ID: 1097093066

View in Genome Browser
Species Human (GRCh38)
Location 12:56522784-56522806
Sequence GTGCTGTCCTTGGGCACATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 253}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097093057_1097093066 18 Left 1097093057 12:56522743-56522765 CCTAGGAGTCTTTATGATTAACC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1097093066 12:56522784-56522806 GTGCTGTCCTTGGGCACATGGGG 0: 1
1: 0
2: 0
3: 20
4: 253
1097093060_1097093066 -4 Left 1097093060 12:56522765-56522787 CCATGGCTGCCAGAGAATTGTGC 0: 1
1: 0
2: 1
3: 15
4: 137
Right 1097093066 12:56522784-56522806 GTGCTGTCCTTGGGCACATGGGG 0: 1
1: 0
2: 0
3: 20
4: 253
1097093059_1097093066 -3 Left 1097093059 12:56522764-56522786 CCCATGGCTGCCAGAGAATTGTG 0: 1
1: 0
2: 2
3: 12
4: 134
Right 1097093066 12:56522784-56522806 GTGCTGTCCTTGGGCACATGGGG 0: 1
1: 0
2: 0
3: 20
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097093066 Original CRISPR GTGCTGTCCTTGGGCACATG GGG Intronic
900169500 1:1259713-1259735 GTGGGGTCCGTGGGGACATGGGG - Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900368212 1:2320086-2320108 GGGCAGCCCCTGGGCACATGGGG - Intergenic
900537965 1:3188103-3188125 ATGCTCTCCTTGGTCCCATGAGG - Intronic
903152203 1:21418173-21418195 GTCCTGTCCTTGTGCACGTTTGG + Intergenic
903715106 1:25359583-25359605 AAGCTGTCCTGGGCCACATGTGG + Intronic
905301866 1:36991050-36991072 GTGCTTTCCTTAGGCACCTCAGG - Intronic
906668018 1:47635333-47635355 GTGCTGTCCTGGGGGTCAAGTGG + Intergenic
907450125 1:54541060-54541082 GTGCTGAGCTTGGCCACCTGGGG - Intergenic
907683367 1:56585701-56585723 GTGTTGACCTTGGCCACATCAGG + Intronic
908282172 1:62551427-62551449 AAGCTGTCCTGGGCCACATGTGG + Intronic
908820722 1:68083681-68083703 CAGCTGTCCTTGGACACATAAGG + Intergenic
910227213 1:84947999-84948021 GTGCTGTGCTTGTGCACACTTGG + Intronic
911039783 1:93582625-93582647 GTGGCTTCCCTGGGCACATGAGG + Exonic
911190378 1:94942614-94942636 CAGCTGTCCTTGGGCCCGTGTGG - Intergenic
921395522 1:214665206-214665228 GTCATGCCCTTGAGCACATGGGG - Intergenic
922019376 1:221688300-221688322 GTGCTTTCCTGGGGCTGATGTGG - Intergenic
922221579 1:223612350-223612372 GTGCAGTCCTGGGGCAACTGAGG + Intronic
922362286 1:224834129-224834151 GTGTTGTCCAGGGGCACAGGAGG - Intergenic
922689671 1:227678244-227678266 GGGATGACCTTGGGCACAGGTGG + Intergenic
922787982 1:228292794-228292816 GGGCTCTCCTTGGCCACATGTGG - Intronic
922875416 1:228936558-228936580 GGGCTGTCCTAGAGCACTTGGGG - Intergenic
923316962 1:232789843-232789865 CAGATGTCCTTGGACACATGTGG - Intergenic
1063441386 10:6075921-6075943 GTGCTGTCCTGGTGCACAGGTGG - Intergenic
1065275516 10:24081778-24081800 AAGCTGTCCTGGGCCACATGTGG + Intronic
1066252185 10:33645083-33645105 AAGCTGTCCTGGGACACATGCGG - Intergenic
1067343355 10:45421379-45421401 GTCCTGTGCTGGGGCACCTGAGG - Intronic
1067744962 10:48928723-48928745 GAGCTGTCCTGCGGCAGATGGGG - Intronic
