ID: 1097100914

View in Genome Browser
Species Human (GRCh38)
Location 12:56588761-56588783
Sequence CTGTAGGAAGGTTGGGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 665
Summary {0: 1, 1: 0, 2: 2, 3: 62, 4: 600}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097100904_1097100914 25 Left 1097100904 12:56588713-56588735 CCAGGATGCTGGCTTGTATTGAC 0: 1
1: 0
2: 1
3: 7
4: 94
Right 1097100914 12:56588761-56588783 CTGTAGGAAGGTTGGGGAAGTGG 0: 1
1: 0
2: 2
3: 62
4: 600

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097100914 Original CRISPR CTGTAGGAAGGTTGGGGAAG TGG Intronic
900004570 1:36210-36232 AAGTTGGAAGGCTGGGGAAGGGG + Intergenic
900024292 1:206726-206748 AAGTTGGAAGGCTGGGGAAGGGG + Intergenic
900274581 1:1815962-1815984 CTGTGGGAAGGGCTGGGAAGAGG - Intronic
900438177 1:2641173-2641195 CTGTGGGGAGGGTTGGGAAGGGG + Intronic
900748826 1:4380561-4380583 CTCTAAGAAGGTTGGGGAGGAGG + Intergenic
901097575 1:6694504-6694526 CTGAAGTCAGCTTGGGGAAGGGG - Intronic
901132927 1:6973870-6973892 CTGTGGGAAGGTGGGGCAGGAGG - Intronic
902037713 1:13469705-13469727 CTGTAGGGACATTGGGGAGGAGG + Intergenic
902794309 1:18791132-18791154 CTGAAGGAAGGTTGGAGAAATGG - Intergenic
902992401 1:20197495-20197517 CTGTAGATAGGTGGGGGAAGAGG + Intergenic
903021772 1:20400018-20400040 CTGTAGGAAGGCAGGGGAGGAGG - Intergenic
904697795 1:32339981-32340003 CTGGAGCAAGGTTTGGGAGGTGG + Intergenic
905484497 1:38285909-38285931 CTGGGGGAGGGCTGGGGAAGAGG - Intergenic
906759579 1:48363948-48363970 CTGTTGTGAGGTGGGGGAAGGGG - Intronic
906877612 1:49556371-49556393 CTGTCGTGAGGTGGGGGAAGGGG + Intronic
907046577 1:51303446-51303468 CTACAGGGAGGCTGGGGAAGGGG - Intronic
907273264 1:53303160-53303182 CTGTAGGAAAGCTGGAGCAGTGG - Intronic
909263027 1:73519512-73519534 CTGGAGAATGGTTGGGGATGTGG - Intergenic
909488000 1:76195756-76195778 CTGGAGGAATGTTGGGGAGTAGG - Intronic
909666146 1:78135210-78135232 CTATTAGGAGGTTGGGGAAGGGG + Intronic
910088665 1:83435885-83435907 CTGTAGGAGGGTGGGGGAGCTGG + Intergenic
910747367 1:90588478-90588500 CTGTTGTTAAGTTGGGGAAGAGG - Intergenic
912093723 1:106114031-106114053 AGGGAGGAAGGATGGGGAAGAGG + Intergenic
912861313 1:113216366-113216388 CTGAAGGAAGGTATGGGAAAAGG - Intergenic
912963455 1:114216355-114216377 TTTCAGGAAAGTTGGGGAAGGGG + Intergenic
912972147 1:114293672-114293694 CTGGAGGAAGGCTGGGAAACTGG - Intergenic
913342193 1:117769679-117769701 CTGTAGCCAGGTGGGGGGAGGGG - Intergenic
914942257 1:152033606-152033628 TTGTGGGTAGTTTGGGGAAGTGG + Intronic
915089396 1:153412978-153413000 CTGTCGTGAGGTTGGGGCAGCGG + Intergenic
915467057 1:156104026-156104048 CTGAAGGAGGGATTGGGAAGGGG + Intronic
915508414 1:156371965-156371987 GTGGGGGAAGGTTGGGGAGGCGG + Intronic
915525466 1:156473385-156473407 CTCTGGGAGGCTTGGGGAAGGGG + Intronic
915763237 1:158336505-158336527 CTGAAGCAAGGATGGGGGAGAGG + Intergenic
918893511 1:190308486-190308508 CTGTTGTAGGGTGGGGGAAGGGG + Intronic
919603713 1:199653305-199653327 CTGTTGTAGGGTGGGGGAAGGGG + Intergenic
920192557 1:204202845-204202867 CTTCAGAAAGGTTGGGGCAGGGG + Intronic
920556836 1:206910074-206910096 GTGTAGGGAAGTTAGGGAAGTGG - Intronic
920880425 1:209875422-209875444 CTGAAGGATGTTTGGGGAGGAGG - Intergenic
920959618 1:210652694-210652716 CTGTAAGAAGAATGGGGAAAGGG + Intronic
921991278 1:221370386-221370408 CTGTTGCTAGGTTGGGGATGAGG + Intergenic
922719472 1:227893021-227893043 CTGGAGGGAGAGTGGGGAAGGGG - Intergenic
923000671 1:230004196-230004218 CTGTCGGAAAGTTTGGCAAGAGG - Intergenic
923390292 1:233508040-233508062 CTATAGGCAGAGTGGGGAAGTGG + Intergenic
924569586 1:245226143-245226165 CTGCAGGAAGGTGGGCAAAGTGG + Intronic
1063985043 10:11493436-11493458 GAGAAGGAAGGTAGGGGAAGAGG - Intronic
1065088279 10:22203003-22203025 AGGTAGGAAGGTAGGAGAAGGGG - Intergenic
1065473977 10:26114086-26114108 GTGGAGGGAGGTTGGGGAGGAGG - Intronic
1065616162 10:27526361-27526383 CTGTAAGCAGCTTGGGGAACCGG - Intronic
1065958417 10:30713543-30713565 ATGAAGGAGGGTTGAGGAAGAGG + Intergenic
1067348212 10:45453708-45453730 CTGTAAGAAGGTGAGGGAGGTGG - Intergenic
1068304047 10:55180287-55180309 TTGTAGAAAGTTTGGGGAACAGG + Intronic
1068585810 10:58796923-58796945 CTGTATGAGGGGTGGGGAGGGGG + Intronic
1068735391 10:60408415-60408437 CAGGAGGAAGGTTGGGGAGGGGG - Intronic
1069615620 10:69804304-69804326 CAGCAGGAAGGTCTGGGAAGGGG - Intronic
1069673621 10:70232226-70232248 GTGTATGAAGGAAGGGGAAGCGG - Intronic
1070129387 10:73646560-73646582 GAGGAGGAAGGTGGGGGAAGGGG + Exonic
1070627591 10:78062325-78062347 CTGTCGGAAGGTAGGGGATAGGG - Intergenic
1070732621 10:78841816-78841838 CCACAGAAAGGTTGGGGAAGAGG + Intergenic
1071729907 10:88237309-88237331 TTGAAGGAAGGAAGGGGAAGAGG - Intergenic
1071900785 10:90118768-90118790 CTGCAGCAAGGCTGGGGGAGGGG - Intergenic
1072374485 10:94800732-94800754 CTGCAGCCAGGTGGGGGAAGGGG - Intronic
1072540418 10:96394217-96394239 TTGTAGGGGGGCTGGGGAAGTGG + Intronic
1072540700 10:96396075-96396097 AGGAAGGAAGGTTGGGGAGGCGG + Intronic
1072631877 10:97151923-97151945 CTGCAGTGGGGTTGGGGAAGGGG + Intronic
1072660061 10:97358485-97358507 CTGGAGGATGGGTGGGGATGAGG - Intronic
1073463413 10:103679533-103679555 ATGGAGGAAGGGTGGGGGAGAGG + Intronic
1073818156 10:107230202-107230224 CTGTTGTAGGGTTGGGGGAGGGG + Intergenic
1073905860 10:108278715-108278737 CTATAGGAAGGTGGGGGATTGGG + Intergenic
1074346448 10:112690909-112690931 CTGAAGGAGGGCTGGGGCAGGGG - Intronic
1074511349 10:114115393-114115415 GTGTTGGAGGGATGGGGAAGAGG - Intergenic
1074526517 10:114267796-114267818 CTGCAGGAAGGTGAGGGAGGAGG + Intronic
1074548905 10:114425144-114425166 CTATTAGAAGGTTGGGGAGGTGG - Intergenic
1074807146 10:117065150-117065172 CTGTAGGGAGGTTGGGGGCAAGG + Intronic
1074944645 10:118269659-118269681 TAGCAGGAAGGTTGGGGAGGGGG + Intergenic
1075629969 10:123994894-123994916 CTGCGGGAAGGGTGTGGAAGGGG - Intergenic
1076088896 10:127661658-127661680 CTGTTGTGGGGTTGGGGAAGGGG - Intergenic
