ID: 1097081838

View in Genome Browser
Species Human (GRCh38)
Location 12:56437514-56437536
Sequence CAGAATACAGAAAATGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3098
Summary {0: 1, 1: 0, 2: 5, 3: 123, 4: 2969}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097081834_1097081838 22 Left 1097081834 12:56437469-56437491 CCAGGAGTGCAGTGGTACAATCA 0: 24
1: 266
2: 1196
3: 2542
4: 3709
Right 1097081838 12:56437514-56437536 CAGAATACAGAAAATGAGGCAGG 0: 1
1: 0
2: 5
3: 123
4: 2969
1097081833_1097081838 23 Left 1097081833 12:56437468-56437490 CCCAGGAGTGCAGTGGTACAATC 0: 7
1: 38
2: 159
3: 302
4: 499
Right 1097081838 12:56437514-56437536 CAGAATACAGAAAATGAGGCAGG 0: 1
1: 0
2: 5
3: 123
4: 2969

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097081838 Original CRISPR CAGAATACAGAAAATGAGGC AGG Intronic
Too many off-targets to display for this crispr