCTGG - Intergenic
1098003285 12:65968362-65968384 GCCATGTTCTCCCCAAATCCTGG + Intergenic
1098706161 12:73692415-73692437 CACAGATTATCCCATAACCCAGG - Intergenic
1100407651 12:94285275-94285297 GCCAGATTCTCCCCTTGCCCAGG + Intronic
1102656117 12:114483761-114483783 CTCATCTTGTCCCCTAATCCAGG + Intergenic
1103360459 12:120350570-120350592 CCCAGACTCTCCCCTCAACCTGG - Intronic
1105795517 13:23848574-23848596 CCCAGCTTCTCCCCTCTGCCAGG - Intronic
1110325555 13:74210840-74210862 CCCATGTTATCTCCTAATCCTGG + Intergenic
1113557935 13:111253658-111253680 CCCAGAGTCTCCACCAAGCCTGG + Intronic
1118923469 14:70170818-70170840 CCCACATTCTCCATTAGTCCAGG + Intronic
1124003613 15:25779502-25779524 CTCAGCTTCTCCCCTAGGCCTGG - Intronic
1124554065 15:30709259-30709281 CCCAGATTCTGCCCTAGTGCAGG + Intronic
1124677180 15:31696412-31696434 CCCAGATTCTGCCCTAGTGCAGG - Intronic
1125835752 15:42749238-42749260 CCCAGAATCTTCTCTGATCCAGG - Intronic
1126167453 15:45665967-45665989 CTCTGATTCTTCCCTGATCCGGG + Intronic
1127127536 15:55826437-55826459 CCCTGTTTCTGCCATAATCCAGG - Intergenic
1127448235 15:59088068-59088090 CCTAAATTCTCTACTAATCCTGG - Intronic
1129333878 15:74841131-74841153 CCCAGATTGACCCCTAAACCTGG + Intronic
1131560758 15:93437341-93437363 CCCAGCTGCTGCCCTGATCCAGG + Intergenic
1132056832 15:98657888-98657910 CTCAGATTGACCCCTATTCCGGG + Intronic
1133288758 16:4704161-4704183 CCCACCTTCTCCCATCATCCTGG - Intronic
1133692196 16:8227326-8227348 GCCAGAATGTCCCCTAATCTGGG - Intergenic
1136291273 16:29272968-29272990 AACAAATTCTCCCCTCATCCGGG - Intergenic
1137712496 16:50576018-50576040 CCCAGATGCTCCCCTACGGCAGG - Intronic
1139658148 16:68401574-68401596 CCAAGAATCTCCCTGAATCCTGG + Intronic
1139709688 16:68766411-68766433 CCCAGGCTCTCCCAAAATCCAGG + Intronic
1143355089 17:6321716-6321738 CCCAGATTCTCCCATCTTCTGGG + Intergenic
1144636553 17:16912874-16912896 CCCTGATTCTCCCCTAGTTTGGG - Intergenic
1145272138 17:21410364-21410386 CTCAGAATCTTTCCTAATCCAGG - Intronic
1145310345 17:21697829-21697851 CTCAGAATCTTTCCTAATCCAGG - Intronic
1145367529 17:22277683-22277705 GCCAGATTCTGCCATTATCCAGG - Intergenic
1146269814 17:31477386-31477408 CCCAGCTTCTCCCCAAGCCCAGG - Intronic
1146747561 17:35345778-35345800 TTCAGATTCTCCCCTCATCCCGG - Intergenic
1149810960 17:59671197-59671219 CCTAAATTCACCTCTAATCCTGG - Intronic
1150686589 17:67325954-67325976 CCCAGTTTCTCCTCCAATCTGGG + Intergenic
1152009334 17:77701360-77701382 CCCAGTTTCTCCACTAATGTTGG - Intergenic
1152266921 17:79300511-79300533 CACAGATTCTCCCCTCCTCCAGG - Intronic
1155571315 18:27196977-27196999 CCGAGATTCTACACTATTCCTGG + Intergenic
1156362763 18:36399044-36399066 CCCAAACTCTCCTCCAATCCTGG - Intronic
1157009735 18:43632453-43632475 CCCAGACTTTCTCCTAATACAGG + Intergenic
1157287564 18:46387476-46387498 ACAAGTTTCTCCCCTAGTCCTGG - Intronic
1158216294 18:55103723-55103745 CCCAAATTCACCCCTCATGCTGG - Intergenic
1160706811 19:533713-533735 ACCGGATTATCCCCTAATGCTGG - Intronic
1160792011 19:927384-927406 CCCAGATTCCCCCCTAGGTCAGG - Intronic
1163551873 19:17969844-17969866 CCCAGATCCTGCCCTCCTCCAGG - Intronic
1165769408 19:38370115-38370137 CCTGGCTTCTCCTCTAATCCTGG + Intronic
1166993778 19:46709303-46709325 CCCAGCTTTTCCCCGACTCCAGG + Intronic