1076716428 10:132366592-132366614 CTGCAGGAAGGGTGGGGACACGG - Intronic
1076849865 10:133087438-133087460 ATGCAGGAGGGTTGGGGTAGGGG + Intronic
1077009486 11:373865-373887 CTGCAGGGAGGTGGGGGGAGTGG - Intronic
1077318473 11:1929556-1929578 CAGGAGGAAGGGTGAGGAAGAGG - Intronic
1078726758 11:13939071-13939093 CGGTAGCAAGGCTGGGGGAGGGG - Intergenic
1078754220 11:14193587-14193609 TTGTGGGATGCTTGGGGAAGAGG + Intronic
1078818406 11:14850332-14850354 CTGTTGTAGGGTGGGGGAAGGGG + Intronic
1078977722 11:16496753-16496775 CTGCAGCAAGGCTGGGGGAGGGG + Intronic
1079251073 11:18788406-18788428 GAGAAGGAAGGTTGGGTAAGGGG - Intronic
1079497730 11:21064652-21064674 ATGGAGGAAGGATGGGAAAGTGG + Intronic
1079641266 11:22808395-22808417 CAGTAGAAAGGATGTGGAAGAGG + Intronic
1081095854 11:38934169-38934191 CAATAGGAAAGTTGGAGAAGGGG + Intergenic
1081534801 11:43988930-43988952 CAGTAGGAAGTTTGGGGAGAAGG - Intergenic
1081688720 11:45060483-45060505 CTGGAGGAAGGATGGAGCAGTGG + Intergenic
1082200713 11:49363233-49363255 CAGTAGGAAGGAGGGGGCAGTGG + Intergenic
1082864407 11:57885590-57885612 CTGTGAGAAGGGTGGAGAAGAGG - Intergenic
1083138563 11:60702855-60702877 TTGGAGGAGGGTTGGGGGAGGGG + Intronic
1083612022 11:64008800-64008822 ATGTGGGGAGGTTGGGGATGGGG + Intronic
1083802912 11:65057291-65057313 CTGGAGGAAGTGAGGGGAAGGGG - Intronic
1084129011 11:67119206-67119228 CTGGAGGAGGGGTGGGGAGGTGG + Intergenic
1084426934 11:69089129-69089151 CTGTGGGATGGTGGGGGAGGGGG + Intronic
1084904328 11:72334412-72334434 CTTTAGGAAGGCTGAGGCAGGGG + Intronic
1085039291 11:73317514-73317536 CGGTAGCAGGGTGGGGGAAGGGG + Intronic
1085516162 11:77113059-77113081 CTGTAGGTAGCTGGGGGCAGAGG + Intronic
1085595559 11:77806036-77806058 TTGTGAGAAAGTTGGGGAAGTGG - Intronic
1085740470 11:79074358-79074380 CAGAAGGAATGCTGGGGAAGGGG + Intronic
1086482048 11:87251989-87252011 CTGTAGGTGGGTTGGGGTAGTGG + Intronic
1087642311 11:100768343-100768365 CTGAAGAAAGGTGGGGGATGAGG + Intronic
1088013025 11:105026183-105026205 GTGTGGGAAGGTTGAGGAAAGGG - Exonic
1088083899 11:105955268-105955290 CTGTTGGAGGGTTGGGGGTGAGG - Intronic
1088318073 11:108527485-108527507 CTTTAGGAAGGTTTTGAAAGCGG - Intronic
1088458764 11:110060624-110060646 CTGTAGGAAGGTGAGGGAGTAGG + Intergenic
1088469299 11:110176546-110176568 CTGTAGGCAGATGGGGAAAGAGG + Intronic
1088617268 11:111643301-111643323 CTGTTGGAAGGTTGGGGGCGAGG + Intronic
1089058936 11:115610237-115610259 CTGTGGGAAGGGGGGGAAAGGGG - Intergenic
1089392704 11:118113015-118113037 CTCAAGGAGGGCTGGGGAAGGGG - Intronic
1089482802 11:118820726-118820748 ATGCAGGAATATTGGGGAAGAGG + Intergenic
1089518731 11:119049715-119049737 TTGTGTGAAGGTTGGGGAGGTGG - Intronic
1089537230 11:119168442-119168464 CTGAAGGTAGGCTGGGGAGGCGG + Intronic
1090875633 11:130786449-130786471 CAGCAGGAAGGTGGGGGCAGGGG - Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091224273 11:133948412-133948434 CTGAAGCAAGGTTGGGGGTGGGG - Intronic
1091371648 11:135065311-135065333 CTGTTGTGAGGTGGGGGAAGCGG - Intergenic
1091377989 12:38262-38284 AAGTTGGAAGGCTGGGGAAGGGG + Intergenic
1091596920 12:1884560-1884582 ATGTAGGAAGTTTGGGGTAAGGG - Intronic
1091647881 12:2287434-2287456 GTTTAGGAAGGTTGGGTCAGTGG + Intronic
1091856703 12:3746391-3746413 GTGGAGGAAGGGTGGGGAAGAGG - Intronic
1092841703 12:12548772-12548794 CTGTAGGATGGTTTGGGAGAAGG - Intronic
1093325905 12:17773954-17773976 CGGCAGGGAGGCTGGGGAAGGGG - Intergenic
1094792241 12:33928682-33928704 CTGCAGCAAGGCTGGGGGAGGGG + Intergenic
1095133262 12:38568121-38568143 CTGGGGGAAGGTGGGGGTAGGGG - Intergenic
1095185108 12:39192420-39192442 CTGTTGTGGGGTTGGGGAAGGGG - Intergenic
1095662014 12:44747293-44747315 CTGTTGTAAGGTGGGGGAAGGGG + Intronic
1096683132 12:53270099-53270121 CTGGAGGTAGGGTGGGGACGTGG + Intronic
1096770593 12:53933743-53933765 GATGAGGAAGGTTGGGGAAGGGG + Intergenic
1096774518 12:53955854-53955876 CTGTGGGAAGGTGGAGGGAGAGG - Intronic
1096826847 12:54285844-54285866 GTGTTGGAAGTTTGGGGAGGAGG + Intronic
1096891625 12:54777180-54777202 CTGCAGCAAGGCTGGGGGAGGGG + Intergenic
1096976781 12:55703858-55703880 GAGAAGGAAGGATGGGGAAGGGG - Intronic
1097100914 12:56588761-56588783 CTGTAGGAAGGTTGGGGAAGTGG + Intronic
1097396307 12:59079131-59079153 CTGTCAGAAGGCTGGGGAAGAGG + Intergenic
1097564860 12:61254332-61254354 CTGTAAGCAAGCTGGGGAAGGGG - Intergenic
1098003738 12:65972505-65972527 CTGAAGGAAGGGTGGTGAGGAGG + Intergenic
1098232454 12:68386390-68386412 CTGTGAGATGGTTGGGGAGGTGG - Intergenic
1098699990 12:73611679-73611701 CTGTCGTGGGGTTGGGGAAGTGG + Intergenic
1098863311 12:75733620-75733642 CTGTTGGAAAGTAGGGGAAACGG + Intergenic
1098986476 12:77017847-77017869 TTGTAGGAAGGGAGGGAAAGTGG + Intergenic
1099731364 12:86508205-86508227 CTGTCGTATGGTGGGGGAAGGGG - Intronic
1099951100 12:89304579-89304601 ATGTATGGGGGTTGGGGAAGCGG + Intergenic
1101078392 12:101154972-101154994 CTGTGGTAGGGTTGGGGGAGGGG + Intergenic
1101100955 12:101392036-101392058 CTGTTGTGAGGTGGGGGAAGGGG + Intergenic
1101186687 12:102288327-102288349 CTGTTGTGGGGTTGGGGAAGCGG - Intergenic
1101266389 12:103092819-103092841 CTATAGCAAGGTTGAGGAAAAGG - Intergenic
1101972428 12:109324868-109324890 CTGTTGGAGGGTAGGGGAAAAGG - Intergenic
1102627355 12:114245764-114245786 CTGTAGGCCGGAGGGGGAAGAGG + Intergenic
1102735220 12:115153324-115153346 CTGTACCAAGTCTGGGGAAGAGG + Intergenic
1103211906 12:119173300-119173322 CAGCAAGAAGGTGGGGGAAGAGG + Intergenic
1104514534 12:129412515-129412537 CTGTAGGAAGAATGAGGAGGAGG - Intronic
1105834163 13:24193594-24193616 CAGGAGGAAGGATGGAGAAGGGG + Intronic
1106028199 13:25974864-25974886 CTGTGGGATGGTGGGTGAAGAGG - Intronic
1106029376 13:25985856-25985878 ATGTAGGAAGATTGGGGTGGGGG + Intronic
1106548666 13:30752552-30752574 CTGTGGGAAGGCCGGGGATGTGG - Intronic
1107111835 13:36706574-36706596 CTGTCTGAGGGTTGGGGCAGGGG + Intergenic
