ID: 1097079800

View in Genome Browser
Species Human (GRCh38)
Location 12:56421726-56421748
Sequence GAGGAATTCCGGGACTCAGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097079800_1097079808 29 Left 1097079800 12:56421726-56421748 CCATCTGAGTCCCGGAATTCCTC 0: 1
1: 0
2: 1
3: 6
4: 133
Right 1097079808 12:56421778-56421800 CCCCCGTCCACAGTACAATATGG 0: 1
1: 0
2: 0
3: 1
4: 43
1097079800_1097079810 30 Left 1097079800 12:56421726-56421748 CCATCTGAGTCCCGGAATTCCTC 0: 1
1: 0
2: 1
3: 6
4: 133
Right 1097079810 12:56421779-56421801 CCCCGTCCACAGTACAATATGGG 0: 1
1: 0
2: 0
3: 1
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097079800 Original CRISPR GAGGAATTCCGGGACTCAGA TGG (reversed) Exonic
900815901 1:4845542-4845564 GTGTAAATCCAGGACTCAGATGG - Intergenic
902160195 1:14523669-14523691 GAGGAAGTAAGGGATTCAGAAGG - Intergenic
904142339 1:28363501-28363523 GAGGCATTACAGAACTCAGATGG + Intergenic
905549536 1:38825175-38825197 GAGGAATTCCTGCAGTGAGAAGG + Intergenic
906518210 1:46452062-46452084 AAGCAATGCCAGGACTCAGAGGG - Intergenic
906653648 1:47532734-47532756 GAGGATTTCAGGGCATCAGAAGG + Intergenic
912410917 1:109480183-109480205 GAGGCCTTCCTGGACTCAGCTGG + Exonic
914431173 1:147620975-147620997 GAGGGATCCCAGGACTCTGAAGG - Exonic
916123452 1:161549453-161549475 GAGTGATTCTGGGACCCAGAGGG + Intronic
920134284 1:203757046-203757068 GAGGAAACCCAGGTCTCAGAAGG + Intergenic
1063044151 10:2374704-2374726 AAGGAATGCAGGGATTCAGACGG + Intergenic
1063365974 10:5491142-5491164 GTGGAATTCAAGGGCTCAGAAGG - Intergenic
1064130753 10:12707633-12707655 GGGGAATTCCAGAACTTAGAGGG + Intronic
1070992266 10:80742805-80742827 GAGGGATTGCAGGACTCAAAAGG + Intergenic
1073856485 10:107681073-107681095 GAGGAATACAGAGACTCAGTTGG - Intergenic
1075395896 10:122126871-122126893 CAGGAATTTCGGGGCTGAGAGGG - Intronic
1075637224 10:124037496-124037518 GGAGAATTCCCTGACTCAGAGGG + Intronic
1078371280 11:10748136-10748158 GAGGAATTCTAGCACACAGAGGG - Intergenic
1080608225 11:33882343-33882365 GGGGATTTCTGAGACTCAGAGGG - Intronic
1081740601 11:45437018-45437040 GGGGAATTCTGAGACTCGGAGGG + Intergenic
1081998313 11:47378290-47378312 GAGGAGTCCCGGTACTCACAGGG + Exonic
1082083037 11:48026860-48026882 GTGGACTTCGGGGACTCAGAGGG - Intronic
1088240655 11:107770592-107770614 AAGGAAGGCTGGGACTCAGAAGG + Intergenic
1088421802 11:109656760-109656782 GAGGAATTTGGGGTCTGAGAAGG + Intergenic
1090409080 11:126495329-126495351 GAGGATCTCTGGGGCTCAGAGGG - Intronic
1094262553 12:28517798-28517820 GTGGACTTTCGGGACTCAGGGGG - Intronic
1096633159 12:52942559-52942581 GAGGAAGCCCGGGACTGAGGTGG - Intronic
1097079800 12:56421726-56421748 GAGGAATTCCGGGACTCAGATGG - Exonic