1167715183 19:51138374-51138396 CCCTGGTTCTCACCTAATCAAGG + Intergenic
1168379192 19:55905925-55905947 CTTTGATTCTCCCCAAATCCAGG - Intronic
1168723583 19:58568978-58569000 CCCACATTCTCTCCCAGTCCTGG - Intronic
925364590 2:3303285-3303307 CCCAGAGGCTCCCCTTAGCCTGG - Intronic
927912873 2:26914114-26914136 CCCAGATTCTTCTGTAATACTGG - Intronic
928705560 2:33946132-33946154 CTCAGAATCTTTCCTAATCCTGG - Intergenic
928899798 2:36304684-36304706 CCTAGACTGTCTCCTAATCCTGG - Intergenic
929905205 2:46039816-46039838 CTCATATTCTCCACTGATCCAGG + Intronic
931158061 2:59657831-59657853 TCCAGAGTCTCCCCTACTGCAGG + Intergenic
932468688 2:71940022-71940044 CCCTGCTTCTGCCCTAACCCAGG + Intergenic
937649870 2:124307845-124307867 ACCAGAGTCTTCCCTAAACCTGG + Intronic
938150530 2:128878799-128878821 CCCAGCTTGTCCACTAATCTGGG + Intergenic
938583722 2:132669926-132669948 CCCACATTCTCCCGGAGTCCCGG + Exonic
939548738 2:143587253-143587275 CTCAGATTCTTCCCTCATCTTGG + Intronic
943040134 2:182794727-182794749 CCCAGAATTTACCCCAATCCGGG + Intergenic
944989281 2:205217058-205217080 CCAACATTCTTCCCTAATTCAGG + Intronic
945682745 2:212933716-212933738 CTCAGATGCTCCCCAAATCCTGG + Intergenic
945884792 2:215363692-215363714 CCCAGCAACTCCCCAAATCCTGG - Intronic
946121859 2:217523280-217523302 CCCAGCTTCACCCCTAACCCTGG - Intronic
946129436 2:217594393-217594415 TACAGATACTCCCCTGATCCTGG + Intronic
947596781 2:231417883-231417905 CCCATATGCTCTCATAATCCAGG + Intergenic
948533194 2:238626594-238626616 CCCATATTCTCCCCTCTGCCAGG + Intergenic
948608848 2:239154311-239154333 CCCAGAGTCTCCTCTTGTCCTGG - Intronic
948632127 2:239309093-239309115 CCCAGACTTTCGCTTAATCCCGG + Intronic
948756940 2:240165493-240165515 CCCTCAGTCTCCCCTAAGCCTGG - Intergenic
1173464209 20:43268338-43268360 CCCAGACTGAGCCCTAATCCTGG - Intergenic
1173540625 20:43848278-43848300 CCCAGAATCACCCCGACTCCAGG - Intergenic
1174676858 20:52366356-52366378 CCCAAATTATCACCCAATCCAGG - Intergenic
1175873249 20:62218182-62218204 CCCAGATCCTCCCTTAACTCCGG + Intronic
1180067453 21:45419664-45419686 CCCAGGTCCTCCCCTAAGCATGG - Intronic
1183457415 22:37930292-37930314 CTGAAAGTCTCCCCTAATCCTGG - Intronic
1183618673 22:38960148-38960170 CCCAGCTCCTCCCCAAATGCTGG - Intronic
1184221256 22:43101422-43101444 CCCAGATTATCACCCAAGCCGGG - Intergenic
951702188 3:25507724-25507746 CCCAGTGTCTCCCCTATCCCTGG - Intronic
952889024 3:38029085-38029107 CCCAGAGGCTCCCCAAAGCCTGG - Intronic
956273406 3:67471684-67471706 CCAAGGTTCTCCCCTAAAACTGG - Intronic
958815345 3:98908106-98908128 CCCAAAGTCTCCCCCAATCAAGG - Intergenic
959193151 3:103141553-103141575 ACCAGTTGCTCCCCAAATCCAGG - Intergenic
961810684 3:129519927-129519949 TCCACATCCTCCCCAAATCCTGG + Intronic
962271685 3:133982194-133982216 CCCAGATTGTTCCCTGGTCCAGG + Intronic
963326408 3:143868038-143868060 CCAAGAATCTCACCCAATCCTGG - Intergenic
969252102 4:5974673-5974695 CCCAGCTTCTCCTCAGATCCAGG + Intronic
973765671 4:54159816-54159838 CCCAGTTTCTCCTCTGTTCCTGG + Intronic
978252019 4:106642416-106642438 ACCACACTCTCCCCAAATCCAGG + Intergenic
979556705 4:122056098-122056120 CACAGATTCTGCTCTAACCCTGG - Intergenic
979689446 4:123545017-123545039 CCAAGTTTGTCCCCTAATCTTGG - Intergenic
981152154 4:141391708-141391730 CCCAGGTTCTCCTCAATTCCAGG + Intergenic
