ID: 1097081150

View in Genome Browser
Species Human (GRCh38)
Location 12:56432026-56432048
Sequence CTGTGGATATGCTGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 1, 2: 4, 3: 65, 4: 416}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097081150 Original CRISPR CTGTGGATATGCTGGGCAGA GGG Intronic
900183784 1:1323952-1323974 CTGGGGGTCTGCTGGGCTGAGGG + Intronic
900183802 1:1324000-1324022 CTGAGGGTCTGCTGGGCTGAGGG + Intronic
900767773 1:4516784-4516806 CTGGGGACAAGGTGGGCAGAGGG + Intergenic
900964160 1:5945926-5945948 GTGTGGATATGCGGGACGGAGGG - Intronic
901317823 1:8320886-8320908 GTGGGGAGAGGCTGGGCAGAGGG + Intronic
901911125 1:12459112-12459134 CTGTGGATATGGAGAGCTGATGG - Intronic
902334332 1:15746524-15746546 CTGGGAATGTGCTTGGCAGAAGG + Intronic
902851786 1:19164252-19164274 CTGTGGATTGGCTGAGCAGATGG - Exonic
904624131 1:31792689-31792711 CTGGGCAGATGCTGGCCAGAAGG + Exonic
904668573 1:32144250-32144272 GTGTGGATATACTGGACAAAGGG + Intronic
904800874 1:33092303-33092325 CTGTGGGGAGGCTGGGCTGAGGG + Intronic
904887029 1:33746646-33746668 CTGTGTATGTGTTGGGGAGAGGG - Intronic
905245537 1:36610642-36610664 CTCTGGCTTCGCTGGGCAGAGGG + Intergenic
905492102 1:38352723-38352745 CTGTGGACACTCTAGGCAGATGG - Intergenic
907231561 1:53004118-53004140 ACTTGGATATGCTGGGCAAAGGG + Intronic
908168025 1:61477240-61477262 GTGTGGATCTGCTGGACAAAGGG + Intergenic
908594700 1:65674725-65674747 GGATGGATATGCTGGACAGAGGG - Intergenic
908806172 1:67935738-67935760 GTGTGGATATGCTGGACTGAGGG - Intergenic
909423806 1:75497492-75497514 AGGTGGAGATGCTGGGCAAATGG + Intronic
911507810 1:98775300-98775322 CAGTGGACATGCTGGACAAAGGG + Intergenic
912268879 1:108189438-108189460 GTGTGGATATGCTGGACAAAAGG - Intronic
912277373 1:108273349-108273371 CTGGGGAGACGTTGGGCAGAGGG + Intergenic
912290855 1:108421007-108421029 CTGGGGAGACGTTGGGCAGAGGG - Intronic
913338344 1:117732115-117732137 ATGAGGAGATGCTGGGAAGAAGG + Intergenic
915940906 1:160117674-160117696 CAGTGGAGATGCAGGGGAGAAGG - Intronic
916742403 1:167657661-167657683 GTTTTGATATGCTGAGCAGATGG + Intronic
917129677 1:171728207-171728229 ATGTGGATATGCAGGACAAAGGG - Intronic
917302469 1:173590755-173590777 CAGTGGGTATGCTGGCCAAAGGG + Intronic
920091920 1:203460460-203460482 GTGTGGGTATGCTGGACAAAGGG + Intergenic
920453257 1:206076661-206076683 CTAAGGATATGCTGGTCACATGG - Intronic
920679240 1:208060110-208060132 CTGTGGAGTTGGTGGGCAGGAGG - Intronic
921155409 1:212434429-212434451 CACTGTATATGCTAGGCAGAGGG + Intronic
921546239 1:216478245-216478267 CTATGGATGTGTTGGGCAGGGGG + Intergenic
921956973 1:220994884-220994906 CTGTGGATGTGGTGGGGAGAAGG + Intergenic
922229117 1:223670439-223670461 CACTTGATATCCTGGGCAGATGG - Intergenic
922448744 1:225719498-225719520 CTGTGGACTTGGTGGGCACACGG - Intergenic
922592382 1:226787084-226787106 CCTTGGATATGGTGGGCATAGGG - Intergenic
923167117 1:231376302-231376324 GTGTGGATATGCTGGACAAAGGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1062848817 10:727810-727832 CTGAGCATATCCTGGGCAGCCGG + Intergenic
1063597449 10:7449573-7449595 CTGTGAATATGCTAGACAAAAGG - Intergenic
1064961575 10:20970819-20970841 CTGGGGAGATGCTGGGCAGGTGG - Intronic
1065031201 10:21587854-21587876 CTATTGATAAACTGGGCAGATGG - Intronic
1066024064 10:31335227-31335249 GTGTGGATATGCTGGACAAAGGG - Intronic
1069755959 10:70774600-70774622 CCGGGGATATGGTGGGCAGGAGG - Intronic
1070721553 10:78760705-78760727 GAGTGAATATGCAGGGCAGAGGG + Intergenic
1071866657 10:89741819-89741841 ATGTGGATATGCTAGGCAAAGGG - Intronic
1072019696 10:91386029-91386051 GGGTGGATATGCTGGACAAAGGG + Intergenic
1072995164 10:100237075-100237097 CTGAGGATATTCTGTGCTGAGGG - Intronic
1073810490 10:107147374-107147396 CAGTGGATAGGATGGGCTGATGG - Intronic
1076569482 10:131423008-131423030 CTTTGGAGATGCTGGACACAGGG - Intergenic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1076810395 10:132883588-132883610 CAGTGGAGTTGCTGGGCACACGG - Intronic
1077184166 11:1228964-1228986 CTGTGGAGAGGCTGTGCAGCAGG + Intronic
1077610032 11:3638437-3638459 CTGTGGCCTTGCTGGGCTGAGGG - Intergenic
1077674685 11:4185694-4185716 CGGTGGTTATGATGGACAGATGG + Intergenic
1077854921 11:6114877-6114899 GTGTGGATATCCTGGACAAAGGG - Intergenic
1078294282 11:10050765-10050787 GTGTGGATAAGCTGGACAAAGGG + Intronic
1078543938 11:12232974-12232996 CCATGGATATGCTGGACAAAGGG - Intronic
1079643248 11:22832478-22832500 CTGTGGATACGCTGTACAAAGGG - Intergenic
1079781045 11:24605838-24605860 ATGGGGATATGCTGGTCAAAGGG - Intronic
1080911220 11:36600984-36601006 CTGTGGATATGATGGGTTGGAGG + Intronic
1081537208 11:44004685-44004707 CTGAGGATAGGGCGGGCAGATGG - Intergenic
1082902001 11:58265376-58265398 ATGTGGATATGCTGAACAAAGGG + Intergenic
1082904278 11:58289485-58289507 GTGTGGATATGCTGGACAAAGGG - Intergenic
1083391505 11:62354643-62354665 GTGTGGATATGCTGGAGAAAGGG + Intronic
1084391472 11:68880076-68880098 AGGTGGAGATGCTGGGCAGGTGG - Intergenic
1084480040 11:69414864-69414886 CTGTGGAGCTGTTGGGGAGAAGG + Intergenic
1084515133 11:69633911-69633933 CTGTGAAGATGCAGGGCAGGTGG + Intergenic
1084967716 11:72752995-72753017 CTGTGTATGTGCTGGGAGGATGG - Intronic
1086849024 11:91786569-91786591 CAGTGGTAATGCAGGGCAGATGG - Intergenic
1087262317 11:96024767-96024789 CTGTGGATATTTTGTGCAGGAGG + Intronic
1088769003 11:113014447-113014469 CAGGGGTGATGCTGGGCAGACGG - Intronic
1089252667 11:117176319-117176341 TTGTAGTTATGCTGGGCAAATGG - Intronic
1089663384 11:120000660-120000682 CTGTAGAGAGGCTGGGCTGATGG - Intergenic
1090382199 11:126335330-126335352 CTGCTGATAAACTGGGCAGAGGG - Intronic
1090453458 11:126826984-126827006 CTGGGATTATGGTGGGCAGAGGG + Intronic
1090681379 11:129061628-129061650 GTGTGGATATGCTGGACAAAGGG + Intronic
1090940836 11:131386892-131386914 CTCTGGATATGTTTGGGAGATGG - Intronic
1091141191 11:133236259-133236281 GTGTGGAGATGCTGGACAAAGGG + Intronic
1091563084 12:1629511-1629533 CTGGGCATAGGCTGGGCAGGAGG + Intronic
1091723970 12:2833128-2833150 TTGGGGATATCCTAGGCAGAGGG + Intronic
1091796911 12:3302756-3302778 CTGTGGATATGGAGGGCTGATGG + Intergenic
1091868872 12:3869961-3869983 GTGTGGATATGCTGGACAAAGGG + Intronic
1092188417 12:6499075-6499097 GTGTGGATATGTTGGACAAAGGG + Intronic
1092195997 12:6550072-6550094 GTGTGAATATGCTGGGCATGGGG + Intronic
1092741464 12:11634069-11634091 CTGTGGTTAGTGTGGGCAGAAGG - Intergenic
1093282486 12:17211431-17211453 CTGTGTGTATGCTGGACTGACGG + Intergenic
1093685099 12:22046269-22046291 ATGTGGAGAAGCTGGGGAGAAGG + Exonic
1094158734 12:27367274-27367296 GCGTGGATATGCTGGACAGAGGG + Intronic
1095596948 12:43970092-43970114 ATGTGGATATGCTGAACAAAGGG - Intronic
1096496167 12:52040620-52040642 CTGTGGGTATGATGGGAAGCAGG - Intronic
1096688006 12:53301582-53301604 CTCTGGAACTGCTCGGCAGAAGG + Intronic
1096716991 12:53497615-53497637 CTGAGGTGATGCTGGGAAGAAGG - Intronic
1097081150 12:56432026-56432048 CTGTGGATATGCTGGGCAGAGGG + Intronic
1097705067 12:62859826-62859848 CTGAGGAAATTCTAGGCAGAAGG - Intronic
1098555891 12:71818300-71818322 CTGTGGAGATACTGGCCAAAGGG + Intergenic
1098899517 12:76098688-76098710 GTGTGGATATGCTGGACAAAGGG + Intergenic
1101073679 12:101105037-101105059 TTGAGGATATGATGGGCAGGAGG + Intronic
1101684046 12:106999558-106999580 CTGTGGATTAGTTGGGAAGAAGG - Exonic
1101985819 12:109446243-109446265 CTGTGCCCATGCTGGGCTGAGGG + Intronic
1102298264 12:111753726-111753748 CTGAGGACATGCTGGGCTGGGGG - Intronic
1102805381 12:115774993-115775015 CTGTGGATATGGATGGGAGAAGG - Intergenic
1102866902 12:116381891-116381913 CCCTGGAGATGCTGGGGAGAGGG - Intergenic
1102988667 12:117299016-117299038 CTGGGGCTGAGCTGGGCAGAGGG + Intronic
1103508986 12:121461193-121461215 AAGTGGATATTCTAGGCAGAAGG + Intronic
1103587706 12:121968428-121968450 GTGTGGATATGTGGAGCAGAGGG - Intronic
1103610064 12:122118159-122118181 GTGTGGATCTGCTGGACAAAGGG + Intronic
1104511328 12:129381865-129381887 AAGTGGTTATGCTGGGCAGCAGG - Intronic
1107842329 13:44471911-44471933 ATGTGGATCTGCTGGACAAAGGG - Intronic
1108094372 13:46885256-46885278 GTGTGGATATGCTGGACAAAGGG + Intronic
1109269073 13:60234210-60234232 GTGTGGATATGGTGGACAAAGGG + Intergenic
1109473959 13:62853127-62853149 GTGTGGATATGCTGGACAAAGGG + Intergenic
1109504278 13:63279409-63279431 GTGTGGATATGCTGGACAAAGGG - Intergenic
1110457046 13:75700744-75700766 GTGTGAATATGCTGGACAAAGGG + Intronic
1110985115 13:81957048-81957070 CTGTGGATATGCTTCTCTGATGG - Intergenic
1112219771 13:97476060-97476082 CTGTGGACATGCTGTGTAAAAGG + Intergenic
1112222627 13:97506518-97506540 GTGTGGAGATGCTGGACAAAGGG + Intergenic
1112227842 13:97558057-97558079 CTGTTGATGTGCTGGGCCTAAGG - Intergenic
1113294844 13:108947576-108947598 CTGTGTTTATGCTGGACACAAGG + Intronic
1115220218 14:31051276-31051298 GTGTAGATATGCTGGACAAAGGG + Intronic
1116199271 14:41770726-41770748 TTGTGGCTTTTCTGGGCAGAGGG + Intronic
1116389578 14:44376776-44376798 CTGTGGATTTTCTAGGCACATGG + Intergenic
1117199853 14:53378329-53378351 GTGTGGATATGCTGGGCAACAGG + Intergenic
1117245293 14:53878740-53878762 ATGTGGAAATGCTGGTTAGAAGG + Intergenic
1118089959 14:62463180-62463202 GTGTGGATATGCTAGGCAAAGGG + Intergenic
1119404924 14:74392368-74392390 CTGGGCATATGCTAGGCACAGGG + Intergenic
1119769432 14:77211182-77211204 CTCTGGACATGCTGAGCAGGGGG - Intronic
1120282011 14:82451301-82451323 GCGTGGATATACTGGGCAGAGGG - Intergenic
1121304240 14:92895904-92895926 GGGTGGATATGCTGGACAAAGGG - Intergenic
1121610352 14:95274486-95274508 CTGCAGCTGTGCTGGGCAGAGGG - Intronic
1121804348 14:96803013-96803035 GTGTGGATATGCTGGACAAAGGG - Intronic
1122071208 14:99206520-99206542 GCATGGATATGCTGGACAGAGGG - Intronic
1122577041 14:102749276-102749298 CAGAGGATGAGCTGGGCAGAGGG - Intergenic
1122596430 14:102896277-102896299 TTGTGGAGCTGCTGGGCAAAGGG - Intronic
1122669797 14:103361955-103361977 ATGTGGATACGCTGGACAAAGGG + Intergenic
1122699914 14:103581422-103581444 CTGTGGAGGTGCTGGACAGAGGG + Intronic
1122917969 14:104867512-104867534 CTCAGGATGTGCTGGGCAGTGGG + Intronic
1125798232 15:42420286-42420308 ATGTAGATATGTTGGACAGAGGG - Intronic
1126486767 15:49189736-49189758 GTGTGGATATGCTGGACAAAGGG + Intronic
1127091072 15:55468181-55468203 CTATGGATATGCTAGGATGAAGG + Intronic
1127490454 15:59457284-59457306 GTGTGGATATGCTGGACAAGAGG - Intronic
1127588229 15:60397871-60397893 GTGTGGAGACGCTGGGAAGAAGG - Exonic
1128016177 15:64349407-64349429 GTGTGGGTATACTGGGTAGAGGG - Intronic
1131413548 15:92231816-92231838 GTGTGGATATGCTGGACAAAGGG - Intergenic
1132640467 16:975996-976018 CTGTGGACATTCTGGGCAAGGGG + Intronic
1134061187 16:11200611-11200633 CTGTTCCTAGGCTGGGCAGAGGG - Intergenic
1134690548 16:16188549-16188571 ATGTGGAATTGCTGGGCAGATGG + Intronic
1135676939 16:24423508-24423530 GTGTGGATACGCTGGACAAAGGG + Intergenic
1136120301 16:28128668-28128690 CAGGGGAAGTGCTGGGCAGAGGG - Intronic
1136421658 16:30138080-30138102 CTGGGGATCTGCTTCGCAGATGG + Intergenic
1136479624 16:30533416-30533438 CTGGGGATATTCCAGGCAGAAGG + Intronic
1137236149 16:46620355-46620377 ATGGGGAGATGCTGGGCAAAGGG - Intronic
1137369778 16:47894517-47894539 GTGTGGATATCCTGGACAAAGGG + Intergenic
1137889180 16:52140585-52140607 GTGTGAATAAGCTGGGCAAAAGG - Intergenic
1139140229 16:64253561-64253583 TAGTGGATATGGTGGGCAGGTGG - Intergenic
1139311603 16:66032604-66032626 CTGTGGCTATCCTTGGCAGTGGG - Intergenic
1139814981 16:69662290-69662312 CTGTAGTAATTCTGGGCAGAGGG + Intronic
1140095061 16:71868069-71868091 CTGGGGATATGCTGCCCAGCTGG - Intronic
1140100259 16:71910237-71910259 GCGTGGATATGCTGGACAAAGGG - Intronic
1140268794 16:73444235-73444257 CTGTGTATATTCATGGCAGAGGG - Intergenic
1140560300 16:75972401-75972423 CAGGGGATATTCTGGGAAGAGGG + Intergenic
1141148330 16:81547441-81547463 CTGTGGGCACGCTGAGCAGAGGG + Intronic
1141577016 16:84970630-84970652 CTGTGGACCTACTGAGCAGATGG + Intergenic
1141731209 16:85824503-85824525 CTGTGGGTGTGCTGGGCTGGAGG + Intergenic
1142703240 17:1677292-1677314 TTTTGCATATGCTGGGCACAGGG - Intronic
1145282057 17:21475386-21475408 CTCTGGGTAGGCTAGGCAGAGGG - Intergenic
1146465209 17:33080802-33080824 GCGTGGATATGCTGGACAAAGGG + Intronic
1146596843 17:34176825-34176847 CTGTGGCACTGCTGGGCAAAAGG - Intergenic
1147061449 17:37882442-37882464 CTATTGATAAACTGGGCAGATGG + Intergenic
1149132554 17:53322437-53322459 CTATGGATATTGGGGGCAGAAGG + Intergenic
1149177349 17:53889178-53889200 GTGTGGGTATGCTGGACAAAGGG + Intergenic
1149441278 17:56676489-56676511 ATGTGTATATGCTGGGGGGATGG + Intergenic
1150663477 17:67107457-67107479 CTGTGGAAATGCTGGGTTGCTGG + Exonic
1151369565 17:73639397-73639419 CTGTCCATGTGCTGGGCAGGAGG - Intronic
1152517615 17:80835052-80835074 CTGGGGATTTACTGGGCATATGG + Intronic
1203192721 17_KI270729v1_random:204904-204926 GTGAGCATATGCTGGGCAGGAGG + Intergenic
1203202088 17_KI270730v1_random:4339-4361 GTGAGCATATGCTGGGCAGGAGG + Intergenic
1154308915 18:13252780-13252802 CTGTGGATGTGGAGGGCCGACGG - Intronic
1156001920 18:32394747-32394769 CTGTGCATATGCTCAGCAGGGGG - Intronic
1156785736 18:40912058-40912080 GTGTGGATATGCTGGAAAAAGGG - Intergenic
1157376556 18:47172596-47172618 ATGTGCATATGCTGGACAAAGGG + Intronic
1157765305 18:50292152-50292174 AGGTGGATATGCTGGGCAAAGGG - Intergenic
1159126876 18:64234419-64234441 CTGTGAAAATGCTGGTCATAGGG + Intergenic
1159689725 18:71471538-71471560 CTGTGAATATCCGGGGGAGATGG + Intergenic
1160030952 18:75259476-75259498 GTCTGGATATGCCGGGCAAAGGG - Intronic
1160075228 18:75668043-75668065 ATGTGGGTTTACTGGGCAGATGG + Intergenic
1160237981 18:77100928-77100950 CTGTGGATCTGCTGAGCTGTGGG - Intronic
1160511439 18:79455648-79455670 CTCTGGATGTGCTGGGCTGGGGG - Intronic
1160532818 18:79575475-79575497 CTGCGGCTGGGCTGGGCAGACGG + Intergenic
1161258208 19:3321399-3321421 CTCTGGATCAGCTGAGCAGAGGG + Intergenic
1163597028 19:18226252-18226274 CTGTGGTGAGGCTGGACAGAGGG - Intronic
1164176255 19:22777864-22777886 CAGTGGATATGCTTGTAAGAAGG + Intronic
1164823760 19:31269024-31269046 GTGTGGACCTGCTGGGCAGCAGG - Intergenic
1165060105 19:33201042-33201064 CTGAGGACCTGCTGGGCAGCTGG - Intronic
1165331317 19:35142537-35142559 CTGCGGGTATTCTGGGGAGAGGG + Intronic
1165687229 19:37832233-37832255 GTGTAGATAGGCTGGACAGAGGG - Intergenic
1165777180 19:38411429-38411451 CTGTGGATTGGCAGGGCAGCTGG + Intronic
1166298399 19:41900661-41900683 CTGTGAATATCCTGAGCAAATGG - Intronic
1167458845 19:49613623-49613645 CTGTGGACATGCTGGTGAAATGG + Intronic
1168375614 19:55876866-55876888 CTGTGGATATGGAGGACTGACGG + Intronic
925486642 2:4340785-4340807 GTGTAGATATGCTGGACAAAAGG + Intergenic
926384500 2:12322919-12322941 CTGTGCAAATCATGGGCAGATGG + Intergenic
927750992 2:25670923-25670945 GTGTGGATATGCTGGAGAAAGGG - Intronic
927941097 2:27103260-27103282 CAATGGGTATGCTGGGTAGAAGG - Intronic
928299244 2:30110985-30111007 CAGTGGATATGCTGAACACAGGG + Intergenic
929013433 2:37470752-37470774 GTGTGGATATGCCGGACAAAGGG - Intergenic
929038017 2:37713455-37713477 CTGTGGATATGCTGGACAAAGGG + Intronic
929091720 2:38224027-38224049 TTGTGAATATGCTGGACAAAGGG + Intergenic
929467666 2:42159763-42159785 CTATGGATGTGTAGGGCAGAGGG - Intergenic
930669653 2:54135175-54135197 GTGTGGATCTGCTGGACAAAGGG + Intronic
931557298 2:63519245-63519267 CAGTGGCTCTGCAGGGCAGAGGG - Intronic
931645584 2:64418927-64418949 CTGTGCAGATGCTGGGAGGATGG - Intergenic
931895673 2:66726942-66726964 ATGTGGATATCCTGGGAAGCAGG + Intergenic
932449489 2:71800491-71800513 CAGTGGGAAGGCTGGGCAGATGG - Intergenic
932499729 2:72173290-72173312 CTCAGGTTATGCTGGGTAGATGG - Intergenic
932770038 2:74495798-74495820 CTTGGAAAATGCTGGGCAGATGG + Intergenic
933275625 2:80280789-80280811 ATGTGGATATGCTGGGCAAAAGG - Intronic
934906896 2:98213138-98213160 CTGTTGATGTCCTGGGCAGAAGG + Intronic
935016649 2:99189087-99189109 CACTGTATATGCTGGGCGGAGGG - Intronic
935799930 2:106685691-106685713 CAGTGGATCTGCTGGCCACATGG - Intergenic
936011513 2:108928127-108928149 GTGTGGACAAGCTGGGCAGGAGG - Intronic
937986376 2:127639951-127639973 CTGGGGATATGGTGGGGACAAGG - Intronic
937992870 2:127674148-127674170 CTGTGGCTTTGCTGGGGAAAGGG - Intronic
938620359 2:133045996-133046018 GTGTAGATATGCTGGACAAAGGG + Intronic
938779228 2:134569926-134569948 GTGTGGATTTGCTGGACAAAAGG - Intronic
938890627 2:135701671-135701693 GCATGGATATGCTGGGCAAAGGG + Intronic
940599316 2:155837622-155837644 GTGTGGATATGCTGGACAAAGGG + Intergenic
941585140 2:167349277-167349299 GTGTGGATAGGCTGGACAAAAGG - Intergenic
941838051 2:170047829-170047851 GTGTGGATATACTGGACAAAGGG - Intronic
942174367 2:173317535-173317557 GCGTGGATATGCTGGACAAAAGG - Intergenic
942956058 2:181774755-181774777 GTGTGGATATGATGGACAAAGGG + Intergenic
944444056 2:199772161-199772183 GTGTGGATATGCTAGACAAAGGG + Intronic
946317101 2:218923609-218923631 CTGTGGCTTTTCTGGGCACATGG + Intergenic
947174455 2:227349210-227349232 CTGTGTATATGCTGGTGAGGGGG - Intronic
948687636 2:239679037-239679059 CTGTGGACAAGCTGCCCAGACGG + Intergenic
948722607 2:239911054-239911076 TAGTGGGTCTGCTGGGCAGAGGG + Intronic
1170891031 20:20375525-20375547 CAGTGTATATGCTGAGCAGATGG + Intergenic
1171103403 20:22408033-22408055 GTGTGGAGATGCTGGACAAAGGG + Intergenic
1172241065 20:33412756-33412778 CTGGAGATCTGCTCGGCAGATGG - Exonic
1174661114 20:52214054-52214076 CTGTGGATATGATGTGCAGCGGG + Intergenic
1174810769 20:53643663-53643685 CTGGGCATATGCTGGGCACCTGG - Intergenic
1175938694 20:62527210-62527232 CCGTGCACATGCTGGGCAGGGGG - Intergenic
1176304235 21:5114953-5114975 GTGTGGACATGCTGGGAAGGAGG - Intergenic
1176931212 21:14812495-14812517 GTGTGAATATGCTGGACAAAGGG + Intergenic
1177012687 21:15747685-15747707 GTGTGGATATGTTGGACAAAGGG + Intronic
1177033628 21:16014512-16014534 ATGTGGATATGCTAGACAAAAGG - Intergenic
1178294579 21:31398331-31398353 CTGTGGATAAGCTGGGCCTGGGG + Intronic
1179852821 21:44147077-44147099 GTGTGGACATGCTGGGAAGGAGG + Intergenic
1180700722 22:17780246-17780268 CTGTGCATCTGGAGGGCAGAGGG + Intergenic
1180825486 22:18858161-18858183 ATGAGGATGTGGTGGGCAGAGGG - Intronic
1181112790 22:20611710-20611732 CTCTGGCTATGCTGGGCCGAAGG - Intergenic
1181177019 22:21043714-21043736 CTGTGGATAAGCTGGGTGGAGGG + Intergenic
1181187246 22:21116386-21116408 ATGAGGATGTGGTGGGCAGAGGG + Intergenic
1181211952 22:21294107-21294129 ATGAGGATGTGGTGGGCAGAGGG - Intergenic
1181397545 22:22632779-22632801 ATGAGGATGTGGTGGGCAGAGGG + Intergenic
1181651861 22:24263279-24263301 ATGAGGATGTGGTGGGCAGAGGG - Intergenic
1181705516 22:24647460-24647482 ATGAGGATGTGGTGGGCAGAGGG + Intergenic
1183271653 22:36866041-36866063 CTGTGGAGACGCTTAGCAGAGGG - Intronic
1183383106 22:37500339-37500361 GTGAGGCTATGCTGGGGAGACGG + Intronic
1183544531 22:38448538-38448560 CTGGGGATTTTCTGGGGAGAAGG + Intronic
1183628424 22:39018657-39018679 ATTTGGTTATGCTGGGGAGATGG - Exonic
1183631027 22:39032566-39032588 ATTTGGTTATGCTGGGGAGATGG - Exonic
1183671553 22:39275943-39275965 CTGGGGAGAAACTGGGCAGATGG - Intergenic
1183777032 22:39972948-39972970 GTGTGGAGTTGGTGGGCAGATGG + Exonic
1184245902 22:43235591-43235613 TTCTGGAGATGCTGGGAAGAGGG + Intronic
1185348285 22:50320110-50320132 CAGTGGAGAAGCTGGGCAGATGG - Intronic
1203215002 22_KI270731v1_random:1325-1347 ATGAGGATGTGGTGGGCAGAGGG + Intergenic
1203275634 22_KI270734v1_random:84064-84086 ATGAGGATGTGGTGGGCAGAGGG - Intergenic
950115688 3:10449162-10449184 CTCTGGATAGGCTGGGGAGCAGG - Intronic
951281503 3:20755719-20755741 CTGTGGATAAGATGGGCATAAGG - Intergenic
953315755 3:41925096-41925118 CTTTGGAGATGCTGGCAAGACGG + Intronic
953437096 3:42886513-42886535 GTGTGGATATGCTAGACAAAGGG + Intronic
953472237 3:43177289-43177311 CACTGGCAATGCTGGGCAGAAGG + Intergenic
953724631 3:45387379-45387401 GCGTGGATATGCTGGACAAAGGG - Intergenic
953754477 3:45634804-45634826 CTGGGAATATGCAGGGCAGATGG + Intronic
954256082 3:49407475-49407497 CTTTGGAAGTGCTGGGCAGGTGG - Intronic
954324819 3:49857841-49857863 CTGTGGATTTCTTGGGCTGAGGG - Intergenic
954533265 3:51338838-51338860 CCGTGGGTGTGCTGGGCAGGAGG - Intronic
955250363 3:57275588-57275610 GTGTGGATACACTGGACAGAGGG - Intronic
955641895 3:61094806-61094828 CAGTGCATATGCTGGACAAAGGG + Intronic
956120934 3:65965164-65965186 CAATGGATACTCTGGGCAGATGG - Intronic
958009317 3:87855808-87855830 GTGTGGATACGCTGGACAAAGGG - Intergenic
958868799 3:99532802-99532824 CAGTGGCTATGCTGTGTAGAGGG - Intergenic
959136066 3:102422759-102422781 GAGTGGATATGATGGGCATAGGG + Intronic
959403186 3:105928444-105928466 GTGTGGAGATGCTGGACAAAGGG - Intergenic
960049865 3:113229032-113229054 CTGGGTATATGTTGGGCAGCAGG + Intronic
960131481 3:114060926-114060948 GTGTGAAGATGCTGGGCAAAGGG + Intronic
960271324 3:115677530-115677552 CTGTGGATGTGTTGGGGTGAGGG - Intronic
961106076 3:124242761-124242783 CTGTGGATATGCAGGACAACAGG + Intronic
961441055 3:126953435-126953457 CTGAGGATATGCTGGGGTGGTGG - Intronic
961920595 3:130421339-130421361 CCCTGGAGATGCGGGGCAGAAGG + Exonic
961971547 3:130973560-130973582 GTGTGGATATGCTGGACAAAGGG + Intronic
962377093 3:134867418-134867440 ATCAGGACATGCTGGGCAGATGG + Intronic
963220677 3:142808287-142808309 CTGTGAATATGCTGAACAAAGGG - Intergenic
964780439 3:160331274-160331296 GAGTGGATATGCTGGACAAAGGG + Intronic
964850537 3:161091511-161091533 GTGTGGATACGCTGGGAAGAGGG - Intronic
964887691 3:161503237-161503259 CTGTGGAGATTCTGGGGAGAGGG + Exonic
965573729 3:170197020-170197042 AGGTGGATATGCTGGACAAAGGG - Intergenic
967131083 3:186471303-186471325 CTGTGTATATGCTGGGGTTAGGG + Intergenic
967445240 3:189558026-189558048 CAGTGAATATGCTGGACAAAGGG + Intergenic
967517395 3:190386519-190386541 ATGTGGAAATGCTGGCCAAAGGG + Intronic