1105783781 13:23727690-23727712 GAGGAATTCTAGAATTCAGAGGG + Intergenic
1106136095 13:26974873-26974895 GTGGACTTTGGGGACTCAGAGGG - Intergenic
1108518544 13:51224013-51224035 GAGGAAGTCCTGGACCCAGGGGG + Intronic
1110671904 13:78190465-78190487 GAGAATTTCTGTGACTCAGAAGG + Intergenic
1110755776 13:79172129-79172151 GTGGAATTTGGGGACTCAGGGGG - Intergenic
1112124891 13:96454085-96454107 GCGGAAACCCTGGACTCAGAAGG - Intronic
1118480168 14:66156778-66156800 TAGGCATTCAGGGACTCAGAGGG - Intergenic
1119531522 14:75364692-75364714 TAGCAAGTCTGGGACTCAGATGG + Intergenic
1123134350 14:106013099-106013121 AAAGAATTCCAGGACTCAAAAGG - Intergenic
1123584375 15:21743543-21743565 AAAGAATTCCAGGACTCAAAAGG - Intergenic
1123621022 15:22186150-22186172 AAAGAATTCCAGGACTCAAAAGG - Intergenic
1124685486 15:31778229-31778251 CAGGAATTCCGGGGGTCAGCAGG + Intronic
1131312119 15:91300288-91300310 GGGGACTTCCAGGATTCAGATGG - Exonic
1136284176 16:29231545-29231567 GAGGATCCCCGGGACACAGAGGG - Intergenic
1138685367 16:58720666-58720688 GAGGAATCCTGGAACCCAGAAGG - Intronic
1141720852 16:85754469-85754491 AAGGAAAGACGGGACTCAGAGGG - Intergenic
1144961031 17:19044234-19044256 GAGAATTCCCGGGTCTCAGAGGG - Intronic
1144974130 17:19130290-19130312 GAGAATTCCCGGGTCTCAGAGGG + Intronic
1149105230 17:52955467-52955489 GTGGACTTTGGGGACTCAGAGGG + Intergenic
1150766499 17:68006372-68006394 ATGGAATTTGGGGACTCAGAGGG - Intergenic
1151692691 17:75696602-75696624 GATTCATTCCAGGACTCAGAAGG + Intronic
1152672993 17:81619972-81619994 CAGGAAATCCAGGACACAGAGGG + Intronic
1153602855 18:6798669-6798691 ATGGACTTCGGGGACTCAGAGGG + Intronic
1161865919 19:6832197-6832219 GAGGAAGACGGGGACTCACATGG - Exonic
1163385968 19:17000766-17000788 GAGGAACTCTGGAACTGAGAAGG + Intronic
1165806920 19:38586028-38586050 GAGGGATTACGGGATTCAGGGGG + Intronic
1166186843 19:41145294-41145316 GAGGACTTCGGGGACTCAGAGGG - Intergenic
1167422829 19:49414085-49414107 CAGCATTTCAGGGACTCAGATGG + Intronic
1167456916 19:49601261-49601283 GAGACATTCCAGGACTGAGAAGG + Intronic
1168309288 19:55452483-55452505 CAGGAGTTCCGGGACCCACATGG - Intergenic
925538825 2:4944501-4944523 GAGGAGTTCTGGAACTCTGAAGG + Intergenic
926772083 2:16387292-16387314 GAGTAAATCCAGGACTCAGTGGG + Intergenic
928388023 2:30885921-30885943 GAGGAATTCTGGGGCTCAAAGGG - Intergenic
937278816 2:120703576-120703598 GAGGAAGGCCAGGGCTCAGAGGG - Intergenic
942381546 2:175396652-175396674 GATGAAGTCTGGGACTCACAAGG + Intergenic
944512680 2:200479990-200480012 TATGAATTCAGGGCCTCAGATGG - Exonic
948167759 2:235876477-235876499 GAGGAAGTCCGGGAGACGGAGGG - Intronic
