ID: 1097073848

View in Genome Browser
Species Human (GRCh38)
Location 12:56377402-56377424
Sequence TAGGTTTCACAGGATGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097073842_1097073848 14 Left 1097073842 12:56377365-56377387 CCTAGAGATTAGAAAAATGGCAC No data
Right 1097073848 12:56377402-56377424 TAGGTTTCACAGGATGCAGCAGG No data
1097073846_1097073848 -8 Left 1097073846 12:56377387-56377409 CCAAGGGTGTTTATCTAGGTTTC No data
Right 1097073848 12:56377402-56377424 TAGGTTTCACAGGATGCAGCAGG No data
1097073841_1097073848 15 Left 1097073841 12:56377364-56377386 CCCTAGAGATTAGAAAAATGGCA No data
Right 1097073848 12:56377402-56377424 TAGGTTTCACAGGATGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097073848 Original CRISPR TAGGTTTCACAGGATGCAGC AGG Intergenic
No off target data available for this crispr