968286897 3:197514097-197514119 CTGGGGTGATGGTGGGCAGAGGG - Intronic
970203624 4:13633813-13633835 GAGTGGATATGCTGGACAAAGGG + Intergenic
970262151 4:14237579-14237601 TTGTGGATACGCTGGACAAACGG + Intergenic
973325274 4:48854271-48854293 GTGTGGATATGCTGGACAAAGGG + Intronic
974260362 4:59518298-59518320 CTGGGGAGAAGCTGGGCAGCAGG + Intergenic
975757911 4:77589300-77589322 GTGTGGATGTGCTGGACAAAGGG - Intronic
975776927 4:77797443-77797465 GTGTGAATATGCTGGACAAAGGG - Intronic
977142828 4:93396445-93396467 GTGTGGATATGCTGGACAAAGGG + Intronic
977202303 4:94131411-94131433 GTGTGGATATGCTGGGGAAAGGG + Intergenic
977821002 4:101472474-101472496 CTGTGGCTTTTCTGGGCACATGG - Intronic
978367891 4:108001710-108001732 GTGTGGATATGCTGGACCAAGGG + Intronic
979200736 4:117975007-117975029 ATGTGGATATGCTGGACAAAAGG + Intergenic
979467302 4:121055345-121055367 CTGGGGATATGCTTTGCAGTTGG + Intronic
979829970 4:125287056-125287078 GTGTGAATATGCTGGACAAAGGG - Intergenic
979933407 4:126661459-126661481 GTGTGGATCTGCTGGACAAAGGG - Intergenic
980020613 4:127705338-127705360 CTGAAGCTATGCTGTGCAGAAGG + Intronic
980253417 4:130347400-130347422 CTGGGGACATGCTGGGGAGTAGG + Intergenic
980510414 4:133779168-133779190 GTGTGGATGTGCTGGACAAAAGG + Intergenic
981889025 4:149714856-149714878 GTGTGGATATGCTGGAGACAGGG + Intergenic
982271112 4:153589454-153589476 ATGTGGATATGCTGGGCAGAGGG + Intronic
982705778 4:158707593-158707615 GTGTGAATATGCTGGACAAAGGG - Intronic
984049982 4:174853877-174853899 GTGTGGGTATGCTGGACAAAAGG + Intronic
985639019 5:1054496-1054518 CTGGGGAAACGCTGGGCGGAGGG + Intronic
985943017 5:3153710-3153732 CTTTGGCTGGGCTGGGCAGATGG - Intergenic
986239871 5:5951399-5951421 CTGTGGACACACTGGGCTGAGGG + Intergenic
986713957 5:10509141-10509163 ATGTGGTTATGGTGGGAAGAAGG - Exonic
986731185 5:10636116-10636138 CTGTGGAGATTCTGGGCCCAGGG + Intronic
988573052 5:32391180-32391202 GTGTGGACATGCTGGACAAAGGG - Intronic
989114381 5:37938331-37938353 ATGTGTATAAGCTGGGCAGGAGG - Intergenic
989309661 5:39999863-39999885 ATGTGGAGATGCTGGGAAGGTGG + Intergenic
989333496 5:40287689-40287711 CTATGGATATGCTGGGCTGTTGG - Intergenic
989648155 5:43659007-43659029 CTGTGGAAGTGTTGGTCAGATGG + Intronic
990356303 5:54969641-54969663 CTGTGGAGAAGCTGTGGAGATGG - Intergenic
991082105 5:62612933-62612955 AAGTAGATATGCTGGGCTGAAGG + Intronic
991720896 5:69493408-69493430 CTTTGGATATCCCGGGGAGACGG + Intronic
992613047 5:78523926-78523948 CTGTGGAGGGGCTGGGCAGGGGG + Intronic
993092259 5:83440932-83440954 GTGTGCATATTCTGGGCAAAGGG + Intergenic
993275399 5:85850501-85850523 CTGTGGTTATGCAGGGCAGGGGG + Intergenic
994335841 5:98565031-98565053 CTGTGAACATGCTGGACATAAGG - Intergenic
994593827 5:101806639-101806661 GTGGGGACAGGCTGGGCAGAGGG - Intergenic
994622578 5:102179955-102179977 CTGGGGACTTGCTGGCCAGATGG - Intergenic
995370659 5:111415257-111415279 GCATGGATATGCTGGACAGAGGG - Intronic
995639865 5:114243475-114243497 GTGTGGATACGCTGGACAAAGGG - Intergenic
995810270 5:116099104-116099126 ATGAGGAGATGCTGGTCAGAGGG - Intronic
996815889 5:127572132-127572154 CTGGGGATTTGCTGGGTGGATGG - Intergenic
996891986 5:128431826-128431848 GCATGGATATGCTGGACAGATGG + Intronic
997365175 5:133321104-133321126 GTGTGGAATTGCTGGGCAGGTGG - Intronic
997982233 5:138475559-138475581 ATGTGGATATGGTGGGAAGAAGG - Intergenic
998576461 5:143323139-143323161 GTGTGGATATGCTGGACAAAGGG - Intronic
999491450 5:152055431-152055453 CTGGGTATATCCAGGGCAGAAGG + Intergenic
999500428 5:152141558-152141580 ATCAGGACATGCTGGGCAGATGG + Intergenic
999675553 5:153998199-153998221 CTGTGGATATGCTGGACAAAGGG - Intronic
1000247489 5:159460817-159460839 GTGTGGATATGCTGGACCAAGGG - Intergenic
1000996456 5:167964072-167964094 CTGTGAATAGGCTGGGAGGAAGG - Intronic
1001001449 5:168011221-168011243 CTGTGGGAATGATGTGCAGATGG + Intronic
1002021786 5:176368268-176368290 CTGTGTATAGGCAGGGCAGGGGG + Intronic
1003013271 6:2446692-2446714 CTGGGGAGATGCTGGTCAAAGGG - Intergenic
1004597207 6:17111342-17111364 ATGTGGATATGCTGGGTCTAAGG - Intronic
1004718469 6:18242576-18242598 GTGTGGATATGCTGGACAAAGGG - Intronic
1004807387 6:19219075-19219097 TTGTGGATATGCTGGACAAAGGG - Intergenic
1005683660 6:28231348-28231370 GTGTGGATATGCTGGACAAAAGG + Intronic
