ID: 1097063065

View in Genome Browser
Species Human (GRCh38)
Location 12:56300277-56300299
Sequence TGCACCAGAGGCCGCGCCGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 57}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097063065 Original CRISPR TGCACCAGAGGCCGCGCCGA CGG Exonic
900741152 1:4332171-4332193 AGCACCAGAGGCAGCACAGACGG + Intergenic
915165488 1:153945939-153945961 TGGGGCAGAGGGCGCGCCGAGGG + Intronic
920540018 1:206771163-206771185 TTCACCAGAAGCCTCCCCGAAGG + Intronic
922740932 1:228013911-228013933 TGCTCCAGAGGCCCCACAGAGGG + Intronic
923505214 1:234599964-234599986 TGCTCCAGAGAGCGCGCCGGCGG + Intergenic
1085126891 11:74008026-74008048 TGCACCAGATACCGTGCTGAGGG + Intronic
1085423207 11:76381067-76381089 TGCACCAGCGGCGGCGGCGGCGG - Intergenic
1090636934 11:128695087-128695109 TGCAACGGAGGCGGCTCCGAAGG - Intronic
1092585023 12:9890829-9890851 TGCACCAGAGGCTGGACCTATGG + Intronic
1097063065 12:56300277-56300299 TGCACCAGAGGCCGCGCCGACGG + Exonic
1104708504 12:130967689-130967711 AGCAACAGAGGCAGCACCGATGG - Intronic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1107468183 13:40667290-40667312 TGCAGTCGAGTCCGCGCCGAGGG + Intergenic
1113503804 13:110799147-110799169 TGCACCGGAAACCGCACCGAGGG - Intergenic
1114470378 14:22957117-22957139 TGCACTAGAGGCCGCGACGAAGG + Exonic
1115502229 14:34060201-34060223 TGCGCCCGCGGCCGCCCCGAAGG + Intronic
1120996543 14:90422286-90422308 TGCACCAGAGGATGGGCAGAGGG - Intergenic
1130335245 15:82952545-82952567 TGCTCCGGCGGCCGCTCCGACGG + Exonic
1132840672 16:1977170-1977192 CGCACCAGAGGCCACGCCGGTGG - Exonic
1133029206 16:3001628-3001650 AGCACCAGAGGCCAAGCCCAAGG - Intergenic
1140900046 16:79358860-79358882 TGCTGCAGAGGCTGCTCCGATGG + Intergenic
1142342976 16:89536243-89536265 AGCACCAGAGGCCACACTGAAGG - Intronic
1152627974 17:81396939-81396961 TCCAGGAGAGGCCGCGCCGGAGG - Intronic
1157320125 18:46627972-46627994 TGCACCAGAGCCTGCGCTCAGGG - Intronic
1157578483 18:48759374-48759396 TGCCCCAGAGGCCAGGCCCAGGG + Intronic
1160862203 19:1242126-1242148 GGCAGCAGAGGCAGGGCCGAGGG - Intronic
1160957136 19:1698930-1698952 TGCCCCATGGGCCGCGCCGCAGG + Intergenic
1160977385 19:1799946-1799968 TGCATCAGCGGCCGCGTCTATGG - Exonic
1161189527 19:2945315-2945337 CGCACGAGGGGCCGCTCCGAGGG - Intergenic
1162572351 19:11480699-11480721 CGCACCAGAGGCCGCCCGGGCGG - Exonic
1166873968 19:45886139-45886161 TGCCCCAGAGGCCGCTTCGCAGG + Exonic
1167643638 19:50694910-50694932 TGTACCAGACGCTGCGCCGCCGG + Intronic
926101301 2:10120149-10120171 TGTACCAGACGCCGTGCCGAAGG - Intergenic
945922598 2:215770878-215770900 TGCACAAGAGGCCTCGCCACAGG + Intergenic
948860041 2:240748425-240748447 TGCACCAGAGGCCGTGGGGCCGG - Intronic
1171892338 20:30728216-30728238 TCCACCTGAGGCCGCGCCCCTGG + Intergenic
1174081479 20:47973417-47973439 TGGACCAGATGCAGCGCCGACGG - Intergenic
1174135019 20:48373469-48373491 TGGACCAGATGCAGCGCCGACGG + Intergenic
1176389631 21:6156900-6156922 TGCCCCAGAGGCCCCACCAAAGG - Intergenic
1178948473 21:36966858-36966880 AGCTCCGGAGGCCGCGCCCAGGG + Intronic
1179733837 21:43381338-43381360 TGCCCCAGAGGCCCCACCAAAGG + Intergenic
1181043713 22:20204822-20204844 TGCACCAGAGGCTGCCACCAGGG - Intergenic
1182237009 22:28883829-28883851 TGCACCGGAGGCCGCGGGGGCGG - Exonic
1184944794 22:47795560-47795582 TGTCCCTGAGGCCGGGCCGATGG + Intergenic
1185288521 22:50012976-50012998 TGCACCAGTGGCCGCCCTGTGGG - Intergenic
956114468 3:65904483-65904505 GGCAGCAGAGGCCGGGCCGCAGG - Intronic
961168554 3:124780085-124780107 TGCCTCAGAGGCCTCGCTGAGGG - Intronic
961637541 3:128342712-128342734 TGCACCACAGGACCAGCCGAGGG - Intronic
972333586 4:38085588-38085610 TGCAGCGGAGGCTGAGCCGAAGG - Intronic
974549269 4:63349778-63349800 TGCGCCAGATGCAGCGCCAAGGG - Intergenic
981081619 4:140643600-140643622 TGCGGCAGAGGCAGCGCCGGAGG - Intronic
981920537 4:150079813-150079835 TGCACCAGGGTCCACACCGAGGG - Intronic
990481920 5:56220028-56220050 TGCACCGGAGGCTGAGCTGAGGG + Intronic
1008276620 6:49550702-49550724 TGCAGCAGAGGCCACACCCAGGG + Exonic
1010833384 6:80557264-80557286 TGCACCAGAGGCCATGCCAATGG + Intergenic
1018769365 6:166957474-166957496 TGCACCCGCGGCCCCGCCCACGG + Intergenic
1022230547 7:28409171-28409193 TGCACCAGGGTCCGCGCGGGCGG + Intronic
1025997604 7:66537851-66537873 TGCACCAGAGGCAGCTCCTTGGG - Intergenic
1026990480 7:74582342-74582364 TGCACCAGAGGCAGCTCCTTGGG - Intronic
1035583353 8:753945-753967 TGCACCTGACACCGCGCCCAGGG - Intergenic
1039433717 8:37545477-37545499 CGCCCCAGAGGCCTCTCCGAAGG + Intergenic
1045803820 8:106133303-106133325 TTCACCAGAAGCCGAGCAGAAGG + Intergenic
1057361125 9:94374676-94374698 GGCGCCAGCGGCGGCGCCGAGGG - Exonic
1061664465 9:132152381-132152403 TTCCCCAGTGGCCGCGCCGCTGG + Intergenic