948603311 2:239119694-239119716 GAGGTGTTCAGGGCCTCAGAGGG + Intronic
948842280 2:240658331-240658353 AAGGACTTTGGGGACTCAGAGGG - Intergenic
1169229211 20:3875839-3875861 GAGGAAATCAGTGATTCAGATGG - Exonic
1169330139 20:4709872-4709894 GAGGAATACGGCGACTCCGACGG - Intergenic
1171964274 20:31517477-31517499 CAGGAGTTCCGGGACAAAGAAGG + Intronic
1173093044 20:39994036-39994058 GAGGACTTGAGGGACACAGATGG - Intergenic
1175483575 20:59328645-59328667 GAGGAAAACCGGGGCACAGAGGG + Intergenic
1175814851 20:61878010-61878032 GAGGACTTCGTGGACACAGACGG + Intronic
1175938044 20:62524017-62524039 GAGGAACTAGGGGCCTCAGAGGG + Intergenic
1177226646 21:18265501-18265523 GTGGACTTTGGGGACTCAGAGGG + Intronic
1180107943 21:45632139-45632161 GAGGACTTCCTGCACCCAGAGGG + Intergenic
1183594217 22:38800330-38800352 GAGGAATACAGACACTCAGAAGG + Intergenic
1183899320 22:40993119-40993141 GTGGAATTTAGGGAATCAGACGG + Intergenic
949401314 3:3667769-3667791 GAGGAAACCTGGGACTCAGGAGG - Intergenic
951508286 3:23473596-23473618 GTGGACTTCGGGGACTCAGTGGG - Intronic
953117188 3:40004642-40004664 GTGGACTTTGGGGACTCAGAAGG - Intronic
954693371 3:52407548-52407570 GAGGCATTCCAGGAATCGGAAGG + Intronic
956455979 3:69420950-69420972 GAGGAAGTCAGGGACGGAGAGGG + Intronic
962816472 3:139005606-139005628 GCGGAATTCCGGGTCGAAGAAGG + Exonic
962891974 3:139679818-139679840 GTGGACTTTGGGGACTCAGAGGG + Intergenic
963403443 3:144832585-144832607 GGGGAATTCTGAGAATCAGAGGG - Intergenic
966736902 3:183194014-183194036 GAGGAATTCATGGTCTCATAGGG + Intronic
966867103 3:184264511-184264533 TATGAATTCCGCCACTCAGAAGG + Intronic
968652673 4:1766431-1766453 GAGGGTTGCCGGGACTCAGCAGG - Intergenic
971450466 4:26795628-26795650 GAGGAAGTCCTGGGCACAGAGGG + Intergenic
974102895 4:57437196-57437218 GAGGAATAGAGGGACTCAAATGG + Intergenic
975670472 4:76775118-76775140 AAGGACTTCGGGGACTCAGCGGG - Intronic
983043796 4:162960769-162960791 AAGGAAGCCAGGGACTCAGATGG - Intergenic
983839396 4:172437827-172437849 TAAAAATTCTGGGACTCAGACGG - Intronic
985788922 5:1915126-1915148 GAGCAATGCGGGGACTCAGGGGG - Intergenic
987017740 5:13837436-13837458 GAGGAAATCCTGGAGTCAGTGGG + Intronic
987335704 5:16896110-16896132 GAGTAATCTCAGGACTCAGAAGG + Intronic
989020199 5:36996428-36996450 GAGGAATTCCAGGACACAGCTGG - Intronic
989952168 5:50312361-50312383 AAGGAATTCTGGGACTCATATGG + Intergenic
990573463 5:57102429-57102451 ATGGACTTTCGGGACTCAGAGGG + Intergenic
992839320 5:80671716-80671738 GAGGAAATCAGGGAATCACATGG + Intronic
993441927 5:87967800-87967822 GTGGAATTTGGGGACTCAGGGGG + Intergenic
1002254423 5:177948821-177948843 GAGGTCTCCCGGGAGTCAGAGGG - Intergenic
