ID: 1097063065

View in Genome Browser
Species Human (GRCh38)
Location 12:56300277-56300299
Sequence TGCACCAGAGGCCGCGCCGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 57}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097063065 Original CRISPR TGCACCAGAGGCCGCGCCGA CGG Exonic