1005831960 6:29678315-29678337 GTGTGGATATGCTAGTCAAAGGG - Intronic
1006581786 6:35081612-35081634 CTGTGGTTTTGCTGAGCAGGAGG - Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1007254681 6:40520524-40520546 TTCTGGCTATGCTGGACAGATGG - Intronic
1008099293 6:47373921-47373943 CTGGGGAGATGTTGGTCAGAGGG + Intergenic
1008267389 6:49445505-49445527 CTGTGGATAGGGTGGGCAGTGGG - Intronic
1008934316 6:56973656-56973678 GTGTGGATACGCTGGACAAAGGG + Intronic
1010698023 6:79002536-79002558 ATGTGGATATGCTGGACAAAGGG - Intronic
1011753405 6:90475734-90475756 CTTTCCCTATGCTGGGCAGAGGG - Intergenic
1013189393 6:107789402-107789424 CTGTGTTTATGCGGGGCAGTGGG - Intronic
1013253132 6:108354666-108354688 GTGTGGATATGCTAGACAAAGGG + Intronic
1013438889 6:110140936-110140958 GTGTGGATATGCTAGACAAAAGG + Intronic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1013749576 6:113388036-113388058 CAGTGGAAATGCTGGGTGGAAGG + Intergenic
1013990992 6:116253621-116253643 CCGTGGCCCTGCTGGGCAGAAGG - Exonic
1014742779 6:125166112-125166134 CCGTGAATATGCTTGGGAGATGG - Intronic
1016105377 6:140156381-140156403 GCGTGGATATGCTGGACAAAAGG - Intergenic
1016126364 6:140408703-140408725 CTGTGGCTTTTCTGGGCACATGG - Intergenic
1019177309 6:170166674-170166696 CCGTGGTTATCCTTGGCAGAAGG - Intergenic
1020448232 7:8292419-8292441 CTCTAGATTTCCTGGGCAGAAGG + Intergenic
1020625319 7:10570837-10570859 GCGTGGATATGCTGGGCAAAGGG + Intergenic
1020643966 7:10791082-10791104 GTGTGGATATGCTGGACCAAGGG + Intergenic
1021224881 7:18015015-18015037 GAGTGGATTTGATGGGCAGAAGG + Intergenic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1021853004 7:24826915-24826937 TTGTGGATTTGCTGGGCATGTGG - Intronic
1022075550 7:26965869-26965891 GTATGGATATGCTGGACAAAGGG + Intronic
1022548350 7:31210188-31210210 GTGTGGATATGCTGGACAAAGGG + Intergenic
1023247802 7:38224603-38224625 GTGTGGATCTGCTGGACAGAGGG - Intronic
1023350183 7:39312812-39312834 ATGTGGATCTGCTGGACAAAGGG + Intronic
1023554912 7:41411538-41411560 ATGGGGATATGCTGGTCAAAGGG - Intergenic
1023678796 7:42661488-42661510 TTGTGGATATGCTGGACAAAGGG + Intergenic
1024218296 7:47266507-47266529 CTGTGAAAATGCAGGGCAAAGGG + Intergenic
1024251692 7:47510240-47510262 CTGTGAAGGTGCTGGCCAGAAGG + Intronic
1024373344 7:48610852-48610874 CTGAGGTTATGCAGGGCAGTGGG + Intronic
1024378777 7:48670082-48670104 CTGTGGATATGCTGGAGAAATGG + Intergenic
1027172789 7:75884724-75884746 TTGTAGATAGGCTGGGCAGGAGG + Intronic
1027254853 7:76424752-76424774 CTGTGGTCATGCTGGGGTGAAGG + Intronic
1028811256 7:95089554-95089576 CTTTGGAGATTCTGGGAAGATGG + Intronic
1030089099 7:105841540-105841562 ATATGGATCTGCTGGGCAAAGGG - Intronic
1030107122 7:105996584-105996606 TTTTGGATATGGTGGGGAGAAGG + Intronic
1030129644 7:106187792-106187814 GTGTGGATACGCTGGACAAAGGG + Intergenic
1030610453 7:111683164-111683186 GTGTGGATACACTGGACAGAGGG - Intergenic
1030640564 7:112001378-112001400 GTGTGGATATGCTGAACAAAAGG - Intronic
1031349838 7:120717315-120717337 GTGTGGATACGCAGGACAGAAGG + Intronic
1031618214 7:123905492-123905514 CTGTGGCTTTTCTGGGCACATGG + Intergenic
1032022992 7:128420468-128420490 GTGTGGATACGCTGAGCAAAGGG - Intergenic
1033013608 7:137648580-137648602 TAGTGGATATGCTGGACAGAGGG + Intronic
1033432790 7:141304434-141304456 GTCTGCATATGCTGGGCAGAAGG - Intronic
1034059490 7:148073472-148073494 GCGTGGATATGCTGGACAAATGG - Intronic
1035816305 8:2544867-2544889 GTGTGGATCTGCTGGGCATAGGG + Intergenic
1035914968 8:3608887-3608909 CATTGCATATGCTGAGCAGAAGG - Intronic
1036209047 8:6827249-6827271 CAGTGGGTTTGCTGGGCAGCAGG - Intronic
1036631115 8:10515934-10515956 CCTTGGATGTGATGGGCAGAGGG + Intergenic
1036988583 8:13566271-13566293 GCGTGGATATGCTAGCCAGAGGG + Intergenic
1037317564 8:17613359-17613381 ACCTGGATATGCTGGACAGAGGG + Intronic
1037498485 8:19463342-19463364 CTGTGGGTATGGTGGGTGGATGG - Intronic
1037561519 8:20079152-20079174 GTGTGGATCTGCTGGACAAAGGG - Intergenic
1037576571 8:20210425-20210447 CTGAGGATATGCTTGGTAAATGG + Exonic
1037620148 8:20556294-20556316 CTGTGGACATTGTGAGCAGAGGG + Intergenic
1037620160 8:20556363-20556385 CTGTGGACATTGTGAGCAGAGGG + Intergenic
1038045288 8:23761019-23761041 CTGTGTTTTTGCTTGGCAGAGGG + Intergenic
1038280830 8:26162848-26162870 GTGTGGATTTGCTGGACAAAGGG - Intergenic
1038494215 8:27990197-27990219 CAGGGGATCTGCTGGGGAGAGGG + Intronic
