ID: 1097083381

View in Genome Browser
Species Human (GRCh38)
Location 12:56449446-56449468
Sequence CACGTGACTCCGAGCGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 21}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097083367_1097083381 20 Left 1097083367 12:56449403-56449425 CCCCGCCTGCGCGAAGAGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1097083381 12:56449446-56449468 CACGTGACTCCGAGCGAACTGGG 0: 1
1: 0
2: 0
3: 0
4: 21
1097083369_1097083381 19 Left 1097083369 12:56449404-56449426 CCCGCCTGCGCGAAGAGCGAGGC 0: 1
1: 0
2: 11
3: 143
4: 628
Right 1097083381 12:56449446-56449468 CACGTGACTCCGAGCGAACTGGG 0: 1
1: 0
2: 0
3: 0
4: 21
1097083370_1097083381 18 Left 1097083370 12:56449405-56449427 CCGCCTGCGCGAAGAGCGAGGCG 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1097083381 12:56449446-56449468 CACGTGACTCCGAGCGAACTGGG 0: 1
1: 0
2: 0
3: 0
4: 21
1097083366_1097083381 25 Left 1097083366 12:56449398-56449420 CCGGTCCCCGCCTGCGCGAAGAG 0: 1
1: 0
2: 0
3: 0
4: 57
Right 1097083381 12:56449446-56449468 CACGTGACTCCGAGCGAACTGGG 0: 1
1: 0
2: 0
3: 0
4: 21
1097083373_1097083381 15 Left 1097083373 12:56449408-56449430 CCTGCGCGAAGAGCGAGGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 120
Right 1097083381 12:56449446-56449468 CACGTGACTCCGAGCGAACTGGG 0: 1
1: 0
2: 0
3: 0
4: 21

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097083381 Original CRISPR CACGTGACTCCGAGCGAACT GGG Intergenic
901937870 1:12639433-12639455 CATGTGAATCTGAGTGAACTAGG + Intergenic
1090577714 11:128125944-128125966 CATGTGAGTCTGAGTGAACTAGG + Intergenic
1097083381 12:56449446-56449468 CACGTGACTCCGAGCGAACTGGG + Intergenic
1103039653 12:117684680-117684702 CATGTGACACAGAGAGAACTTGG - Intronic
1105772807 13:23629296-23629318 CACCAGACTCCGAGCCACCTGGG - Intronic
1117937361 14:60921275-60921297 CATGTGACTCCAAGATAACTGGG - Intronic
1132010712 15:98273807-98273829 AATGTGACTCCGAGCGTGCTGGG - Intergenic
1134309437 16:13062284-13062306 CACCTGACTCCGTGCACACTGGG + Intronic
1135255674 16:20939816-20939838 CAAGTGACTCAGAGCCAAGTGGG - Intronic
1135423801 16:22322470-22322492 CACGTGACACCAAGAGAACCAGG - Intronic
1152809333 17:82374161-82374183 CACGTGACTCTGTGGGAACGAGG + Intergenic
1160690850 19:460321-460343 CACGTGACGCCGTGGGAACCCGG + Intronic
932644308 2:73485736-73485758 CACCTGGCTCCGAGCGTCCTAGG - Intronic
968274566 3:197430139-197430161 CAGGTGACTCTGGGTGAACTGGG - Intergenic
986663898 5:10083224-10083246 CACATGGCTCCGGGAGAACTTGG - Intergenic
990282908 5:54270859-54270881 CATGTGAGTCTGAGCGGACTAGG + Intronic
1021813151 7:24423528-24423550 CACGTGAGTCGGAGTGGACTAGG + Intergenic
1034601075 7:152256434-152256456 CACATAACTCCTAGCTAACTCGG + Intronic
1041266718 8:56072740-56072762 CACGTGCCTACTAGCGCACTAGG + Intronic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1203585221 Un_KI270746v1:62579-62601 CACATAACTCCTAGCTAACTCGG + Intergenic
1196283840 X:113856783-113856805 CATGTGACTCTGAGTGGACTAGG + Intergenic