ID: 1097081182

View in Genome Browser
Species Human (GRCh38)
Location 12:56432340-56432362
Sequence GGGACTCGGGCAATAGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 77}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097081170_1097081182 30 Left 1097081170 12:56432287-56432309 CCATTATCACAAGAGCAATTCTG 0: 1
1: 0
2: 5
3: 10
4: 155
Right 1097081182 12:56432340-56432362 GGGACTCGGGCAATAGGCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097081182 Original CRISPR GGGACTCGGGCAATAGGCCA GGG Intronic
903232717 1:21931610-21931632 GGGAGGGGGGCAACAGGCCAGGG + Intronic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
907488758 1:54795297-54795319 GGGACTTGGGTGTTAGGCCATGG + Intronic
913026049 1:114841649-114841671 GGGACTTTTGCAATAGGGCAAGG + Intergenic
914666962 1:149840390-149840412 GGGCGTCGGGCACGAGGCCAGGG - Exonic
914668805 1:149853400-149853422 GGGCGTCGGGCACGAGGCCAGGG + Exonic
1067757719 10:49017667-49017689 GGGAAGAGGGCAACAGGCCAGGG - Exonic
1068002851 10:51356806-51356828 GGGAGTCAGGCAATTGCCCATGG - Intronic
1068170917 10:53393524-53393546 AGGACTCTGGAAATAGGCAAAGG + Intergenic
1073059571 10:100725206-100725228 GGGTGTCAGGCCATAGGCCAAGG - Intergenic
1075012599 10:118887517-118887539 GTGTCTGGGGAAATAGGCCAGGG - Intergenic
1075219198 10:120569708-120569730 AGGATTCTGGCAAGAGGCCAAGG - Intronic
1076772722 10:132675449-132675471 GGGAAGCGGGCAAATGGCCATGG + Intronic
1077390206 11:2297279-2297301 GGGACAGGGGCAAGAGGCCGGGG - Exonic
1083955566 11:65981140-65981162 GTGACTTGGACAGTAGGCCAGGG - Intergenic
1084281467 11:68097881-68097903 GGGACTCGAGCCATATGCCTGGG - Intronic
1084524390 11:69686734-69686756 GGGACCCGGGCAGTGGGCCAGGG - Intergenic
1085371846 11:76014924-76014946 GGGACTGGGGCAAGAGGACACGG + Intronic
1089508234 11:118979229-118979251 GGGACTTGGGCAGTAGGCGAGGG + Intronic
1089725275 11:120472394-120472416 GGGGGTGGGGCAATAGGACAAGG + Intronic
1096847751 12:54417456-54417478 GGGGTTTGGGCAAAAGGCCAGGG + Intronic
1097081182 12:56432340-56432362 GGGACTCGGGCAATAGGCCAGGG + Intronic
1114705902 14:24726572-24726594 GGGACTGGGACACTAGGCCCTGG - Intergenic
1124183125 15:27497016-27497038 TGGACTGGTGCAATGGGCCAGGG - Intronic
1124370592 15:29102838-29102860 GGGACCTGGGCAATAGGGAAGGG + Intronic
1137291915 16:47057622-47057644 GAGACTCGGGAAGGAGGCCAGGG - Intergenic
1138420585 16:56896495-56896517 GGCACTCTGGCAGCAGGCCAAGG + Intronic
1142173666 16:88635225-88635247 GGGACGAGGGCACTAGGCCGAGG + Intergenic
1142184192 16:88686587-88686609 GGGTCTCGGGCAACACGCCCAGG + Intergenic
1148470249 17:47888827-47888849 GAGACTCGGGAAGTGGGCCATGG - Intergenic
1152133466 17:78490974-78490996 GGGACTAGGGCTGTGGGCCAGGG - Intronic
1157850132 18:51041067-51041089 GGGGCATGGGCAATGGGCCAAGG - Intronic
1159955804 18:74517583-74517605 GCGACTCGGGCAAGAGGCAGGGG + Intronic
1160740121 19:681723-681745 GGGCCTCGGGCACCAGGCCCAGG - Exonic
1161024998 19:2032641-2032663 GGGACAAGGGCAACAGGCCAGGG + Intronic
1161736343 19:5994513-5994535 GGGACTGGGGCCAAAGTCCAGGG + Exonic
1161829348 19:6591176-6591198 GGGACTTGAGCAATTGGCGAGGG + Intronic
1162577603 19:11507886-11507908 GGGACTCGGCCCAGAGGCCCAGG + Intronic