1107300232 13:38958342-38958364 CTGCAAGAAGGTCTGGGAAGTGG - Intergenic
1107986774 13:45782921-45782943 CAGTCGGCAGGTTGGGGAAGGGG - Exonic
1108350525 13:49586550-49586572 CTCCAGTAATGTTGGGGAAGTGG - Intergenic
1108839526 13:54594622-54594644 CTGTCAGTGGGTTGGGGAAGGGG + Intergenic
1109953582 13:69535067-69535089 CATTAGGAAAGCTGGGGAAGTGG + Intergenic
1109980721 13:69902749-69902771 CTGTTGTAGGGTTGGGGGAGGGG + Intronic
1110129872 13:71994105-71994127 CTGGAGGAAGGTTGGTGGAAGGG - Intergenic
1110538769 13:76683709-76683731 CTATTGGTAGGTTGGGGAAAGGG + Intergenic
1112023951 13:95395471-95395493 ATGGAGGAGGGTTGGGGGAGAGG + Intergenic
1112729247 13:102341534-102341556 TGGTAGGTAGGTTGGGGAAGGGG - Intronic
1112926730 13:104684742-104684764 CTGAAAGCAGGTTGGGGCAGGGG + Intergenic
1113914079 13:113860734-113860756 CTGGAGGAATGTCGGGGGAGGGG + Intronic
1114635609 14:24185150-24185172 CAGTGGGGAGCTTGGGGAAGGGG - Intronic
1115135765 14:30106518-30106540 ATGTAAGAGGGTTGGGGGAGAGG + Intronic
1115587536 14:34829589-34829611 TTGTAGGAATGGTAGGGAAGTGG - Intronic
1117448090 14:55823980-55824002 CTGAAGCTAGCTTGGGGAAGAGG - Intergenic
1118042537 14:61932743-61932765 CTGAAGCAAAGATGGGGAAGGGG - Intergenic
1118728840 14:68652429-68652451 CTGTTGGAGGGCTGGGGAGGGGG - Intronic
1120854621 14:89201855-89201877 CTGTGGGAAAGTTGGTGCAGGGG - Intronic
1121509167 14:94499732-94499754 CTGTAGGGAAGTGAGGGAAGTGG + Intronic
1121823523 14:96991275-96991297 CTGTAGGAGTCTTGGGGCAGTGG + Intergenic
1121905344 14:97736702-97736724 CTGTTGGAATGTGGGGGATGAGG - Intergenic
1122117813 14:99536391-99536413 CTGTAGAAAGGTGGGGGGTGTGG + Intronic
1122402385 14:101475093-101475115 CTCTTGGAAGGATGGGGAGGCGG + Intergenic
1122643736 14:103177647-103177669 CAGTAGGCAGGGTGGGGAAAGGG + Intergenic
1122827505 14:104377382-104377404 ATGGAGGCAGGTTGGGGTAGGGG - Intergenic
1123022628 14:105408795-105408817 CTGGTGGGAGGATGGGGAAGGGG - Intronic
1202943623 14_KI270726v1_random:6661-6683 CTGTAGGGGGGTTGGGGGAAGGG - Intergenic
1124013446 15:25858161-25858183 CTGTAGGTAGGTTAGGGCACTGG - Intronic
1124134186 15:27019624-27019646 CTGAAGGAAGGTTGGTGATGGGG + Intronic
1125875124 15:43137618-43137640 CTGTGGGAGGGTTGGGACAGTGG - Intronic
1125919626 15:43517818-43517840 CAGTAGGCAGGATGGGGAAATGG + Intronic
1126002604 15:44225263-44225285 CTGTAAGTAGGTTTGGGAAAAGG + Intergenic
1126124471 15:45283019-45283041 CTGTAGTGGGGTTGGGGGAGGGG + Intergenic
1127133228 15:55890353-55890375 CTGAAGGAGGGGTGGGGAAATGG - Intronic
1127270058 15:57392331-57392353 CTAGAGGGAGGTTGGGGAAGGGG + Intronic
1127329852 15:57928087-57928109 CTGTTGGAAGGTTGGGGGATAGG - Intergenic
1127355366 15:58193782-58193804 CTGCAGGGAGGCTGGGGGAGGGG + Intronic
1127687168 15:61359302-61359324 CTGTTGGGAGGTGGGGGGAGAGG - Intergenic
1127762152 15:62149977-62149999 CTGTAGGAAGGCTGGCTAAATGG - Intergenic
1128055760 15:64699154-64699176 TGGTAGGAGGGTTGGGGGAGAGG - Intronic
1128147372 15:65339445-65339467 CTTTAGGAAGTTTGAGGAAAAGG + Intronic
1128336369 15:66788256-66788278 CTGTTGGGGGGTTGGGGAGGGGG + Intergenic
1129823443 15:78619771-78619793 CTGGGGGCAGCTTGGGGAAGCGG + Intronic
1130136139 15:81183407-81183429 CTGCAGGAAGGTAGGGGATCTGG - Intronic
1130484100 15:84388194-84388216 CTGTTGTGAGGTTGGGGGAGGGG - Intergenic
1131123325 15:89836999-89837021 CTCTGGGAAGGCTGAGGAAGGGG + Intronic
1131488074 15:92838614-92838636 TTGTTGGAAGGTTGGGACAGTGG - Intergenic
1131709519 15:95037828-95037850 CAGTAGGATGGATGGGGAACTGG - Intergenic
1132230818 15:100182531-100182553 CTGTTGAAGGGTGGGGGAAGAGG + Intronic
1132314616 15:100880483-100880505 CAGTTGGAAGACTGGGGAAGCGG + Intronic
1132448938 15:101954734-101954756 AAGTTGGAAGGCTGGGGAAGGGG - Intergenic
1132538683 16:497006-497028 CTGAAGGAGTGTTGGGAAAGGGG + Intronic
1132752889 16:1466989-1467011 CAGGACGATGGTTGGGGAAGGGG - Intronic
1132930467 16:2456522-2456544 CTGCAGGAAGGTTGGTGGGGAGG - Intronic
1134382633 16:13742232-13742254 CTGTCTCAAGGTTGGGGAAGGGG + Intergenic
1134447791 16:14343913-14343935 CTGAATTAAGGTGGGGGAAGAGG + Intergenic
1136374303 16:29856274-29856296 CTCCAGGGAGGTTGGGGGAGTGG - Intergenic
1136539884 16:30923463-30923485 GTGGAGGAAGGAGGGGGAAGGGG + Intronic
1137676657 16:50306986-50307008 CTGGAGGCAGGGTGGGCAAGTGG + Intronic
1137864442 16:51878759-51878781 CTGAAGGAAGGTTTGGTTAGGGG - Intergenic
1137949666 16:52771586-52771608 CTGTAGGAAACTGGGGGTAGAGG + Intergenic
1137950577 16:52779782-52779804 TTGTAGGGAGGTGGGGAAAGAGG + Intergenic
1138135489 16:54517679-54517701 TTTTAGGTTGGTTGGGGAAGGGG - Intergenic
1139152082 16:64394962-64394984 CTGTTGTAGGGTGGGGGAAGGGG - Intergenic
1139256954 16:65551538-65551560 CGGCAGCAAGGCTGGGGAAGGGG + Intergenic
1139322667 16:66127932-66127954 CTGGAGGAAGGGTGGGGACCAGG + Intergenic
1140410220 16:74736695-74736717 CCTGAGGAAGGATGGGGAAGAGG + Intronic
1142990268 17:3725393-3725415 CTGTGAGAAGATTGGGGAAGGGG + Exonic
1143479845 17:7221871-7221893 CTGCTGGAGGGATGGGGAAGTGG + Intronic
1143751501 17:9031552-9031574 CTGTCTGCAGGTTGGGGAAGGGG - Intronic
1144420922 17:15097828-15097850 GTGCAGGAAGGAGGGGGAAGAGG - Intergenic
1144713477 17:17418704-17418726 GTATGGGAAGGTTGGGGAAAGGG - Intergenic
1145180489 17:20746055-20746077 CTGTAGAAATGATGGGGAAGAGG + Intergenic
1145231691 17:21177762-21177784 CTGTAGAAAAGCTGGGGCAGGGG - Intronic
1145723263 17:27091370-27091392 CAGTAGGAAGTCTGGGGAACGGG + Intergenic
1146507993 17:33422090-33422112 CTGGAGGCAGGTCAGGGAAGAGG - Intronic
1147462029 17:40578938-40578960 CTGTAGTGGGGTTGGGGGAGGGG + Intergenic
1147658515 17:42104721-42104743 CTGTGGGAGGGATGGGGAGGAGG - Intronic
1147896250 17:43753332-43753354 CAGTAGGAAGCTTGGTGGAGTGG + Intergenic
1147918063 17:43900410-43900432 CTGGAGGAAGGTAGGCTAAGGGG + Intronic
1148728549 17:49815306-49815328 CTGCAGGAAGGGAGGGGCAGGGG - Intronic
1149133756 17:53340291-53340313 CTGCAGGCTGGTAGGGGAAGAGG + Intergenic
1149224034 17:54447973-54447995 CTGTTGGGGGGTGGGGGAAGGGG - Intergenic