1002483570 5:179518991-179519013 GAGGTCTCCCGGGAGTCAGAGGG + Intergenic
1006173549 6:32108882-32108904 GAGGGACTCCGGGAGTCAGATGG - Intronic
1007040353 6:38715740-38715762 GTGGACTTCGGAGACTCAGAAGG + Intronic
1007326506 6:41065128-41065150 GTGGAATTCTGGGACTTAGCAGG - Exonic
1007418491 6:41705858-41705880 GAGGGATTTCCGGACCCAGAGGG - Intronic
1017697210 6:157028775-157028797 GAAGAATAGCGGCACTCAGAAGG - Intronic
1018880579 6:167875459-167875481 CAGGAATTTCGGAGCTCAGATGG + Exonic
1022856058 7:34315762-34315784 AAGAAAGTCCGGGACTCAGCTGG + Intergenic
1027358364 7:77382427-77382449 AAGGAATTCCAGGTCTCATATGG + Intronic
1029568408 7:101354996-101355018 GTGGAATATCGGGACTCCGAGGG + Intergenic
1029861816 7:103580742-103580764 GTGGACTTTGGGGACTCAGAGGG - Intronic
1031186517 7:118487756-118487778 GTGGACTTTGGGGACTCAGAGGG + Intergenic
1032449330 7:132016073-132016095 GTGGACTTTGGGGACTCAGAGGG + Intergenic
1032462625 7:132123038-132123060 GAGGGATTCCGGGACTGACTGGG + Intergenic
1040331922 8:46390032-46390054 GAGGGCTGCAGGGACTCAGAGGG + Intergenic
1040337051 8:46421328-46421350 GAGGGCTGCAGGGACTCAGAGGG + Intergenic
1041463159 8:58133518-58133540 GAGGAAGGATGGGACTCAGAGGG + Intronic
1041777270 8:61537081-61537103 GAGGGCTTCAAGGACTCAGATGG + Intronic
1042212717 8:66397547-66397569 GTGGATTTGGGGGACTCAGAGGG + Intergenic
1042769447 8:72363822-72363844 GAGGAACTCATGGACACAGAGGG - Intergenic
1044662805 8:94608089-94608111 GTGGACTTTTGGGACTCAGAGGG + Intergenic
1045015280 8:97996237-97996259 CAGAAATTAAGGGACTCAGATGG - Intronic
1047876957 8:129149137-129149159 GATCAGTTCAGGGACTCAGAAGG - Intergenic
1048179746 8:132184060-132184082 GAGGAATTTGAGGACCCAGAAGG + Intronic
1048801010 8:138193810-138193832 GAGGAATCCCAGGCCCCAGAGGG + Intronic
1049050283 8:140189241-140189263 GAGGAATTCCTGGAGACAGCAGG - Intronic
1057548228 9:96033881-96033903 GAAGCATACCGGGGCTCAGAAGG + Intergenic
1057891656 9:98874379-98874401 GAGGAGTGACGGGACTCAGGAGG + Intergenic
1059142303 9:111864890-111864912 GTGGACTTCGGGGACTCAGGGGG + Intergenic
1187200030 X:17125957-17125979 GACGAGTACCTGGACTCAGATGG + Intronic
1191944817 X:66521352-66521374 ATGGAATTCAGGGACTCAGCAGG - Intergenic
1193792108 X:85827404-85827426 GTGGACTTCGGGGACTCAGGGGG + Intergenic
1193912927 X:87327720-87327742 CAGGAAGTCTGGGACTCACAGGG - Intergenic
1196155766 X:112427934-112427956 ATGGACTTCGGGGACTCAGAGGG - Intergenic
1196843590 X:119880824-119880846 GAGGAATTCCGACACCCAGGGGG - Intergenic
1198235328 X:134731723-134731745 TAGGAATTTCAGGAATCAGAAGG - Intronic
1200783209 Y:7235613-7235635 GAGGAATTCAGGAACTGACATGG - Intergenic
1200806584 Y:7439777-7439799 AAGGACTTCGGGAACTCAGAGGG + Intergenic