ID: 1097091780

View in Genome Browser
Species Human (GRCh38)
Location 12:56511156-56511178
Sequence TCCCTTTGGCCCCATTGTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097091780_1097091785 9 Left 1097091780 12:56511156-56511178 CCCTTACAATGGGGCCAAAGGGA No data
Right 1097091785 12:56511188-56511210 GTGATTATCGAGCAGAGCTGGGG 0: 1
1: 3
2: 1
3: 4
4: 87
1097091780_1097091784 8 Left 1097091780 12:56511156-56511178 CCCTTACAATGGGGCCAAAGGGA No data
Right 1097091784 12:56511187-56511209 AGTGATTATCGAGCAGAGCTGGG 0: 1
1: 3
2: 1
3: 9
4: 89
1097091780_1097091783 7 Left 1097091780 12:56511156-56511178 CCCTTACAATGGGGCCAAAGGGA No data
Right 1097091783 12:56511186-56511208 CAGTGATTATCGAGCAGAGCTGG 0: 1
1: 3
2: 1
3: 8
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097091780 Original CRISPR TCCCTTTGGCCCCATTGTAA GGG (reversed) Intergenic