1149840087 17:59955028-59955050 CTGTAGAAATGATGGGGAAGAGG + Intronic
1150195232 17:63291067-63291089 CTATAGGAAGCTGGGGGAAGGGG - Intronic
1150419568 17:65020129-65020151 CTTTAGGAAGGTAGGAGGAGAGG - Intronic
1150596302 17:66608722-66608744 CTCCAGGAAGGTTGGGAAGGAGG + Intronic
1150750839 17:67861312-67861334 ATCTTGGAAGGTTGGGGTAGGGG - Intronic
1151267105 17:72965092-72965114 CTGTTGTGAGGTGGGGGAAGGGG + Intronic
1151290291 17:73144940-73144962 CTGTTGAAAGGGTGGAGAAGTGG + Intergenic
1152164545 17:78693920-78693942 ATTTAGGAAGATTGGAGAAGCGG - Intronic
1152598368 17:81249237-81249259 GAGAAGGAAGGTGGGGGAAGAGG + Intronic
1153524787 18:5984641-5984663 ATGTATCAAGGTGGGGGAAGGGG - Intronic
1153847382 18:9062275-9062297 CAGTAGAAGGGTTGGGGAAGAGG - Intergenic
1155440383 18:25856023-25856045 GGGATGGAAGGTTGGGGAAGAGG + Intergenic
1156004369 18:32422136-32422158 CTGTTGTGGGGTTGGGGAAGGGG - Intronic
1157305971 18:46518056-46518078 CTGAAGGCAGGGTGGGGCAGAGG + Intronic
1157501406 18:48193495-48193517 CTGTTGGGAGGTTGGGTAAGGGG - Intronic
1158779018 18:60624184-60624206 TTGTAGGCAGCTTGGGGAGGTGG + Intergenic
1159028303 18:63206782-63206804 CAGTGGGAGGGTTGGGGCAGGGG + Intronic
1160142865 18:76340857-76340879 CTGTAGGGAGGTTTGGAAGGTGG - Intergenic
1160636322 19:77819-77841 AAGTTGGAAGGCTGGGGAAGGGG + Intergenic
1160899206 19:1418717-1418739 CCGAAGGAAGGATGGGTAAGGGG + Exonic
1161092440 19:2368522-2368544 CTGTGGGGAGGTTTGGGCAGAGG + Intergenic
1162043730 19:7985465-7985487 CTGTAAGGAGTTTGGGGATGTGG - Intronic
1162986323 19:14272470-14272492 CTGAAGGAATGTGGGGGCAGGGG + Intergenic
1163124184 19:15235752-15235774 CTGTGGGAAGGGTTGGGAAATGG + Exonic
1163199922 19:15759866-15759888 CTGTCTGAAGGTAGGGGAAGGGG + Intergenic
1163858554 19:19726792-19726814 CGGCAGCAAGGCTGGGGAAGGGG - Intronic
1164133175 19:22384654-22384676 CTGTAGTGAGGCTGGGGAAGGGG - Intergenic
1164165636 19:22672104-22672126 CTGTAGTGAGGCTGGGCAAGGGG + Intergenic
1164542751 19:29133009-29133031 CAGCAGCAAGGCTGGGGAAGGGG + Intergenic
1164887597 19:31795686-31795708 CTGGAGGCAGGTTGGGGCATGGG - Intergenic
1165810279 19:38607805-38607827 TTGTAGGAAGGTGGGGGCTGAGG + Intronic
1165951057 19:39474151-39474173 CAGTAGGAGGGTTTGGGCAGGGG - Intronic
1166775786 19:45311699-45311721 CTGGAGGAGGCTGGGGGAAGAGG + Intronic
1167042259 19:47028939-47028961 CTGTAGGGAGGATGGGGCAGGGG + Intronic
1167635861 19:50655190-50655212 CTCTAGGATTGTAGGGGAAGGGG + Intronic
1167636614 19:50659390-50659412 CTGGAGGAAGATTAGGGACGCGG - Intronic
1167643585 19:50694747-50694769 CTGAGAGAAGGTTAGGGAAGAGG + Intronic
1167645483 19:50703121-50703143 CTGGAGGGAGGATGAGGAAGGGG - Intronic
1168412714 19:56149632-56149654 CTGTCGGGGGGTGGGGGAAGGGG - Intronic
925094102 2:1181061-1181083 CTGTAGTGGGGTGGGGGAAGGGG + Intronic
926151342 2:10427195-10427217 CTGTGGGAAGGGTGGGGACGAGG + Exonic
926310096 2:11669096-11669118 CTGGAGGTAGGGTGGGGACGGGG - Intronic
926950483 2:18237316-18237338 GTGTAGGAAGGTAGGTAAAGAGG + Intronic
927151493 2:20198863-20198885 TTGTAGGATGGGTGGGGAGGAGG - Intergenic
927509998 2:23638557-23638579 ATGGAGGAAGTGTGGGGAAGTGG - Intronic
927791749 2:26015612-26015634 CTGGAGGAAAGAAGGGGAAGGGG + Intergenic
931076343 2:58717510-58717532 CAGGAGGAAGATTTGGGAAGTGG + Intergenic
931624560 2:64245181-64245203 CTGAAGGGAAGTTGGGGAAGCGG - Intergenic
932069309 2:68600928-68600950 CTGTTGTAGGGTTGGGGGAGTGG + Intronic
932212230 2:69941811-69941833 CTCTTGAAAGGATGGGGAAGAGG - Exonic
933296113 2:80493034-80493056 CTGAAAGAAGGTTGGATAAGTGG + Intronic
933296203 2:80493978-80494000 CTGAATGAAGGTTGGATAAGTGG + Intronic
933381941 2:81559073-81559095 CTGTTGTGGGGTTGGGGAAGGGG + Intergenic
933425770 2:82110427-82110449 CTTTAGGAAGGTTGTGATAGAGG - Intergenic
933613180 2:84458734-84458756 CAGTAGGAAGTTGGGGGATGAGG - Intronic
933658430 2:84907285-84907307 CAGCAGGAAGGGTGGGGATGTGG + Intergenic
933987594 2:87604707-87604729 GTGGGGGAAGGATGGGGAAGAGG - Intergenic
936239216 2:110772611-110772633 TTGTAGGCTGGTTGGGGGAGGGG - Intronic
936306246 2:111346101-111346123 GTGGGGGAAGGATGGGGAAGAGG + Intergenic
936565159 2:113577231-113577253 AAGTTGGAAGGCTGGGGAAGGGG - Intergenic
936679814 2:114757212-114757234 CAGGAGGAAGGGTGGGGAAGAGG + Intronic
937050713 2:118886466-118886488 CTGTTGTAGGGTGGGGGAAGGGG - Intergenic
937487947 2:122335364-122335386 CAGCAAGAAGGATGGGGAAGTGG + Intergenic
937561471 2:123230091-123230113 CTCTAGCAAGACTGGGGAAGAGG + Intergenic
937815950 2:126251132-126251154 CTGTAGGGAGGATGGGAAGGTGG + Intergenic
937908899 2:127065873-127065895 CTTTAGGAAGCATGTGGAAGGGG + Intronic
938184546 2:129218141-129218163 CTGTAGGGGGGTGGGGGAAAAGG + Intergenic
938203095 2:129392947-129392969 CTGGGGAAGGGTTGGGGAAGGGG + Intergenic
938779814 2:134575041-134575063 CTGTGGGGGGGTGGGGGAAGGGG + Intronic
938920695 2:135992048-135992070 CAGTAGGAAGTTGGGGAAAGAGG + Intergenic
940037881 2:149329840-149329862 CTGGAGGAAGGGTTGGGCAGAGG + Intergenic
940816894 2:158306672-158306694 CTGTTGCAGGGTGGGGGAAGGGG + Intronic
941296154 2:163740961-163740983 CTCTAGGAAGGTTGGGGTGTGGG - Intergenic
941665594 2:168241413-168241435 CTGCGGGAAGGTTGCTGAAGAGG - Intronic
941725177 2:168852742-168852764 CTGTCTGAAGGGTGGGGAAAGGG - Intronic
941792082 2:169563518-169563540 CTGTAGAAAGGTTTTGAAAGGGG + Intronic
942832397 2:180252581-180252603 CTGTTGGAAGGTTGGGGGCTAGG - Intergenic
944121810 2:196248542-196248564 CTGTAGGAAAGGTGGGGAAAGGG + Intronic
945162620 2:206908442-206908464 CGGCAGCAAGGCTGGGGAAGGGG + Intergenic
945391419 2:209269860-209269882 CTGTGGGAAGGAGTGGGAAGGGG - Intergenic
945622696 2:212160854-212160876 CTGAGGGTAGGTTGGGGAAGGGG + Intronic
946156175 2:217808185-217808207 CTGCAGGAAGGTCTGGGGAGAGG + Intronic
946295958 2:218783680-218783702 CTGTTCTAAGGTTGGGGAAGAGG + Intronic
946330718 2:219007589-219007611 GTGTAGGAAGGTTGTGAAATTGG + Intronic
946713187 2:222526857-222526879 CTGTTGGGAGGTTGGGGGTGAGG + Intronic
946719070 2:222584775-222584797 CTGCAGCAAGGCTGGGGGAGGGG + Intronic
946750152 2:222886223-222886245 CTGTAGGTGGGTGGGGTAAGGGG - Intronic
948575182 2:238945369-238945391 ATGTAAGAAGGGTGGGGTAGTGG - Intergenic
948832195 2:240603581-240603603 CAGTGGGAAAGTTGGGGAAGGGG - Intronic
1168917904 20:1506355-1506377 CTGTAGCAAGTTTTGGGAAGAGG + Intergenic
1169713550 20:8590972-8590994 CTGTTGGAAGGTCGGGGAGGGGG - Intronic
1169785365 20:9354110-9354132 CTGCAGGGAGGTTGGGTAAGAGG - Intronic
1170469812 20:16657213-16657235 CTGTCGGAAGGTGGGGTAGGGGG - Intergenic
1170588394 20:17752766-17752788 CTGTAGGGAGTCTGGTGAAGGGG + Intergenic
1170902778 20:20482281-20482303 CTGTAGGTAGTTTGCAGAAGAGG + Intronic
1172434647 20:34920516-34920538 CTGTGGGAAGAATGGGGAACAGG - Intronic
1172649528 20:36493035-36493057 CTGTGGGTAGGGTGGGGATGGGG - Intronic
1172766722 20:37355061-37355083 CTGTAGCCAGGTGGGTGAAGTGG + Intronic
1172775027 20:37402325-37402347 GTGTGGGGAGGGTGGGGAAGGGG + Intronic
1173566427 20:44041576-44041598 CTGAAGTGCGGTTGGGGAAGTGG + Intronic
1173825224 20:46043812-46043834 GTGCAGGAAGGGTGGGGAGGGGG + Intronic
1174366963 20:50062313-50062335 CTGTAGGAAGATTTGGTGAGAGG - Intergenic
1174522551 20:51142894-51142916 ATCTAGGAAGGTTTTGGAAGTGG + Intergenic
1174529668 20:51201043-51201065 CTGGAGTAAGGTGGGGGATGGGG - Intergenic
1175332067 20:58172022-58172044 CTGAAGGATGGTTGGGGAGGTGG - Intergenic
1175341346 20:58232151-58232173 TTGTAGGTAGGGTGGGGCAGGGG + Intergenic
1175384104 20:58583240-58583262 GTGTAGAAATGTTTGGGAAGGGG + Intergenic
1175555955 20:59856910-59856932 CTGTTGTAGGGTAGGGGAAGGGG + Intergenic
1175671796 20:60909622-60909644 CTGTAGGAAGGTGGGGGCCAAGG - Intergenic
1176186687 20:63784078-63784100 CTCCACGAAGGTTGGGGAGGAGG - Intronic
1176200766 20:63859334-63859356 CTCTAGGCAGGTTGGGGCTGTGG - Intergenic
1177176772 21:17708148-17708170 CTGTTGGAGGGTTGGGGGAAGGG - Intergenic
1177260971 21:18729357-18729379 GTGTAGAAAGGGTGGGGAAGTGG + Intergenic
1179145746 21:38765910-38765932 CTGGAGGGGGCTTGGGGAAGGGG + Intergenic
1179150593 21:38805708-38805730 CAGCAGGAGGGTTGGGGGAGCGG - Intronic
1179155958 21:38851517-38851539 CTGGAGCAGGGATGGGGAAGGGG + Intergenic
1180375533 22:12089388-12089410 CTGTTGGGGGGTGGGGGAAGGGG + Intergenic
1180377293 22:12105972-12105994 CTGTTGTGAGGTGGGGGAAGGGG - Intergenic
1180669126 22:17539506-17539528 CTGTTGTGAGGTGGGGGAAGAGG + Intronic
1181162931 22:20968264-20968286 CTGTTGCAGGGTTGGGGAAGGGG + Intronic
1181932359 22:26412496-26412518 ATGTAGGATGAATGGGGAAGAGG + Intergenic
1181985263 22:26796264-26796286 CTGCAGGGAGCTTGGGGCAGAGG - Intergenic
1183261509 22:36798625-36798647 CTGAAGTGGGGTTGGGGAAGAGG - Intergenic
1183462693 22:37961843-37961865 CTATAGGGAGTTTGGGGTAGGGG - Intronic
1183734288 22:39635445-39635467 CTGTAGGAAGCGTGGGGACGTGG + Intronic
1183735773 22:39644034-39644056 CTGGAGGAGGGATGGGGAGGTGG + Intronic
1183781711 22:40003158-40003180 CTGTGCTAAGGCTGGGGAAGAGG + Intronic
1184851550 22:47124234-47124256 ATGCAGGAAGGTTGGGGATGGGG + Intronic
1184886219 22:47345932-47345954 CTGTTGTGAGGTGGGGGAAGGGG - Intergenic
1185248970 22:49789671-49789693 CTGTAGGTGGTTGGGGGAAGGGG - Intronic
950394792 3:12725939-12725961 ATGTGGAAAAGTTGGGGAAGGGG + Intergenic
951045835 3:18037440-18037462 CTGTAGGAAGGCAGCGGGAGTGG + Intronic
952157007 3:30654414-30654436 CTGTAGGGAGGCAGGGGAACTGG - Intronic
952534805 3:34298103-34298125 CTGCAGGAAGTGTGGGGTAGAGG + Intergenic
952696183 3:36267438-36267460 CTGTAAGATGGTGGTGGAAGTGG - Intergenic
954072114 3:48150660-48150682 TTTTAGGAGGGTTGGGGATGGGG - Intergenic
954391536 3:50270410-50270432 CTATCGGGAGGTTGGGGGAGAGG - Intronic
954536552 3:51363633-51363655 CTGTTGTCAGGTGGGGGAAGTGG - Intronic
954891864 3:53937919-53937941 ATGGTGGAAGGTTGGAGAAGTGG + Intergenic
955008164 3:54989035-54989057 CTGCAGGAAGCTTGAAGAAGTGG - Intronic
955058317 3:55474894-55474916 CTGGGGGGAGGTTGGGGTAGAGG + Intronic
955181490 3:56675146-56675168 ATGTAGAATGGTTGGGGATGTGG - Intronic
955311017 3:57886517-57886539 CTGTAGGAAGATTGAGGAGAAGG + Intronic
955580270 3:60412276-60412298 CTTGAGGAAGGTGGGGGAAAAGG + Intronic
955665794 3:61348034-61348056 GTGTAGCAAGGGTGGGGAGGTGG + Intergenic
957133056 3:76247322-76247344 ATGTGGGGAGGTTTGGGAAGAGG - Intronic
958171433 3:89944676-89944698 CTGCAGCAAGGCTGGGGGAGGGG - Intergenic
958651529 3:96942321-96942343 CTGCAGCAAGGCTGGGGGAGGGG - Intronic
959204253 3:103284528-103284550 CAGTAGGATGGATGGGGAACTGG + Intergenic
959688722 3:109176146-109176168 CTGTTGTAAGGTGGGGGGAGGGG - Intergenic
960140137 3:114143683-114143705 CTGGAGCTAGGTTGGGGGAGGGG - Intronic
960508967 3:118525604-118525626 CAGCAGGAAGGATGGGGAACTGG + Intergenic
960811885 3:121633938-121633960 CTGTAGGAACTATGAGGAAGGGG - Intronic
960896703 3:122514218-122514240 CCGGAGGGAGGTGGGGGAAGCGG - Intronic
961083027 3:124042699-124042721 CTGTGGGGAGGCAGGGGAAGAGG + Intergenic
961093838 3:124138136-124138158 CTGCAGGAGGGTGGTGGAAGTGG - Intronic
961134340 3:124496056-124496078 CTGGAGGAGTTTTGGGGAAGGGG + Intronic
961345330 3:126260264-126260286 CTAGAGGGAGGATGGGGAAGAGG - Intergenic
961819758 3:129569958-129569980 CTGTGCAGAGGTTGGGGAAGGGG + Intronic
962206216 3:133436752-133436774 CTGTAGTGGGGTGGGGGAAGCGG - Intronic
962441921 3:135427889-135427911 CTGTTGTGGGGTTGGGGAAGGGG + Intergenic
962829208 3:139124787-139124809 TAATAGGGAGGTTGGGGAAGTGG + Intronic
963234708 3:142945521-142945543 CAGTAGGATGGATGGGGAGGTGG + Intergenic
963415754 3:144993798-144993820 CTGTTGTGGGGTTGGGGAAGGGG - Intergenic
964074010 3:152671283-152671305 ATGTGGTAAGGTTGGGGCAGTGG - Intergenic
964715266 3:159714679-159714701 CGGCAGCAAGGCTGGGGAAGGGG + Intronic
964924219 3:161936431-161936453 CTATAAGAAAGTTGGGGAGGGGG + Intergenic
965600220 3:170447030-170447052 CTGTTGGGGGGTTGGGGGAGGGG + Intronic
966063450 3:175787298-175787320 CAGCAGGAAGGCTGGGGGAGGGG - Intronic