984189955 4:176593597-176593619 CACAGATTTTCCCTTCATCCAGG + Intergenic
987266106 5:16256676-16256698 CCCTGCTTCTCCCCACATCCGGG - Intergenic
989532062 5:42519280-42519302 CCCTTATTCTCCCATAATTCAGG - Intronic
992739053 5:79754826-79754848 TCCATATTCTCCCCTTCTCCTGG + Intronic
996603884 5:125297945-125297967 CCCAGATTATGCCCTTGTCCTGG - Intergenic
997348597 5:133212427-133212449 CTCTGATTTGCCCCTAATCCTGG - Intronic
1001304356 5:170560899-170560921 CCCAGATTCTCCCTCACTACAGG + Intronic
1001328491 5:170746147-170746169 CACAGACTCTCCCCTAAGCAGGG + Intergenic
1003024264 6:2539679-2539701 CCCAGATCCTCCCATAACTCTGG - Intergenic
1003630983 6:7786946-7786968 CACAGATGATCCCCGAATCCTGG + Intronic
1004285785 6:14319241-14319263 CCCAGAATCACCACTTATCCAGG + Intergenic
1007335081 6:41150064-41150086 CCAAGTTTCTCCCCAAATCTGGG + Intronic
1009918029 6:70020687-70020709 GCCAGCCTCTCCCCTAGTCCTGG - Intronic
1011173619 6:84535229-84535251 CCCAGATTCTCTCTTATTTCAGG + Intergenic
1011629211 6:89308564-89308586 CCCAGATTCCCCTATAAGCCAGG + Intronic
1013411719 6:109889337-109889359 TCCAGATTCTCGGCTAAACCAGG + Intergenic
1013665571 6:112344095-112344117 CCCAGATTCTCCATTATTACAGG - Intergenic
1013727283 6:113114454-113114476 CCGAGATTCTTCCCTTAGCCTGG - Intergenic
1015778973 6:136843857-136843879 CACACATTCTACCCTAGTCCTGG - Intronic
1017286244 6:152679836-152679858 CCAAGAATCTACCCTCATCCAGG + Intergenic
1018842028 6:167524264-167524286 GCCAGATGCTCCCCAAAGCCAGG - Intergenic
1023315097 7:38928325-38928347 CCCAGTATCTCCTCTAACCCTGG + Intronic
1026828727 7:73599245-73599267 CCCAGAAACTCCCCTTCTCCAGG + Intronic
1034466753 7:151234220-151234242 CCCGGATTGTCCCCTACTACAGG + Exonic
1036621065 8:10424740-10424762 CCCAGCACCTCCCCTAACCCAGG - Intronic
1037000192 8:13707965-13707987 CCCAGATTGGCCCCTAAACCAGG - Intergenic
1037926296 8:22846395-22846417 ACCAGATTCTCTCCCAATCCAGG - Intronic
1038063187 8:23935015-23935037 CCCAGGCTCTTCCCTATTCCAGG - Intergenic
1038119578 8:24597732-24597754 CCTTAATTTTCCCCTAATCCAGG - Intergenic
1041040787 8:53843861-53843883 CCCAAATTTTCCCCTAGTCCAGG + Intergenic
1041468958 8:58187319-58187341 CACAGTTTCTCCCTTTATCCTGG + Intronic
1041714183 8:60919165-60919187 CACAGATTTTACCCCAATCCTGG + Intergenic
1041940297 8:63380447-63380469 ATCAGATTCTCCCCTTATCCAGG + Intergenic
1043664820 8:82795777-82795799 CCCAAATTCTACCCAAATCTTGG - Intergenic
1045254550 8:100508716-100508738 CCCAGATTCTAACCTCCTCCTGG + Intergenic
1047890575 8:129303787-129303809 ACCAGATTCTCCCTCAATGCTGG - Intergenic
1050523657 9:6527238-6527260 CCCTGCTTCTCCTCTAGTCCTGG - Intergenic
1051038681 9:12779671-12779693 CTCAGATTCTGACCTCATCCTGG - Intronic
1053051063 9:34960703-34960725 TCCAGGCTCTCCCCTAATCTTGG + Intronic
1055770861 9:79715704-79715726 CCCAGAGGCTGCCATAATCCTGG + Intronic
1058161459 9:101574541-101574563 TCCAGATTGTCCCCTTCTCCTGG - Intronic
1059357332 9:113710196-113710218 CCCAGAGCCTCTCCTAAGCCTGG - Intergenic
1060944651 9:127562799-127562821 CCCAGCTTTTTCCCTAATGCTGG - Intronic
1061818249 9:133208640-133208662 CCCAGATTCTACTCTGACCCTGG + Intronic
1062242207 9:135546718-135546740 CCCAGATTCTACTCTGACCCTGG - Intronic
1195720758 X:107865600-107865622 CCCAGTTTCTCCCCTTATATGGG - Intronic
1201671164 Y:16522214-16522236 CCAAAATATTCCCCTAATCCAGG - Intergenic