1163845833 19:19637687-19637709 GGAACTAGGGCAGTCGGCCAGGG + Intronic
1164596339 19:29532967-29532989 GGGACTCAGGCTGAAGGCCAAGG - Intronic
1167786900 19:51644567-51644589 GAGGCTGGGGCAATGGGCCAGGG + Intronic
926693131 2:15751083-15751105 AGGACTGGGGCACAAGGCCATGG - Intergenic
927139346 2:20119075-20119097 GGGACTCAGGCCTTGGGCCAGGG - Intergenic
929569846 2:43015492-43015514 GGGACTCAGGAAATAAGACATGG + Intergenic
929642591 2:43596398-43596420 GGGACTCGGGAACGAGTCCAGGG + Intergenic
934576558 2:95405463-95405485 GGGCCTCGGGCTATAGCCCTAGG + Intronic
935956377 2:108380727-108380749 GGGTCTAGGGCACTGGGCCATGG + Intronic
937308323 2:120885680-120885702 GGGACTCAGGCTTGAGGCCACGG + Intronic
941572794 2:167192775-167192797 GGAACTCAGGAAATAGGACAAGG + Intronic
942811589 2:180006673-180006695 GGGACCCGGGCACTAGGAAAGGG + Intronic
948258257 2:236584114-236584136 GGGTCTGGGACAGTAGGCCACGG - Intergenic
948856909 2:240734485-240734507 GGGACTCAGCCAAGAGGACAGGG + Intronic
1169084274 20:2817050-2817072 GGGTCTCAGGCCCTAGGCCAGGG - Intronic
1172804072 20:37598566-37598588 GGGGCTCGGGAAAGAGCCCACGG + Intergenic
1172989348 20:39021344-39021366 GGGACTCTGACTATAAGCCAAGG - Intronic
1173253143 20:41375161-41375183 GGGACCCGGGCAAAAGGAGAAGG - Intergenic
1174500739 20:50982203-50982225 GGGATTGGGGCAAGGGGCCAGGG + Intergenic
1175192971 20:57223920-57223942 GGCCCTCGGGCAGTGGGCCAAGG - Intronic
1175418343 20:58816189-58816211 GTGAATGGGGCAAGAGGCCAGGG - Intergenic
1176135591 20:63520825-63520847 GGGACGGGGGCGCTAGGCCACGG - Exonic
1182551027 22:31100831-31100853 GGGACGGGGGCAGGAGGCCAGGG - Intronic
1183392791 22:37555258-37555280 GGGAGACTGGCAATGGGCCAAGG - Intergenic
1185320069 22:50196502-50196524 GAGACAGGGGCAATAGGCCTCGG + Intronic
953232059 3:41074156-41074178 GGGTCTCGGGAAAAAGGGCACGG - Intergenic
954154772 3:48679313-48679335 GGCCCTCGGGCAATGGGCCCTGG + Intronic
967941601 3:194770682-194770704 GGGACACGGGCAGTGGGCCAAGG - Intergenic
968662983 4:1806466-1806488 GGCACCAGGGGAATAGGCCAGGG - Intronic
972824657 4:42743765-42743787 GTAACTTGGGCTATAGGCCAAGG - Intergenic
985819519 5:2150097-2150119 GCCACTCGGGAAATAGCCCATGG + Intergenic
1010365719 6:75049281-75049303 GGGGCTAGGGAAATAGGCAAGGG - Intergenic
1016590078 6:145735068-145735090 GGGACGCGGGCAAAAAGCCCGGG + Intronic
1019381442 7:726434-726456 GGGTCCCGGGCTATAGGCCTGGG - Intronic
1021102373 7:16598600-16598622 AGGACTCTGGCAAGAGGGCACGG - Intergenic
1022116374 7:27264613-27264635 GGCACTCAGGGAAGAGGCCAGGG + Intergenic
1022903913 7:34837503-34837525 GGGAAATGGGCAATGGGCCATGG - Intronic
1025004774 7:55345114-55345136 GGGACGCGCGCCAGAGGCCAGGG - Intergenic
1028238476 7:88389632-88389654 GGGACTTGGGCAATAGATGAGGG + Intergenic
1036389282 8:8310588-8310610 GGTAGTTGGGTAATAGGCCAGGG + Intergenic
1047067996 8:121308402-121308424 GGGACTCAGGCAGGAAGCCATGG - Intergenic
1049683003 8:143928026-143928048 GGGGCTCGAGCAATAGCCCAAGG + Intronic
1049824928 8:144662269-144662291 GGGAGTCGGGGAATGGTCCAAGG - Intergenic
1051841693 9:21405063-21405085 GGGACTGGGCCAAGATGCCAGGG + Intergenic
1190324173 X:49196442-49196464 GGGACTCAGGAAAGAGGACAGGG - Intronic
1190426786 X:50340757-50340779 GGGACTAGGGCTATAGGAGATGG + Intronic