1070397200 10:76021546-76021568 GTGCTGTCCTCTGCAACATGAGG + Intronic
1071174132 10:82904129-82904151 AAGCTGTCCTGGGCCACATGTGG - Intronic
1074055858 10:109922803-109922825 GGGCTCTCCTTGGGCATAGGAGG - Intronic
1075030919 10:119024258-119024280 AAGCTGTCCTGGGCCACATGAGG + Intergenic
1076063016 10:127428333-127428355 GTGCTTGCTTTGGGCACAGGTGG + Intronic
1076831532 10:132996744-132996766 GTGGTGTCCCTGGACACATCCGG + Intergenic
1076874420 10:133208610-133208632 GAGCTGCCCCTGGTCACATGGGG + Intronic
1077517842 11:3012648-3012670 GTGATGTCCTTGGGCTCCTTAGG - Intronic
1078855470 11:15203163-15203185 GTGCTGTACTATGGCAGATGTGG - Intronic
1078859180 11:15231472-15231494 AAGCTGTCCTGGGCCACATGTGG + Intronic
1079331396 11:19535813-19535835 GTGCTTTCCTGGGGCTCATTTGG - Intronic
1081248649 11:40801497-40801519 GTGCAGTCCATGCCCACATGGGG - Intronic
1086859010 11:91902213-91902235 GTGGTGTCCATGGGAAGATGGGG + Intergenic
1088888019 11:114022859-114022881 AAGCTGTCCTGGGCCACATGCGG + Intergenic
1091104226 11:132903273-132903295 CTCCTGTCCTTGGTCACATATGG - Intronic
1092635801 12:10447140-10447162 AAGCTGTCCTGGGTCACATGCGG - Intronic
1092990254 12:13890478-13890500 GTGCTGCCACTGGGCGCATGGGG - Intronic
1093237579 12:16630069-16630091 GAGCTGCCATTGGGCACATTAGG + Intergenic
1097093066 12:56522784-56522806 GTGCTGTCCTTGGGCACATGGGG + Intronic
1097681919 12:62657107-62657129 GTGCTGTCACTGGGCTCATTGGG + Intronic
1098219410 12:68252711-68252733 GTGCCGTCCATGGGTACTTGGGG - Intronic
1101755167 12:107615895-107615917 GTGCTGAGGTTGGGCACATCAGG + Intronic
1105816340 13:24039832-24039854 GTGCTTTCCTGGAGCAAATGTGG - Intronic
1106244828 13:27940194-27940216 AAGCTGTCCTGGGCCACATGTGG - Intergenic
1106286252 13:28320462-28320484 AAGCTGTCCTGGGCCACATGTGG - Intronic
1107728856 13:43328062-43328084 ATACTCTCCTTGGGCACATGTGG + Intronic
1108581943 13:51835133-51835155 GTGCTGTCCCTATCCACATGTGG - Intergenic
1110253439 13:73406029-73406051 AAGCTGTCCTGGGCCACATGTGG + Intergenic
1111681583 13:91448207-91448229 ATGCTGAGCTTGGGCCCATGGGG + Intronic
1112206423 13:97328100-97328122 CTGCTGTTCTTGGGCACCTTGGG - Intronic
1112429533 13:99338405-99338427 AAGCTGTCCTGGGCCACATGTGG + Intronic
1114058629 14:18999282-18999304 GTGCTGTCCTTGTACACCTCTGG + Intergenic
1114103917 14:19402472-19402494 GTGCTGTCCTTGTACACCTCTGG - Exonic
1117620515 14:57581622-57581644 ACTCTGTGCTTGGGCACATGTGG - Intronic
1117962688 14:61178707-61178729 TGGCTGTCCTTGGGCACATTGGG - Intergenic
1119921574 14:78451218-78451240 ATGTTGTAATTGGGCACATGTGG - Intronic
1121485943 14:94314401-94314423 ATGCTGTCCCTGGGCACCTGTGG - Exonic
1122195295 14:100080280-100080302 AAGCTGTCCTGGGCCACATGCGG + Intronic
1122285328 14:100648486-100648508 AAGCTGTCCTGGGCCACATGAGG + Intergenic
1122941649 14:104984216-104984238 GTGTTGTCCTTGTGTACAGGTGG - Intergenic
1125366277 15:38920216-38920238 GTGCTATCCTTTGGCCCACGTGG - Intergenic
1125878297 15:43168778-43168800 CTGCAGTCCTTGGGCAAATCTGG - Intronic
1126661551 15:51038345-51038367 GTCCTGTCCTTGGGCCCCAGTGG + Intergenic
1129154306 15:73708276-73708298 GTGCTGTCCTCCGGGACATGGGG + Intronic
1129557435 15:76527370-76527392 TTGCTTTCCTTGGGCACCTAGGG + Intronic
1132473330 16:119080-119102 GGGCTCTCCCTGGGCAGATGTGG - Intronic
1135525754 16:23212596-23212618 GGGCTGTCCTTGGTGACCTGGGG + Intronic
1135672223 16:24385141-24385163 GTGCGGTGGTTGGGCACAGGTGG - Intergenic
1136613219 16:31379859-31379881 ATGCAGTCCTTGGGTACCTGGGG - Exonic
1137687047 16:50393448-50393470 GTGCTGTGGGAGGGCACATGAGG + Intergenic
1137749100 16:50845457-50845479 GTGGTGTCACTGGGCACAGGGGG + Intergenic
1138170804 16:54847807-54847829 TTGCTGACCTTTGACACATGAGG - Intergenic
1138226846 16:55303201-55303223 GGGCTGTCCCTGGGCAAATAGGG - Intergenic
1138590247 16:57995797-57995819 GTGCCATCCTTGGGGACAGGAGG - Exonic
1139568157 16:67792876-67792898 CTGGTGACATTGGGCACATGAGG - Intronic
1141027809 16:80564329-80564351 GCTCTGTCCTTGGGCAAAAGTGG + Intergenic
1141444761 16:84050737-84050759 CAGCTGTCCTTACGCACATGCGG - Intergenic
1141806113 16:86342693-86342715 AAGCTCTCCTTGGCCACATGTGG + Intergenic
1145067535 17:19772052-19772074 GTGGAGCCCCTGGGCACATGTGG - Intronic
1146260146 17:31415632-31415654 GTGCTGTCATTGTCCAGATGGGG + Intronic
1146684941 17:34835255-34835277 GTGCTGGCCTTTGGCACAGGTGG - Intergenic
1146844828 17:36175932-36175954 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1146857133 17:36263867-36263889 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1146863482 17:36324508-36324530 CTGCTGCCCTTGGGCAGCTGTGG + Intronic
1146873045 17:36387777-36387799 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1146880403 17:36438863-36438885 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1147066342 17:37925096-37925118 CTGCTGCCCTTGGGCAGCTGTGG + Intronic
1147075928 17:37988402-37988424 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1147077875 17:38004657-38004679 CTGCTGCCCTTGGGCAGCTGTGG + Intronic
1147087453 17:38067948-38067970 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1147093811 17:38128592-38128614 CTGCTGCCCTTGGGCAGCTGTGG + Intergenic
1147103397 17:38191911-38191933 CTGCTGCCCTTGGGCAGCTGTGG - Intergenic
1147437666 17:40427468-40427490 GGGCTGTCCTTGGGGACACTGGG + Intergenic
1147835629 17:43329455-43329477 GTGCTGTCCTTCAGCCTATGGGG - Intergenic
1149847971 17:60018380-60018402 CTGCTGCCCTTGGGCAGCTGTGG - Intergenic
1150258531 17:63769828-63769850 AAGCTGTCCTGGGTCACATGCGG + Intronic
1155201567 18:23522401-23522423 AAGCTGTCCTGGGCCACATGTGG - Intronic
1155429222 18:25738111-25738133 CAGCTGTCCCTGGGCAGATGAGG + Intergenic
1155905407 18:31444707-31444729 GTGCTGTCCGTAGGCATTTGGGG - Intergenic
1156879725 18:42062367-42062389 AAGCTGTCCTGGGCCACATGTGG - Intronic
1157824568 18:50801130-50801152 GTGCTGGGCTTGGGCAGGTGGGG + Intronic
1159204404 18:65231963-65231985 GTCCTGCCCTTGAACACATGGGG - Intergenic
1160811214 19:1013744-1013766 GTGGTGGCCTTGGGCACTGGTGG - Intronic
1160905017 19:1447867-1447889 GTCCTGTCCTTGTATACATGGGG - Intronic
1161124450 19:2547873-2547895 CTGCTGTGCATGGGCACACGTGG + Intronic
1161273667 19:3404083-3404105 GTTCAGCCCGTGGGCACATGTGG + Intronic
1161535916 19:4818367-4818389 GTGCAGGCCATGGGCACAGGTGG + Exonic
1163263331 19:16204265-16204287 TTCCTGTCCTTGGGCCCATGGGG + Intronic
1166200923 19:41237671-41237693 GTTTTTTCCTTGGGCACACGGGG - Intronic
1166819661 19:45569847-45569869 GTGGTGTCATTGGGAACCTGAGG - Intronic
925001089 2:403369-403391 GGTCTCTCCCTGGGCACATGGGG + Intergenic
925045806 2:772393-772415 TTGCTGTCCTTTGGGAAATGGGG - Intergenic
925486168 2:4334259-4334281 GTGCTGTCTTTGGGGCCTTGTGG - Intergenic
925571939 2:5321755-5321777 AAGCTGTCCTGGGCCACATGTGG + Intergenic
927785650 2:25972627-25972649 CTGGTGTCCTTGGGGACATGTGG + Intronic
927906338 2:26861055-26861077 GTGAAGTTCTTGGGCCCATGTGG + Intronic
929959904 2:46488571-46488593 GTCCTGTCCTTGGGCTCAGGAGG - Intergenic
932195146 2:69776813-69776835 AAGCTGTCCTGGGCCACATGTGG + Intronic
932810225 2:74819103-74819125 AAGCTGTCCTAGGCCACATGTGG + Intergenic
934762394 2:96863922-96863944 GTGCTGTTCATTGGCACAGGTGG - Exonic
935422178 2:102880641-102880663 AAGCTGTCCTGGGCCACATGCGG - Intergenic
935684848 2:105674127-105674149 AAGCTGTCCTGGGCCACATGCGG + Intergenic
937093509 2:119222191-119222213 GTGCTGTCCTTGGGCATTAAAGG + Intergenic
939387859 2:141524484-141524506 GAGCTGTCCTGGGCCGCATGTGG - Intronic
939392854 2:141591237-141591259 ATGCTGTTCTTAGGGACATGGGG - Intronic
940351811 2:152699193-152699215 AAGCTGTCCTGGGCCACATGTGG - Intronic
942319188 2:174721296-174721318 TTGGTGTCCTTGGGGACATGGGG - Intergenic
942529216 2:176890475-176890497 GTGTTTTCTTTGAGCACATGAGG - Intergenic
942674018 2:178407423-178407445 AAGCTGTCCTGGGCCACATGTGG - Intergenic
944046159 2:195414181-195414203 CTGCTTTTCTTGGGCACAAGGGG - Intergenic
946338221 2:219052476-219052498 CTGCTGGGGTTGGGCACATGTGG - Intergenic
946372303 2:219288250-219288272 GAGGTGTCCTTGGACAAATGGGG - Intergenic
948788154 2:240363789-240363811 CTGCTGTCCTTGGGGAGATGTGG - Intergenic
949020381 2:241737882-241737904 GTGCTGTCATTGGGAAGATCTGG + Intronic
1169603764 20:7292115-7292137 GTGCTGTTATTGAGCACTTGTGG - Intergenic
1170530716 20:17288242-17288264 CTGCTACCCTAGGGCACATGAGG + Intronic
1173255484 20:41391900-41391922 CTGCAGCCCTTGGGCAGATGTGG + Intergenic
1173437872 20:43048812-43048834 GTCCTGTCCTTGGGCCTGTGGGG + Intronic
1173901054 20:46589073-46589095 GGCCTGGCCTTGGGCCCATGGGG - Intronic
1174069040 20:47887185-47887207 GTGCTGTCACTGGACAGATGAGG + Intergenic
1174514828 20:51083676-51083698 TTGCTGTTCTTCGGCACATTGGG - Intergenic
1174559245 20:51418090-51418112 GTGCTGTACTAGGGAACAGGCGG + Intronic
1175228956 20:57461470-57461492 GTGGGGTCCTTTGGCACGTGGGG - Intergenic
1175516021 20:59570621-59570643 AAGCTGTCCTGGGTCACATGTGG - Intergenic
1175534215 20:59696509-59696531 GGGCTGTGCTTCGGGACATGGGG + Intronic
1176091584 20:63320760-63320782 ATTCTGTCCTGGGGCTCATGCGG + Intronic
1178681936 21:34679828-34679850 GAGCTGTCCAAGGCCACATGGGG - Intronic
1178899725 21:36589232-36589254 GTGCTGTCCTTGGGGACCAAGGG - Intergenic
1179730168 21:43363351-43363373 GTGCCGACCATGTGCACATGGGG + Intergenic
1180022287 21:45136045-45136067 GTGGTGTCCCTGGGCCCATGGGG + Intronic
1180477114 22:15721901-15721923 GTGCTGTCCTTGTACACCTCTGG + Intergenic
1181463705 22:23099609-23099631 GAGCTGTCCTTGTGGACTTGAGG - Intronic
1182489568 22:30662271-30662293 GGGCTGTCATTGGACAGATGAGG + Exonic
1183890300 22:40922032-40922054 GTGCAGTCAGTGGGCAGATGAGG - Intronic
1184265332 22:43343203-43343225 CTGCTGGCCCTGGGCACACGCGG - Exonic
1184331065 22:43828271-43828293 GTGCTGGCCTTGGCCATAGGAGG - Intronic
1184491959 22:44814949-44814971 GTGCCGGCCTTTGGCACCTGTGG + Intronic
1184645802 22:45894627-45894649 GTGCTGTCCATGGACACTTCTGG - Intergenic
1185062101 22:48612480-48612502 GCCCTGTCCCTGGGCACAGGTGG + Intronic
949202463 3:1395350-1395372 GTGCAGCCCTTGAGCACATCTGG - Intronic
949283787 3:2377695-2377717 AAGCTATCCTTGGCCACATGCGG - Intronic
950123479 3:10497050-10497072 CTGCTGACCTTGGGCAGCTGTGG + Intronic
950284800 3:11736252-11736274 TTCCTTTCCATGGGCACATGTGG - Intergenic
951970951 3:28443279-28443301 GAGGTCTCCTTGGGGACATGTGG + Intronic
952014265 3:28938383-28938405 AAGCTGTCCTGGGACACATGTGG - Intergenic
954559173 3:51541616-51541638 GTGCTGTCCCTTGGAACAGGAGG + Exonic
954648557 3:52145808-52145830 GGGCTGCCCTTGGGCCCAGGAGG + Intronic
954686527 3:52373094-52373116 GTGCTGTGCAGGGGCACAGGAGG + Intronic
954753414 3:52826376-52826398 TTGCTGTCATTTGGCAGATGGGG - Intronic
955832551 3:63019492-63019514 AAGCTGTCCTGGGCCACATGTGG + Intergenic
958083713 3:88779859-88779881 GGTCTCTCCTTGGCCACATGAGG + Intergenic
958918737 3:100078970-100078992 AAGCTGTCCTGGGCCACATGTGG + Intronic
959683353 3:109120650-109120672 GTGATGTCCTGGGCCACCTGGGG + Intergenic
960131629 3:114062227-114062249 GTGCAGTGGTTGGGCACCTGTGG + Intronic
960635754 3:119782734-119782756 CTGCTGTCCTTGGCCTCAGGGGG - Exonic
960661669 3:120067077-120067099 AAGCTGTCCTGGGCCACATGTGG + Intronic
962363447 3:134760825-134760847 CTGCTGTCCTGGGGCACCTCCGG + Intronic
962517241 3:136163706-136163728 GGTCTGTCCCTTGGCACATGGGG - Intronic
962712425 3:138099233-138099255 GAGCTGTTCTGGGCCACATGTGG - Intronic
963416541 3:145002134-145002156 GTGCTGTCCTTGTGATAATGAGG - Intergenic
968382776 4:109746-109768 GTGCTTTCCTTGGGCACCCCTGG - Intergenic
968822083 4:2861860-2861882 AAGCTGTCCTGGGCCACATGTGG - Intronic
972457221 4:39266449-39266471 ATGCTGTCCAGGGCCACATGTGG + Intronic
973619978 4:52716600-52716622 GTGCTGCCCCTAGCCACATGTGG - Intergenic
974063919 4:57060020-57060042 GTGATGTGCTGGGTCACATGAGG + Intronic
975415551 4:74100076-74100098 GTGCTGTCCCTGGGCAGAAAAGG + Intergenic
976008639 4:80460489-80460511 GTGCTGTCATTCAGCAGATGAGG - Intronic
976966011 4:91042142-91042164 GGTCTGTCCCTTGGCACATGGGG - Intronic
977415157 4:96723191-96723213 AAGCTGTCCTGGGCCACATGCGG + Intergenic
979522593 4:121685949-121685971 GAGCTGTCCTGGGCCACATGTGG - Intronic
979585361 4:122409014-122409036 GTGCTGTCCTTGGACAATTATGG - Intronic
981610183 4:146585350-146585372 AAGCTGTCCTGGGCCACATGTGG + Intergenic
982064518 4:151641459-151641481 AAGCTGTCCTGGGCCACATGCGG - Intronic
983146632 4:164224098-164224120 AAGCTGTCCTGGGCCACATGTGG - Intronic
983366198 4:166793517-166793539 AAGCTGTCCTGGGCCACATGTGG + Intronic
983519780 4:168696099-168696121 AAGCTGTCCTGGGCCACATGTGG + Intronic
985546729 5:513680-513702 GAGCTGTCCCTGGGCCCCTGAGG - Intronic
985649131 5:1099205-1099227 GTGCTGCTCTTTGGCCCATGGGG - Intronic
986139121 5:5013094-5013116 AAGCTGTCCTGGGCCACATGCGG + Intergenic
986758022 5:10855854-10855876 CTGCTCTCCTTGTGCAAATGGGG + Intergenic
986781765 5:11072922-11072944 GTGCTGCCCTTGGGGGCATAAGG - Intronic
990326079 5:54676634-54676656 GTGCTGTACTTGGGCAACTCAGG - Intergenic
991279875 5:64900916-64900938 GAGCTGTCCTGGGCCACATGTGG - Intronic
993110029 5:83645372-83645394 GAGCTGTTCTGGGCCACATGTGG - Intronic
994894815 5:105688931-105688953 ATGCTTTCCTTGGGGTCATGTGG + Intergenic
996863874 5:128095602-128095624 AAGCTGTCCTGGGCCACATGTGG - Intronic
998003743 5:138643694-138643716 AAGCTGTCCTGGGCCACATGTGG - Intronic
998146453 5:139731785-139731807 CTGCTGTCCCTGGGTACCTGGGG - Intergenic
1001119647 5:168969430-168969452 GTGCAATCCTTGGCCACAGGCGG + Intronic
1003064683 6:2893986-2894008 GAGCTGACATTGGGCACATGGGG + Intronic
1004235995 6:13874790-13874812 AAGCTGTCCTGGGCCACATGAGG - Intergenic
1004999708 6:21228806-21228828 GTGCTGTCCTTGAGATCTTGAGG + Intronic
1005369493 6:25116203-25116225 ATGCTGGCTTTGGGAACATGTGG + Intergenic
1006701032 6:35973469-35973491 AAGCTGTCCTGGGCCACATGTGG - Intronic
1006966448 6:37990782-37990804 CAGCTGTCATTGGCCACATGTGG - Intronic
1007265064 6:40589569-40589591 GTACTGTGCTGGGGCACAGGTGG + Intergenic
1007631182 6:43274571-43274593 CTGCTGTCCTTGGGTTGATGTGG + Intronic
1007720740 6:43884130-43884152 GAGCTGAACTGGGGCACATGAGG - Intergenic
1010439799 6:75880552-75880574 AAGCTGTCCTGGGCCACATGTGG + Intronic
1011335793 6:86258322-86258344 AAGCTGTCCTGGGCCACATGTGG + Intergenic
1013274314 6:108569713-108569735 CTGCAGTCCTAGGGCACATCTGG - Intronic
1014791618 6:125678833-125678855 GTGGAGTCCTTGAACACATGAGG + Intergenic
1016509896 6:144830622-144830644 AAGCTGTCCTGGGCCACATGTGG - Intronic
1017251092 6:152280362-152280384 AGGCTGTCCTGGGCCACATGCGG - Intronic
1019564773 7:1673873-1673895 GAGCTGTCCTGGGGCAGCTGGGG + Intergenic
1022515341 7:30971624-30971646 GTGCTGTTCTTGGTCTCATGGGG + Intronic
1022596152 7:31714963-31714985 GTGCTGTCCTTTGGCATCTAAGG + Intergenic
1023919918 7:44620672-44620694 AAGCTGTCCTGGGCCACATGTGG - Intronic
1024420638 7:49161703-49161725 TTTCTGTCCTTTGGCACATTAGG - Intergenic
1024682617 7:51708713-51708735 GAGCTGTCCTGGGCCACATGAGG - Intergenic
1027402309 7:77821909-77821931 GTCCTGTCCCTGGGCACAGCAGG - Intronic
1029191775 7:98777084-98777106 GTGCTCCCATTGGTCACATGAGG - Intergenic
1032331779 7:130987201-130987223 GGCCTGTCTTGGGGCACATGAGG + Intergenic
1035245881 7:157561700-157561722 GGGCTGTCCTGGGGCTCAGGAGG - Intronic
1035748261 8:1977012-1977034 AAGCTGTCCTGGGCCACATGTGG - Intronic
1037776353 8:21838421-21838443 CTGCAGGCCTTGGACACATGGGG + Intergenic
1038416155 8:27397472-27397494 GTGCTGTCCCTGGGGCCATGAGG + Intronic
1039318345 8:36398512-36398534 AAGCTGTCCTGGGCCACATGTGG + Intergenic
1040611532 8:48988610-48988632 GTGCTGTCCTTACCCACATCTGG + Intergenic
1041531652 8:58874964-58874986 AAGCTGTCCTGGGCCACATGTGG + Intronic
1043447566 8:80334108-80334130 AAGCTGTCCTCGGCCACATGCGG - Intergenic
1044419665 8:91979871-91979893 TTGCTGTCCTGGGTCATATGAGG - Intronic
1045247270 8:100453844-100453866 AAGCTGTCCTTGGCCACATGCGG + Intergenic
1045547722 8:103142961-103142983 GTGCTGTCCTGGGGCTGAAGTGG - Intronic
1049248896 8:141577717-141577739 GTCCCGTGCTTGGGCACACGTGG + Intergenic
1051769677 9:20563500-20563522 GTTCTCTCCTTGTGCACATAAGG - Intronic
1055027694 9:71739695-71739717 AAGCTGTCCTGGGCCACATGTGG - Intronic
1055664137 9:78536298-78536320 AAGCTGTCCTGGGCCACATGAGG + Intergenic
1056043792 9:82695554-82695576 ATGGTGTACTTGGGCACCTGGGG + Intergenic
1056263951 9:84877512-84877534 GGGGGGTCCTTGGCCACATGGGG - Intronic
1056764840 9:89438293-89438315 GTGCTGGACTTGTGCTCATGTGG + Intronic
1061163818 9:128911145-128911167 GTCCTGTCCTGGGGCCCAGGAGG - Intronic
1061366982 9:130177242-130177264 GGACTGTCCTGGGGCCCATGAGG + Intronic
1062004378 9:134231934-134231956 GTGCTGGCCCTGGGGACAGGGGG - Intergenic
1062239105 9:135526363-135526385 GTGCCGTCCTTGGGCTGCTGAGG - Exonic
1203453224 Un_GL000219v1:140405-140427 AAGCTGTCCTGGGTCACATGTGG - Intergenic
1186546947 X:10459829-10459851 GTGCAGTTCTTTGGCACAAGGGG + Intronic
1187999738 X:24969380-24969402 GTGCTTTCCTGGGGTGCATGGGG - Intronic
1189873118 X:45404929-45404951 GTGCTTCCCTGGGGAACATGAGG - Intergenic
1190622460 X:52300924-52300946 GAGCTGTCCTGGGGTGCATGTGG - Intergenic
1192471335 X:71401544-71401566 GTGGTGCCATTGGACACATGAGG + Exonic
1192745355 X:73932976-73932998 GTGCTGTGCTTAGCCACATTGGG + Intergenic
1196574468 X:117302224-117302246 GTGCTATGGTTGGGCATATGAGG + Intergenic
1198435738 X:136615325-136615347 AAGCTGTCCTGGGCCACATGCGG - Intergenic
1199428799 X:147735219-147735241 AAGCTGTCCTGGAGCACATGTGG - Intergenic
1199981369 X:152922367-152922389 GTCTTGTCACTGGGCACATGGGG - Intronic