966176274 3:177141197-177141219 CTCTAGAAAGCTTGGGGATGGGG + Intronic
966288531 3:178326686-178326708 CTGAAGGAAGGGTGGGAAATAGG - Intergenic
966591814 3:181692580-181692602 CTGAAGGTATGTTTGGGAAGAGG - Intergenic
966925677 3:184643097-184643119 CTGTAGAATGGTAGGGGGAGGGG + Intronic
967200821 3:187070989-187071011 CTGTAGGAAGGTATGGGCATGGG + Intronic
967255493 3:187587759-187587781 CTGTCAGAAGGTGGGGGATGAGG - Intergenic
967814634 3:193788451-193788473 CTTTAAGAAGAATGGGGAAGGGG - Intergenic
967835603 3:193959962-193959984 CTGTAGAAAGGGTGTAGAAGGGG + Intergenic
969142727 4:5093556-5093578 CTGTTGTGAGGTGGGGGAAGGGG + Intronic
970719200 4:18966396-18966418 CTGTTGTGGGGTTGGGGAAGGGG + Intergenic
971196511 4:24475476-24475498 CTGTAGGAAGGAGGGGGAGTTGG - Intergenic
972277149 4:37568095-37568117 CTGTAGGAATGCTGAGGAACAGG - Intronic
973125157 4:46573709-46573731 TTGTAAGAAGGCTGGGGCAGTGG - Intergenic
974750478 4:66134008-66134030 CTGTTGTGAGGTGGGGGAAGAGG + Intergenic
974931673 4:68367026-68367048 CTGTTGGGAAGTTGGGGATGAGG + Intergenic
975092820 4:70423615-70423637 CGGCAGCAAGGCTGGGGAAGGGG - Intergenic
975104004 4:70548226-70548248 CTTTAAGAATGTTGGGGAATTGG - Intergenic
976289599 4:83403872-83403894 CTGTTGTGGGGTTGGGGAAGTGG + Intergenic
976451327 4:85194598-85194620 CTGTTGTGGGGTTGGGGAAGGGG + Intergenic
976806873 4:89057918-89057940 CTGTTGGGAGGTTGGGGGTGAGG - Intronic
977222677 4:94356374-94356396 CTGTAGGCATGTTATGGAAGAGG - Intergenic
978076691 4:104539989-104540011 CTGTTGGAGGGTTGGGGGATAGG - Intergenic
978591254 4:110327513-110327535 CGGCAGCAAGGCTGGGGAAGGGG - Intergenic
978724512 4:111954712-111954734 CTACAGGAGGTTTGGGGAAGAGG + Intergenic
978937685 4:114398260-114398282 CTGTAGGAAAGCTGTAGAAGAGG - Intergenic
980618584 4:135267331-135267353 CTGTTGGAAGGTGGGGGCAAGGG - Intergenic
981106515 4:140887766-140887788 CTCTGGGAGGGGTGGGGAAGAGG + Intronic
981504412 4:145482892-145482914 CTGTAGGAAGGTGGGGGTGGTGG + Exonic
982298129 4:153851021-153851043 CTGTAGGAAAACAGGGGAAGGGG + Intergenic
982308503 4:153959158-153959180 CTGTAGTGAGGTGGGGGGAGAGG + Intergenic
982380087 4:154740677-154740699 CTGCAGGCGGGTAGGGGAAGCGG + Intronic
983722137 4:170868680-170868702 CTGGAGGAATTTTAGGGAAGTGG - Intergenic
983976102 4:173936299-173936321 CTGAAGGAAGGTGGGTGGAGAGG - Intergenic
984164203 4:176288179-176288201 AAGAAGGAAGGTAGGGGAAGGGG - Intergenic
984806785 4:183758529-183758551 CGGTGGGAAGGCTGGGGACGGGG + Intergenic
985104936 4:186490857-186490879 CTGTAGGATGGTTGGACAAAGGG + Intronic
1202757132 4_GL000008v2_random:74830-74852 CTGTTGGGGGGTGGGGGAAGGGG + Intergenic
1202758898 4_GL000008v2_random:91431-91453 CTGTTGTGAGGTGGGGGAAGGGG - Intergenic
985514697 5:335500-335522 TTGTGGGCAGGCTGGGGAAGGGG + Intronic
985618531 5:939284-939306 CGGTAGGAAGACTGGGGCAGGGG - Intergenic
985948329 5:3203750-3203772 CTGGAGGGATGTAGGGGAAGAGG - Intergenic
986234478 5:5894360-5894382 ATGCAAGAAGGTTGAGGAAGTGG - Intergenic
986437022 5:7744215-7744237 CTGTTGGAGGGTGGGGGAAAAGG + Intronic
986443770 5:7803477-7803499 CTGTAGGAAGGAAGAGGAATGGG - Intronic
987330253 5:16850732-16850754 CTCTAAAAAGTTTGGGGAAGGGG + Intronic
987496693 5:18653695-18653717 CTGTGGGATGATAGGGGAAGGGG + Intergenic
987866564 5:23547710-23547732 CTCTTGTAAGGTTGGGGTAGTGG + Intergenic
988787603 5:34579075-34579097 CTTTGGTAAGGTTGGGGAAGTGG - Intergenic
988992597 5:36686042-36686064 CTGCAGGCAGGGTGGGGAGGAGG - Intronic
989366897 5:40666006-40666028 CTTCAGGAAACTTGGGGAAGAGG - Intergenic
989623545 5:43408483-43408505 CTGTCGTAAGGTGGGGGGAGCGG + Intronic
989953576 5:50330489-50330511 CTGCAGTGAGGCTGGGGAAGGGG + Intergenic
990237056 5:53779694-53779716 CTGTTGGAAGGGAGAGGAAGTGG + Intergenic
990435262 5:55783986-55784008 CTGTTGGAAGGTGGGGGACAGGG - Intronic
990854470 5:60248443-60248465 CTGTTGGCAGGTTTGGGCAGAGG + Intronic
990882524 5:60555892-60555914 CAGCAGCAAGGTTGGGGGAGGGG + Intergenic
991076621 5:62546442-62546464 CTGTCGTAGGGTTGGGGGAGTGG + Intronic
991250118 5:64550727-64550749 CTGTTGCAGGGTTGGGGGAGGGG - Intronic
991251611 5:64568408-64568430 GTGTAGGAAGGTGGAGGAAGAGG + Intronic
992080646 5:73232673-73232695 CTGGAGGAAGAGTGGGGAAGCGG - Intergenic
992310190 5:75490190-75490212 CTGTCGGGAGGTTGGGGACAAGG + Intronic
992603562 5:78431739-78431761 CTGTATAAAGGTTGGGAAGGGGG - Intronic
993098295 5:83506004-83506026 CTGTATGCAGCTTGGGGAATTGG - Intronic
993270571 5:85791054-85791076 CTGTAGTGGGGTAGGGGAAGTGG - Intergenic
994328319 5:98475550-98475572 TTGTGGGGAGGTTGGGGAGGAGG - Intergenic
994664270 5:102689131-102689153 CTGCAGCAAGGCTGGGGGAGGGG - Intergenic
995266846 5:110172210-110172232 CTGTAGTGGGGTGGGGGAAGGGG - Intergenic
995530398 5:113086440-113086462 CTGTAGGTAACTTGGGGAAAAGG - Intronic
998697703 5:144659079-144659101 CTGCAGCAAGGTGGAGGAAGAGG + Intergenic
999566450 5:152867786-152867808 ATATAGCAAGGTTGGGGTAGGGG - Intergenic
999953724 5:156677533-156677555 CTGTTGTAGGGTTGGGGGAGGGG + Intronic
999976520 5:156917107-156917129 ATTTAGAAACGTTGGGGAAGTGG - Intergenic
1000397082 5:160787385-160787407 TTGTAGGAAGGTTAGGGCAGGGG - Intronic
1000478719 5:161744619-161744641 CTGTGGGGAGGTTAGGGGAGAGG + Intergenic
1000760084 5:165212371-165212393 CTTTTGTATGGTTGGGGAAGGGG - Intergenic
1001076946 5:168636864-168636886 CTGTTGTGGGGTTGGGGAAGCGG + Intergenic
1003486910 6:6588018-6588040 AAGTAGGAAGGGTGGGGAGGTGG - Intergenic
1003730202 6:8813089-8813111 CTGTTGTGGGGTTGGGGAAGGGG + Intergenic
1003803014 6:9692968-9692990 CTGTTGGGGGGTTGGGGGAGAGG - Intronic
1003939717 6:11012152-11012174 CTTTAGAAAGCTTGGGAAAGAGG + Intronic
1004644404 6:17545693-17545715 CTGTTGTGAGGTTGGGGGAGGGG - Intronic
1005164688 6:22906342-22906364 CTGCAGGAATTCTGGGGAAGAGG + Intergenic
1006286006 6:33094869-33094891 CTGTAGGAAGGATGGGCTGGAGG + Intergenic
1006317416 6:33298755-33298777 CTGCAGGAAGGTTGGGGGAGGGG + Intronic
1006473827 6:34242869-34242891 CTGTGGGGAGGTCTGGGAAGGGG + Intronic
1006911680 6:37567310-37567332 CTTTTGGGAGGTGGGGGAAGAGG - Intergenic
1007065382 6:38985793-38985815 TTGCAGGAAGGCTGGGGAGGAGG - Intronic
1007590181 6:43016340-43016362 CAGTAGCAGGGATGGGGAAGTGG + Intronic
1007596855 6:43056290-43056312 CTGTAGGCAAGTTTGGGATGTGG - Exonic
1007702847 6:43774473-43774495 CTGTGGGGAGGAAGGGGAAGGGG + Intronic
1007713094 6:43837169-43837191 CTGAGGGTAGGTTGGGGGAGTGG + Intergenic
1007803462 6:44418142-44418164 CTGTTGGAGGGTGGGGGGAGAGG - Intronic
1008825175 6:55685077-55685099 CGGCAGCAAGGTTGGGGGAGGGG + Intergenic
1009241335 6:61189454-61189476 CTGTTGGGGGGTTGGGGGAGTGG + Intergenic
1009283158 6:61777132-61777154 CTGTTGGGGGGTGGGGGAAGGGG + Intronic
1010463287 6:76138046-76138068 CTGTTGTGAGGTAGGGGAAGGGG - Intergenic
1010492842 6:76495107-76495129 GCAGAGGAAGGTTGGGGAAGAGG + Intergenic
1011272274 6:85592143-85592165 CTGTAGGAGTGTGGGAGAAGTGG - Intronic
1011365434 6:86576581-86576603 CTGTAGTAGGGAAGGGGAAGGGG - Intergenic
1011366175 6:86584887-86584909 CTGGAGAGAGCTTGGGGAAGGGG - Intergenic
1011766703 6:90627951-90627973 CTGTTGTGAGGTGGGGGAAGGGG + Intergenic
1012527472 6:100195611-100195633 CTGTTGTAGGGTGGGGGAAGGGG + Intergenic
1012638617 6:101580457-101580479 GAGTAGGAAGGTAGTGGAAGAGG - Intronic
1014645874 6:123972009-123972031 ATGTTGAATGGTTGGGGAAGGGG - Intronic
1015127060 6:129766995-129767017 CTTAAGGAAGACTGGGGAAGAGG - Intergenic
1015561182 6:134517723-134517745 CTGTGGGAGGGGTGAGGAAGAGG - Intergenic
1016009186 6:139121205-139121227 CTGTCGTAGGGTTGGGGGAGCGG - Intergenic
1016292173 6:142538046-142538068 CTGAAGTAAGGTTGGGGCATGGG - Intergenic
1017897740 6:158695698-158695720 ATGTAGGACAGTGGGGGAAGGGG - Intronic
1018167092 6:161108342-161108364 CTGGAGGTAGGATGGGGAAAGGG + Intronic
1019376359 7:694607-694629 CTGGAGGTGGGTGGGGGAAGGGG - Intronic
1020119470 7:5495093-5495115 CTGCAGGGAGGATGGGGACGAGG + Intronic
1021185889 7:17564283-17564305 CTGTTGGAGGGTGGGGGATGAGG + Intergenic
1021363994 7:19753374-19753396 ATGAAGGCAGGTTTGGGAAGGGG - Intronic
1021526571 7:21594975-21594997 CTGTAGGGAGGCTAGGGAAGAGG + Intronic
1021888552 7:25164773-25164795 CAGGGGGAAGGTTGGGAAAGGGG - Intronic
1021993940 7:26161768-26161790 GTGGAGGTAGGTTGGGGAATGGG + Intronic
1022219467 7:28298226-28298248 CTGTAGGAAGGTGGGTGGGGAGG - Intergenic
1023028702 7:36074604-36074626 CTGTAGGAGGGATTGAGAAGGGG + Intergenic
1023097128 7:36672614-36672636 CTGTCAGAAGGTGGGGGAAAGGG + Intronic
1023839055 7:44085720-44085742 CTGGAGGATGGTTGGGGAGGGGG + Intergenic
1023852844 7:44159695-44159717 CTGTATGGAACTTGGGGAAGGGG + Intronic
1023932388 7:44713712-44713734 CTGGATGAAGGGTGGGGAGGGGG - Intergenic
1024680692 7:51683862-51683884 CTGTTGTAGGGTTGGGGGAGGGG + Intergenic
1024967364 7:55035862-55035884 CTGGAGGAGGTTGGGGGAAGGGG - Intronic
1025134705 7:56401294-56401316 CTGTTGTGGGGTTGGGGAAGGGG + Intergenic
1026540464 7:71275662-71275684 CTGTCTGAAGGTTGAGGAAGTGG + Intronic
1027046967 7:74997352-74997374 CTCTTGGAAGTTTGGGGAACAGG + Intronic
1027228250 7:76258272-76258294 CTGGAGGAAAGGAGGGGAAGCGG + Intronic
1027305519 7:76892321-76892343 CTGTAGGAAGGTGGGGGAGCTGG + Intergenic
1027335149 7:77142561-77142583 CTGTTGTAAGGTGGGGGAAGGGG - Intronic
1027495962 7:78888164-78888186 CTGCAGGAAGGCTGGGGGAGGGG + Intronic
1027770992 7:82406036-82406058 CTGTCGTAGGGTTGGGGGAGGGG - Intronic
1027872994 7:83733048-83733070 TTGGAGGAAGGTTAGGTAAGGGG - Intergenic
1028331864 7:89604844-89604866 TTGTAGGAAGGAGGGAGAAGAGG - Intergenic
1028436725 7:90812461-90812483 CTGTTGTGGGGTTGGGGAAGGGG + Intronic
1028750008 7:94372462-94372484 CTGTAGGCAGCTTTGGGAAGTGG - Intergenic
1029133963 7:98355224-98355246 CTGCAGGAAGGTTTGGGCTGTGG + Intronic
1029386028 7:100244279-100244301 CTCTTGGAAGTTTGGGGAACAGG - Intronic
1029423639 7:100484032-100484054 GTGCAGGAAGGTTGGGGTGGGGG + Intronic
1029780643 7:102728537-102728559 CTGTTGTGAGGTGGGGGAAGCGG + Intergenic
1030603102 7:111611451-111611473 CAGTAAGCAGGTTGGGGAATGGG - Intergenic
1030660593 7:112214692-112214714 GTGAAGGGAGGTTGGGAAAGAGG + Intronic
1031143309 7:117969544-117969566 CTGTTGTGGGGTTGGGGAAGGGG + Intergenic
1032603687 7:133326914-133326936 CAGCAGCAAGGCTGGGGAAGGGG - Intronic
1033619174 7:143047134-143047156 CTGTAAGAAGGTTCAGAAAGGGG + Intergenic
1033787881 7:144756149-144756171 CTGTCGTAGGGTTGGGGGAGTGG - Intronic
1034265254 7:149777615-149777637 CTGCAGGAGGGCTGGAGAAGAGG - Intergenic
1035061151 7:156070633-156070655 CTGCAGGAAGGGAGGGGAGGCGG - Intergenic
1035275432 7:157745421-157745443 CGGGAGGCAGGTTGGGGGAGAGG + Intronic
1035471088 7:159109342-159109364 CGGCAGGGAGGTTGGGGGAGTGG + Intronic
1035835751 8:2750050-2750072 ATGTAGGAAGGTCAGGGTAGGGG - Intergenic
1036109139 8:5878557-5878579 CTGGAGGAAGGGTGAGGGAGTGG - Intergenic
1036384937 8:8270615-8270637 CTGTGGGTAGGGTGGGGCAGAGG - Intergenic
1036630694 8:10512534-10512556 CTGTAGGATCCTTGAGGAAGGGG - Intergenic
1036943365 8:13071823-13071845 CTGAAGGATGGTGGAGGAAGGGG - Intergenic
1037409893 8:18585264-18585286 CTGTAGGAAGATTGTGAAAAGGG + Intronic
1037447002 8:18975129-18975151 GGGTTGGAAGGGTGGGGAAGAGG + Intronic
1037928657 8:22864892-22864914 GTGTGGGAAGGTCGGGGCAGGGG + Intronic
1038154480 8:24975779-24975801 CTGTGAGAAGATTGGGGAAGAGG - Intergenic
1038853173 8:31300474-31300496 CACCAGGAAGGTTGGGGATGGGG - Intergenic
1038877853 8:31571333-31571355 CTGTAGTGGGGTTGGGGGAGGGG + Intergenic
1041130297 8:54691963-54691985 CTGTTGTAGGGTTGGGGGAGGGG - Intergenic
1041146825 8:54884798-54884820 CTGTTGGGGGGTTGGGGAGGAGG + Intergenic
1041163525 8:55069379-55069401 CTGAAGTTAGCTTGGGGAAGGGG + Intergenic
1041682992 8:60612125-60612147 CTGTAGGGAGGTTGGGGAAAAGG - Intronic
1042193389 8:66210855-66210877 CTGGAGGAGATTTGGGGAAGGGG - Intergenic
1042801424 8:72722204-72722226 GTGCAGGAAGGTTGGTGAGGAGG - Intronic
1042960493 8:74298738-74298760 TTGTAGGAAAGTTAGGAAAGTGG - Intronic
1044610232 8:94084432-94084454 CTGTTGGGAGGTGGGGGATGAGG - Intergenic
1045708734 8:104958776-104958798 CTGTTGTGAGGTTGGGGAAGTGG - Intronic
1046100612 8:109610088-109610110 CTTAAGGAGGGTTGGGGATGGGG - Intronic
1047295456 8:123566812-123566834 CTGGAGGGTGGTGGGGGAAGGGG + Intergenic
1047718778 8:127619755-127619777 CAGTATGAATGTTGGAGAAGTGG - Intergenic
1048098902 8:131325414-131325436 CTGTTGTGAGGTTGGGGGAGAGG + Intergenic
1048419062 8:134259168-134259190 TTTTAGGAATGTGGGGGAAGGGG - Intergenic
1048859008 8:138709631-138709653 CTGTAGTAGGGTGGGGGGAGGGG + Intronic
1049595335 8:143480830-143480852 TGGCAGGAAGGCTGGGGAAGGGG + Intronic
1049745209 8:144260373-144260395 GTGTAGGCTGGTTGGGGCAGGGG + Exonic
1049887265 9:35993-36015 AAGTTGGAAGGCTGGGGAAGGGG + Intergenic
1050280310 9:4043500-4043522 CTGTAGGAAGGGCTGGGAAGGGG + Intronic
1050392147 9:5155319-5155341 CTGTTGCAGGGTTGGGGGAGGGG + Intronic
1050589895 9:7150029-7150051 CTGTAGAAAGGGAGAGGAAGGGG + Intergenic
1050943430 9:11488325-11488347 TTCTTGGATGGTTGGGGAAGGGG + Intergenic
1051265373 9:15304638-15304660 CGGGGGGGAGGTTGGGGAAGAGG - Intronic
1051696988 9:19779195-19779217 CTATAGGAAGATTGGGGTAGAGG + Intronic
1052531241 9:29686634-29686656 CTGCAGTGAGGTTGGGGAAAGGG + Intergenic
1053062079 9:35039988-35040010 TTGGATGGAGGTTGGGGAAGTGG - Intergenic
1053146349 9:35714731-35714753 CTCTAGGAAGGATGTGGGAGTGG - Intronic
1053179924 9:35960135-35960157 CTGTATGAAGGGATGGGAAGAGG - Intergenic
1055175349 9:73311924-73311946 CTGTAGGAAGGTAGGGGGCTAGG + Intergenic
1055230721 9:74061686-74061708 CTGTCAGAAGGTGGGGGAATGGG - Intergenic
1056788127 9:89606882-89606904 CTGTAGGAGGGAGGGGGAGGAGG - Intergenic
1056893395 9:90517266-90517288 CTGCAGGATGGTGGGGGATGAGG - Intergenic
1057741866 9:97719085-97719107 CTTTAGGAAGCTGAGGGAAGAGG + Intergenic
1057866810 9:98687847-98687869 CTGTAGGAAGGAGGGTGAAGGGG + Intronic
1057908350 9:98999372-98999394 CTGCAGGAAGGTGGTGGGAGGGG + Intronic
1058002514 9:99880575-99880597 CTGTCGTGAGGTGGGGGAAGGGG - Intergenic
1058185819 9:101853341-101853363 CTGTTGGATGGTGGGGGATGAGG + Intergenic
1058229414 9:102407532-102407554 CTGTTGAAAGGTAGGGGGAGGGG + Intergenic
1058817140 9:108694730-108694752 CTGTAGGGAGGTTGGGGGCAAGG + Intergenic
1059555350 9:115275583-115275605 CTGTGTGAAGCTGGGGGAAGGGG + Intronic
1059745648 9:117198176-117198198 CTGTTGGAGGGTTGGGGGTGAGG - Intronic
1060254121 9:122011923-122011945 CAGAAGGAAGGTGGGAGAAGAGG + Intronic
1060401005 9:123349628-123349650 TTGTAGGAAGGCTCAGGAAGGGG + Intergenic
1060547533 9:124470060-124470082 GTGGAGGATGGGTGGGGAAGGGG - Intronic
1060767216 9:126304078-126304100 GTGCAGGGAGGTTGGGGGAGAGG - Intergenic
1060976872 9:127770246-127770268 CAGGAGGAAGGAAGGGGAAGAGG - Intronic
1061482753 9:130905199-130905221 CTGTGGCAGGGATGGGGAAGGGG - Intronic
1061574309 9:131496609-131496631 CAGCAGGCAGGTTGGGGGAGGGG + Exonic
1062612220 9:137380393-137380415 CTGGAGGGGGGTTGGGGAGGAGG - Intronic
1203537922 Un_KI270743v1:59690-59712 CTGTTGGGGGGTGGGGGAAGGGG + Intergenic
1185872146 X:3673324-3673346 CTGTAGGGAGGTGGTGGCAGGGG + Intronic
1186862160 X:13683307-13683329 CTGTTGTAGGGTGGGGGAAGGGG + Intergenic
1186882275 X:13878340-13878362 CAATGGGAAGGTGGGGGAAGGGG + Intronic
1186886680 X:13921311-13921333 CTGTAGGAAGGTTTGGGATTTGG - Intronic
1186968030 X:14809610-14809632 CGGCAGGCAGGCTGGGGAAGGGG + Intergenic
1187303913 X:18077741-18077763 CTCTAGGAGGGATGGGGTAGGGG + Intergenic
1187639143 X:21268196-21268218 GACTAGGAAGGTTGGGCAAGTGG - Intergenic
1187918923 X:24182152-24182174 GTGGGGGAAGGTGGGGGAAGGGG + Intronic
1187945616 X:24423796-24423818 CAGCAGGCAGGTTGGGAAAGAGG + Intergenic
1188035720 X:25315559-25315581 CAGCAGCAAGGCTGGGGAAGGGG - Intergenic
1188336790 X:28945593-28945615 CAGTTGGAGGGTTGGGGATGAGG + Intronic
1188807104 X:34605077-34605099 CAGTAGGAAGGATGGGGAGCTGG - Intergenic
1189365365 X:40383884-40383906 TTCTGGGAAGGTTGGGGATGGGG + Intergenic
1190107037 X:47568435-47568457 CTGTAGGCAGGGAGGGGGAGGGG + Intronic
1190260720 X:48795241-48795263 GAGTGGGAATGTTGGGGAAGGGG - Intergenic
1190623197 X:52309308-52309330 CTGTTGTGAGGTGGGGGAAGGGG + Intergenic
1191117823 X:56869418-56869440 CTGCAGCAAGGCTGGGGGAGGGG + Intergenic
1191134511 X:57049337-57049359 CAGCAGCAAGGCTGGGGAAGGGG + Intergenic
1191606256 X:63065942-63065964 CCGGAGGTTGGTTGGGGAAGGGG + Intergenic
1192697626 X:73434313-73434335 CGGCAGCAAGGTTGGGGGAGGGG - Intergenic
1192967227 X:76191382-76191404 CTGTTGTAGGGTTGGGGGAGGGG + Intergenic
1193002978 X:76583542-76583564 CAGCAGCAAGGCTGGGGAAGGGG - Intergenic
1193033516 X:76924779-76924801 CGGTAGCGAGGTTGGGGGAGGGG + Intergenic
1193983073 X:88208305-88208327 CTGCAGCAAGGCTGGGGGAGGGG + Intergenic
1195110935 X:101648460-101648482 CTGTTGTAGGGTTGGGGGAGTGG + Intergenic
1195151116 X:102071464-102071486 GTGTGTGAAAGTTGGGGAAGCGG + Intergenic
1195564649 X:106326605-106326627 CTGGAGCATGTTTGGGGAAGGGG - Intergenic
1195672876 X:107484138-107484160 CTATAGGAAAGTGGGGGCAGTGG - Intergenic
1195884786 X:109626479-109626501 CTGAAGAACGGTTGGGGAAGAGG - Intronic
1195932849 X:110096393-110096415 CGGCAGCAAGGCTGGGGAAGGGG - Intronic
1196002655 X:110803365-110803387 CTGTCGTGGGGTTGGGGAAGGGG - Intergenic
1196600611 X:117597715-117597737 CTGTTGTGAGGTGGGGGAAGGGG + Intergenic
1197251262 X:124218445-124218467 CTGGAGAAAGGATGGGGGAGAGG + Intronic
1197542966 X:127789205-127789227 CAGCAGCAAGGCTGGGGAAGGGG + Intergenic
1197574854 X:128199357-128199379 CGGCAGGAAGGCTGGGGGAGGGG + Intergenic
1198194482 X:134346135-134346157 CTGTTGGAAGGTAGGGGAGTAGG - Intergenic
1198415915 X:136419452-136419474 ATATGGGAAGGTTGGGGAGGGGG + Intergenic
1200090660 X:153634374-153634396 CTGTAGGTAGGATGGGGCAGTGG - Intergenic
1200441223 Y:3214466-3214488 CTGTAGTGGGGTTGGGGGAGGGG + Intergenic
1201291336 Y:12423364-12423386 CCATAGGAAGGTTGAGGAAGGGG - Intergenic
1202026430 Y:20528619-20528641 CTGCAGCAAGGCTGGGGGAGGGG + Intergenic