1038912477 8:31981887-31981909 ATGTGTATATGCTGGGCAAAGGG + Intronic
1039518779 8:38153835-38153857 CAGTGGATGAGCTGGGCAGGTGG + Intergenic
1039737697 8:40350217-40350239 GTGTGGATTTGCTGGACAAAGGG + Intergenic
1040484739 8:47859200-47859222 CTGTGGAATGACTGGGCAGACGG - Intronic
1040733326 8:50476029-50476051 ATCTGGATATGCTGGACAGAGGG - Intronic
1040779790 8:51094671-51094693 CTGAGGATTTGCTGGCAAGATGG + Intergenic
1041618316 8:59934358-59934380 CTGTGGATATCTGGGGAAGAGGG + Intergenic
1041964600 8:63660667-63660689 TTGTAGAAATGCTGGCCAGAGGG + Intergenic
1042723614 8:71849188-71849210 CTGGGGGTAGGCTGGGGAGAGGG + Intronic
1043109515 8:76161591-76161613 GTGTGGATACGCTGGACAAAGGG - Intergenic
1043391165 8:79793799-79793821 ATGTGGATAAGCTGGACAAAGGG - Intergenic
1043618659 8:82160187-82160209 GTGAGGATATGCTGGGTAAAGGG + Intergenic
1044028888 8:87210535-87210557 CTGAGGCTATGCAGGGCAGCAGG - Intronic
1044727078 8:95202665-95202687 GTGTGGAGATGCTGGGCAAAGGG + Intergenic
1044923543 8:97189642-97189664 ATGTGGAGATGCTGGACACAGGG + Intergenic
1045982354 8:108205672-108205694 GTGTCGATATGCTGGACAAAGGG - Intronic
1048583809 8:135754221-135754243 CCATGGATATGCTGGACAAAGGG - Intergenic
1049140935 8:140953495-140953517 TGGTGGATATGCTGGACAAAGGG + Intronic
1049196037 8:141316174-141316196 CTGTGGAAATGCGGGGAAGGGGG + Intergenic
1049272905 8:141705528-141705550 ATGTGGAGATGATGGGGAGATGG + Intergenic
1049340561 8:142110110-142110132 CACTGGATCTGCTGGTCAGATGG - Intergenic
1049990876 9:990438-990460 CTGAGGATCGGCTGGACAGAAGG - Exonic
1050529011 9:6571616-6571638 CAGTGGATATGCTGGACAAAGGG + Intronic
1051115037 9:13684995-13685017 GTGTGGATATACTGGACAAAAGG - Intergenic
1051212695 9:14761733-14761755 GTGTGGATGTGCTGGACAAAGGG - Intronic
1052349239 9:27441541-27441563 GTGTGGGTATGCTGGACAAAGGG + Intronic
1052606742 9:30713538-30713560 CTGTGGATAGTCTGGACAAAGGG - Intergenic
1052963085 9:34317638-34317660 GTGTGGATAGGCTGGACAGTGGG - Intronic
1055442330 9:76348770-76348792 CTGGGGAGATGCTGGTCAAAGGG - Intronic
1055546043 9:77374453-77374475 GCATGGATATGCTGGACAGAGGG + Intronic
1055579257 9:77690833-77690855 CTGTGGCTTTTCTGGGCACATGG + Intergenic
1055698224 9:78912135-78912157 AAGTGCATATGCTGGGCACATGG + Intergenic
1056561488 9:87733785-87733807 CTGTGCAGATGCTGCTCAGAGGG + Intergenic
1056596018 9:88008185-88008207 GGGTGGATATGCTGGACAAAGGG - Intergenic
1057112810 9:92490122-92490144 CTGTGGAGGTGCTGGGCACAGGG - Intronic
1058323382 9:103662527-103662549 GTGTGGATATTCTGGACAAAGGG + Intergenic
1058476725 9:105342308-105342330 GTGTGGATATGCTGGACAAAGGG - Intronic
1058952198 9:109914405-109914427 CTGTGGCTGAGCTGGGCATATGG - Intronic
1059130524 9:111743460-111743482 GTGTGGATATGCTGGGCAAAGGG - Intronic
1061244587 9:129394901-129394923 TTGGGGGTCTGCTGGGCAGAGGG - Intergenic
1061509257 9:131050394-131050416 AGGTGGACATGCTGGCCAGAGGG - Intronic
1062304654 9:135897713-135897735 GTGTGGACATGCTGGACAAAGGG + Intronic
1062431511 9:136528701-136528723 CTGTGGCTCTGCTGGGGAGCAGG - Intronic
1062441283 9:136570871-136570893 CTGTGGAGAGGCTGGGGAGTGGG - Intergenic
1185691812 X:2161460-2161482 ATGTGTATTTTCTGGGCAGAAGG + Intergenic
1191024771 X:55901933-55901955 GTGTGGATAAGCTGGACAAAGGG + Intergenic
1192138715 X:68630259-68630281 CTGAGACTAAGCTGGGCAGAGGG - Intergenic
1192147068 X:68689034-68689056 CTGAGACTAAGCTGGGCAGAGGG + Intronic
1194050980 X:89068672-89068694 GTGTGGATATACTGGACAAAAGG + Intergenic
1194159732 X:90435930-90435952 CTGTGTATATACTGTGAAGAGGG + Intergenic
1194784046 X:98060069-98060091 GTTTGGATATGCTGGACAAAGGG + Intergenic
1196650770 X:118166168-118166190 ATGTTGATGTGCTGGGCAGGAGG + Intergenic
1196970181 X:121099800-121099822 CTGTGGCTTTTCTGGGCTGAGGG + Intergenic
1197214894 X:123858916-123858938 CTGAGGATAGGCGGGGCACAAGG + Intergenic
1197233114 X:124028344-124028366 GCGTGGATATGCTGGACAAAGGG + Intronic
1197428993 X:126336042-126336064 ATATAGATATGCTGTGCAGAAGG + Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1199524002 X:148771027-148771049 TTTTGTACATGCTGGGCAGAAGG + Intronic
1199999885 X:153054770-153054792 CTGTGGATGTTCTGGGCATTGGG - Intergenic
1200506034 Y:4012896-4012918 CTGTGTATATACTGTGAAGAGGG + Intergenic
1201414268 Y:13731968-13731990 CTGGGAAAATTCTGGGCAGATGG - Intergenic