ID: 1097076998

View in Genome Browser
Species Human (GRCh38)
Location 12:56402414-56402436
Sequence AGTTATCGCCAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097076998_1097077001 15 Left 1097076998 12:56402414-56402436 CCTGCCATCTTCTGGCGATAACT No data
Right 1097077001 12:56402452-56402474 GACAGCTCTTGACCTGTTACTGG 0: 5
1: 171
2: 192
3: 142
4: 192
1097076998_1097077002 16 Left 1097076998 12:56402414-56402436 CCTGCCATCTTCTGGCGATAACT No data
Right 1097077002 12:56402453-56402475 ACAGCTCTTGACCTGTTACTGGG 0: 5
1: 184
2: 199
3: 165
4: 198
1097076998_1097077003 25 Left 1097076998 12:56402414-56402436 CCTGCCATCTTCTGGCGATAACT No data
Right 1097077003 12:56402462-56402484 GACCTGTTACTGGGCTTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097076998 Original CRISPR AGTTATCGCCAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr