ID: 1097077192

View in Genome Browser
Species Human (GRCh38)
Location 12:56403785-56403807
Sequence ATGCTGATTCAGAGCGTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097077192_1097077195 17 Left 1097077192 12:56403785-56403807 CCATGTACGCTCTGAATCAGCAT No data
Right 1097077195 12:56403825-56403847 CTCCCATAGCCAGGATTCACAGG 0: 125
1: 202
2: 185
3: 155
4: 259
1097077192_1097077198 23 Left 1097077192 12:56403785-56403807 CCATGTACGCTCTGAATCAGCAT No data
Right 1097077198 12:56403831-56403853 TAGCCAGGATTCACAGGTTCAGG 0: 7
1: 73
2: 161
3: 208
4: 323
1097077192_1097077194 8 Left 1097077192 12:56403785-56403807 CCATGTACGCTCTGAATCAGCAT No data
Right 1097077194 12:56403816-56403838 TGTTAGTTTCTCCCATAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097077192 Original CRISPR ATGCTGATTCAGAGCGTACA TGG (reversed) Intergenic
No off target data available for this crispr