ID: 1097090919

View in Genome Browser
Species Human (GRCh38)
Location 12:56504078-56504100
Sequence GCCTCGACCTCCAAGGGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097090915_1097090919 -5 Left 1097090915 12:56504060-56504082 CCATCATGGCTTACTGCAGCCTC 0: 25
1: 491
2: 2312
3: 7679
4: 14413
Right 1097090919 12:56504078-56504100 GCCTCGACCTCCAAGGGGTTAGG No data
1097090912_1097090919 17 Left 1097090912 12:56504038-56504060 CCCAGGCTGGAGTGCAGTGGCGC 0: 47841
1: 174825
2: 232776
3: 176871
4: 95097
Right 1097090919 12:56504078-56504100 GCCTCGACCTCCAAGGGGTTAGG No data
1097090910_1097090919 20 Left 1097090910 12:56504035-56504057 CCACCCAGGCTGGAGTGCAGTGG 0: 3132
1: 4112
2: 3201
3: 2056
4: 1930
Right 1097090919 12:56504078-56504100 GCCTCGACCTCCAAGGGGTTAGG No data
1097090913_1097090919 16 Left 1097090913 12:56504039-56504061 CCAGGCTGGAGTGCAGTGGCGCC 0: 5047
1: 62314
2: 191429
3: 242516
4: 178772
Right 1097090919 12:56504078-56504100 GCCTCGACCTCCAAGGGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097090919 Original CRISPR GCCTCGACCTCCAAGGGGTT AGG Intergenic
No off target data available for this crispr